| effect of some natural pesticides on entomogenous muscardine fungi. | five commercial preparations of natural pesticides were tested for in vitro compatibility with muscardine fungi, beauveria brongniartii and metarhizium anisopliae. neemark (azadirachtin) was found compatible with both the fungi. phytoallexin, the natural fungicide, significantly inhibited the growth of both the fungi, while other natural pesticides showed moderate to severe inhibition. | 1992 | 1459622 |
| [method of biological control of triatominae, vectors of chagas disease, using entomopathogenic hyphomycetes. preliminary study]. | bioassays determined the pathogenic activity of 14 strains of 5 entomopathogenic hyphomycetous species (fungi imperfecti), beauveria bassiana, beauveria brongniartii, metarhizium anisopliae, nomuraea rileyi and paecilomyces fumosoroseus to rhodnius prolixus. treatments consisted of direct spraying with conidial titrated suspensions on first instar larvae. when tested at 3 x 10(5) conidia/cm2, only 2 strains, b. bassiana n. 297 and b. bassiana n. 326 killed 100% of larvae at 10 days post-exposure ... | 1987 | 3111731 |
| identification of group-i introns in the 28s rdna of the entomopathogenic fungus beauveria brongniartii. | the length of the 28s ribosomal dna differs significantly between two strains (bt102 and bt114) of the entomopathogenic fungus beauveria brongniartii. rflp analysis on pcr products revealed the presence of three insertional elements of 350-450 bp in strain bt114. one of the insertions has been cloned and sequenced and shown to possess all the characteristic sequences and secondary structures of a group-ic intron. its length is 428 bp and it is devoid of any long open reading frame. the distribut ... | 1994 | 7750145 |
| identification and differentiation of the entomopathogenic fungus beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis. | a series of genomic dna probes which exhibit specificity for beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal dna (hegedus and khachatourians, 1993a). to improve the sensitivity of a dna-based monitoring system for detection of this entomopathogenic fungus we have developed a pcr-based method. using sequence information from a region of the b. bassiana-specific probe pbb22, primers p1 (5'aagcttcgacatggtctg) and p3 (5ggaggtggtgaggttctgtt) were generated. th ... | 1996 | 8812610 |
| 28s rdna group-i introns: a powerful tool for identifying strains of beauveria brongniartii. | the nuclear ribosomal dna of the entomopathogenic fungus beauveria brongniartii is polymorphic in terms of both restriction site and length. insertions of 350-450 bp long, identified as group-i introns, were detected in the 28s rdna. a panel of 47 strains of b. brongniartii, two b. bassiana and one metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. twelve ty ... | 1997 | 9131812 |
| allelic variation of a beauveria bassiana (ascomycota: hypocreales) minisatellite is independent of host range and geographic origin. | the minisatellite locus, bbmin1, was isolated from a partial beauveria bassiana genomic library that consisted of poly(ga) flanked inserts. polymerase chain reaction (pcr) of the bbmin1 repeat demonstrated allele size variation among 95 b. bassiana isolates. amplification was also observed from single isolates of beauveria amorpha, beauveria brongniartii, and beauveria caledonica. eight alleles were identified at the haploid locus, where repeat number fluctuated between one and fourteen. amova a ... | 2002 | 11908654 |
| the effect of application time and soil factors on the occurrence of beauveria brongniartii applied as a biological control agent in soil. | the effects of abiotic and biotic soil factors on occurrence of the entomopathogenic fungus beauveria brongniartii after application at different times of the year were examined in switzerland. applications made from may to august generally resulted in an increase of 1-5 x 10(3) cfu g(-1) dry soil compared to untreated control plots. conversely, soils treated in october and november yielded no increase. soil temperatures between 20 and 25 degrees c, and high clay content of the soil had a positi ... | 2003 | 13678708 |
| accurate determination of oosporein in fungal culture broth by differential pulse polarography. | a simple and accurate differential pulse polarographic method has been developed for the determination of oosporein in the culture broth of the fungus beauveria brongniartii. this hydroxybenzoquinone derivative is the only major secondary metabolite secreted by this entomopathogenic fungus, which is used as biological pest control agent (bca) against melolontha melolontha larvae. it can be found in the host organism as well as in the formulated product. the polarographic behavior of oosporein wa ... | 2004 | 15030190 |
| beauveria brongniartii subjected to spray-drying in a composite carrier matrix system. | the negative aspects of chemical pesticides are of growing concern to the public. thus, there is a strong effort to exploit environmentally friendly possibilities for pest management. one strategy is the application of biocontrol agents such as the fungus beauveria brongniartii. in this context, the central objective of the research presently described is to investigate spray drying as a preservation method for fungal conidia to obtain a practical formulation for spray application. an aqueous bi ... | 2004 | 15204598 |
| high-performance liquid chromatography-diode array detection assay for the detection and quantification of the beauveria metabolite oosporein from potato tubers. | a high-performance liquid chromatography-diode array detection (hplc-dad) assay is described for the detection and quantification of the secreted beauveria brongniartii metabolite oosporein from potato tubers. analyte recovery was achieved with a britton-robinson buffer system at ph 5.5 diluted with methanol 3:7 (v/v) (br5.5-meoh). an internal standard protocol using 2-iodobenzoic acid was established to minimize analytical error. the resulting assay, using a binary solvent gradient with acidic ... | 2005 | 16199235 |
| identification of molecular variants in mitochondrial dnas of members of the genera beauveria, verticillium, paecilomyces, tolypocladium, and metarhizium. | a set of five mitochondrial (mt) probes derived from a strain of beauveria bassiana was used to evaluate the similarity of mtdnas from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. the probes and genes encoded for (shown in parentheses) were pbbmte2 (nadi, atp6), pbbmte3 (atp6, small rrna [srrna]), pbbmte4 (srrna, co3, nad6), pbbse1 (nad6, trna, large rrna [lrrna]), and pbbxs1 (lrrna). the probes produced identical hybridization patterns in ecori-digested ... | 1993 | 16349124 |
| nucleotide excision repair and photoreactivation in the entomopathogenic fungi beauveria bassiana, beauveria brongniartii, beauveria nivea, metarhizium anisopliae, paecilomyces farinosus and verticillium lecanii. | to compare the dna repair capabilities of the entomopathogenic fungus (epf) bassiana to the epf beauveria brongniartii, beauveria nivea, metarhizium anisopliae, paecilomyces farinosus, verticillium lecanii, and the fungi aspergillus niger and neurospora crassa. | 2006 | 16629997 |
| persistence and efficacy of beauveria brongniartii strains applied as biocontrol agents against melolontha melolontha in the valley of aosta (northwest italy). | to monitor and select genetically characterized strains of beauveria brongniartii to be used as microbiological control agents against melolontha melolontha in different climatic conditions of the valley of aosta (northwest italy). | 2006 | 16630007 |
| [biological characteristics of metarhizium anisopliae var. major and its virulence to white grubs]. | with beauveria brongniartii and metarhizium anisopliae var. anisopliae as the reference, this paper studied the biological characteristics and invading ability of metarhizium anisopliae var. major, a new variety separated from white grubs. the results showed that the optimal culture condition of m. anisopliae var. major was similar with that of other entomopathogenic species, and the optimal temperature was 25 degrees c. among the three test media, ppda was the most appropriate one, followed by ... | 2006 | 16706069 |
| a new cuticle scale hydrolysing protease from beauveria brongniartii. | from a screening for the production of new proteases specific for cuticle scales, beauveria brongniartii was selected producing an alkaline ca(++) dependent protease. the purified had a molecular weight of 27 kda and a pi value of 8.0. substrate specificities of model substrates (wool with partially removed cuticles treated with sds) were analyzed by protein release, dissolved organic carbon (doc) and nitrogen analysis. the c/n ratio of released material turned out to be a good parameter to dete ... | 2006 | 16791724 |
| cloning a cuticle-degrading serine protease gene with biologic control function from beauveria brongniartii and its expression in escherichia coli. | beauveria brongniartii extracellular subtilisin-like serine protease (pr1) is one of the most virulent factors by virtue of its activity against insect cuticles. the pr1 cdna was cloned using the switching mechanism at the 5' end of the rna transcript and rapid amplification of cdna ends. the 1732-bp fragment of genomic dna containing the predicted open-reading frame of the pr1 gene was cloned by polymerase chain reaction and sequenced. the pr1 cdna is 1550 bp and contains an 1140-bp orf. the de ... | 2006 | 16832726 |
| mass production, survival and evaluation of solid substrate inocula of beauveria brongniartii (saccardo) petch against holotrichia serrata (coleoptera: scarabaeidae). | the entomopathogenic fungus beauveria brongniartii (saccardo) petch has emerged as a promising biological control agent for soil-inhabiting scarabs including holotrichia serrata f., a serious constraint to the production of rainy season (july-october) crops in india. use of these fungi in practical biocontrol programmes will require production of large amounts of inoculum. in the present study, a two-stage system of mass production method was used to produce infective propagules in which fungal ... | 2006 | 17385511 |
| in vitro susceptibility to fungicides by invertebrate-pathogenic and saprobic fungi. | the effect of five fungicides, benomyl (1 mg/l), dodine (50 mg/l), manzate (100 mg/l), cupric sulphate (200 mg/l) and thiabendazole (4 mg/l) was tested under in vitro conditions on development of 15 isolates of fungi pathogenic for insects and other invertebrates (beauveria brongniartii, culicinomyces clavisporus, duddingtonia flagrans, hirsutella thompsonii, two metarhizium anisopliae, nomuraea rileyi, two isaria/paecilomyces spp., and sporothrix insectorum) and 13 isolates of contaminant fungi ... | 2007 | 17574540 |
| [pathogenicity of several fungal species on spodoptera litura]. | the virulence test of five species of entomogenous fungi beauveria brongniartii, beauveria bassiana, paecilomyces fumosoroseus, metarhizium anisopliae and nomuraea rileyi to spodoptera litura larvae showed that b. brongniartii and n. rileyi had evident pathogenic effects on s. litura, with the lt50 value to s. litura 2nd instars being 2.95 and 4.10 days, and the corrected accumulative mortality of the instars being 100% and 95.2%, respectively. the virulence of b. brongniartii and n. rileyi to t ... | 2007 | 17615897 |
| cultivation-independent analysis of fungal genotypes in soil by using simple sequence repeat markers. | cultivation-independent analyses of fungi are used for community profiling as well as identification of specific strains in environmental samples. the objective of the present study was to adapt genotyping based on simple sequence repeat (ssr) marker detection for use in cultivation-independent monitoring of fungal species or strains in bulk soil dna. as a model system, a fungal biocontrol agent (bca) based on beauveria brongniartii, for which six ssr markers have been developed, was used. speci ... | 2007 | 17720832 |
| defense mechanism of the termite, coptotermes formosanus shiraki, to entomopathogenic fungi. | termites, coptotermes formosanus shiraki, reared individually, were highly susceptible to entomopathogenic fungi, paecilomyces fumosoroseus and beauveria brongniartii and metarhizium anisopliae, while termites reared in groups were highly resistant. quantitative assays with an epifluoresent microscope revealed a significant difference in the number of conidia attachments among three entomopathogenic fungi. the conidia of b. brongniartii and p. fumosoroseus bound to termite cuticles more effectiv ... | 2008 | 17949740 |
| community composition, host range and genetic structure of the fungal entomopathogen beauveria in adjoining agricultural and seminatural habitats. | although intensively investigated for biological control of insect pests, little is known about the ecology of the fungal entomopathogenic genus beauveria in natural or agricultural habitats. in this study, we used molecular phylogenetic and genotypic information to infer species diversity, reproductive potential and genetic structure of beauveria occurring within a single arable field and bordering hedgerow in denmark. isolates were sampled from cultivated field and hedgerow soils, from insects ... | 2009 | 19226319 |
| the role of antennae in removing entomopathogenic fungi from cuticle of the termite, coptotermes formosanus. | our previous research has shown that the termite, coptotermes formosanus shiraki (isoptera: rhinotermitidae), protects itself from entomopathogenic fungi by mutual grooming behavior. the termite removes and discards foreign organisms, such as fungal conidia, from the body surface of its nestmates by mutual grooming behavior. the role of the antennae in detecting the condia was examind here. three entomopathogenic fungi were used, beauveria brongniartii 782 (saccardo) (hypocreales), paecilomyces ... | 2009 | 19611249 |
| carbon utilization pattern as a potential quality control criterion for virulence of beauveria brongniartii. | the registered entomopathogenic fungus beauveria brongniartii (bipesco 2) was tested for its virulence after one, five and 10 times sub-culturing on four types of selective synthetic nutrient media. bioassays with third instar melolontha melolontha larvae showed that sub-culturing negatively affects the virulence of the fungus after 10 transfers. with the biolog sf-p2 and biolog sf-n2 microtiter plate systems the sub-cultivated b. brongniartii conidia were monitored for any change in the carbon ... | 2010 | 20123102 |
| preservation of aerial conidia and biomasses from entomopathogenic fungi beauveria brongniartii and metarhizium anisopliae during lyophilization. | in this study, we assessed the stability provided by different formulations to aerial conidia or biomasses (conidia, blastospores, and mycelia) of beauveria brongniartii and metarhizium anisopliae subjected to lyophilization. first, the impact of the freezing and drying processes on spore survival was evaluated. whereas unprotected b. brongniartii spores showed high cryosensitivity, those of m. anisopliae were markedly harmed by the drying process. then, the protective efficiency of 14 excipient ... | 2010 | 20457163 |
| diversity of rhizosphere associated entomopathogenic fungi of perennial herbs, shrubs and coniferous trees. | understanding habitat selection of fungal entomopathogens is critical to improve the efficacy, persistence and cost of these fungi as microbial insecticides. this study sought to determine the prevalence of metarhizium and beauveria spp. isolated from the rhizosphere of strawberry, blueberry, grape and christmas tree crops in the willamette valley of oregon. entomopathogenic fungi were assigned to thirteen species based on molecular phylogenetic criteria. four species of metarhizium were isolate ... | 2010 | 21056569 |
| influence of fungal odor on grooming behavior of the termite, coptotermes formosanus. | the termite coptotermes formosanus shiraki (isoptera: rhinotermitidae) protects itself from entomopathogenic fungus by mutual grooming behavior. c. formosanus removes foreign organisms, such as fungal conidia, from the body surface of its nestmates by mutual grooming behavior and eating them. the conidia removal rate from the body surface differed according to the isolate of entomopathogenic fungi (beauveria brongniartii 782, paecilomyces fumosoroseus k3, and metarhizium anisopliae 455), and the ... | 2010 | 21073347 |
| in vivo interactions of entomopathogenic fungi, beauveria spp. and metarhizium anisopliae with selected opportunistic soil fungi of sugarcane ecosystem. | in the present study, the interactions of entomopathogenic fungi viz., beauveria bassiana, beauveria brongniartii and metarhizium anisopliae among themselves and three other opportunistic soil fungi from the sugarcane ecosystem namely, fusarium saachari, aspergillus sp. and penecillium sp. were assayed in vivo against galleria mellonella larvae. the tested fungi were co-applied on iv instar g. mellonella @ 1 x 10(7) ml(-1), in combinations of two, at the interval of 24 hrs either preceding or su ... | 2012 | 23359998 |
| cellular apoptosis of hemocytes from dendrolimus tabulaeformis tsai et liu larvae induced with the secondary metabolites of beauveria brongniartii (sacc.) petch. | to investigate the effect of the secondary metabolites of entomopathogenic fungus on the hemocyte immunity of host insect, the secondary metabolite complex (smc) of beauveriabrongniartii was used in three concentrations (5.5, 55, and 550 µg/ml), and the 4(th) instar larvae of the pine caterpillar dendrolimustabulaeformis were employed as host insects. the larvae were inoculated with the smc solutions by injection in bioassays. apoptosis of the larval hemocytes was observed using fluorescence mic ... | 2013 | 23940771 |
| microbial diversity and dynamics during the production of may bryndza cheese. | diversity and dynamics of microbial cultures were studied during the production of may bryndza cheese, a traditional slovak cheese produced from unpasteurized ewes' milk. quantitative culture-based data were obtained for lactobacilli, lactococci, total mesophilic aerobic counts, coliforms, e. coli, staphylococci, coagulase-positive staphylococci, yeasts, fungi and geotrichum spp. in ewes' milk, curd produced from it and ripened for 0 - 10 days, and in bryndza cheese produced from the curd, in th ... | 2014 | 24291178 |
| evaluation of insect associated and plant growth promoting fungi in the control of cabbage root flies. | delia radicum l. or cabbage maggot is an important pest for brassicaceous crops. there are currently no registered chemical control agents for its control in slovenia. fungal control agents for cabbage maggot were therefore sought among nine rhizosphere-compatible and plant growth-promoting, soil-adapted, and entomopathogenic species to cabbage maggots and were assayed in in vitro and soil laboratory bioassays. in the in vitro tests, the conidial suspensions were applied directly to cabbage magg ... | 2014 | 25195421 |
| beauveria brongniartii on white grubs attacking sugarcane in south africa. | beauveria brongniartii (saccardo) petch fungal infections were observed on the melolonthid hypopholis sommeri burmeister (coleoptera: scarabaeidae) at two sites (harden heights and canema) in the sugarcane producing area of the northern kwazulu-natal midlands of south africa. to initially identify the disease-causing fungus, 17 different fluorescently-labelled microsatellite pcr primers were used to target 78 isolates of beauveria spp. dna. microsatellite data resolved two distinct clusters of b ... | 2012 | 22982079 |
| reduced entomopathogen abundance in myrmica ant nests-testing a possible immunological benefit of myrmecophily using galleria mellonella as a model. | social insects such as ants have evolved collective rather than individual immune defence strategies against diseases and parasites at the level of their societies (colonies), known as social immunity. ants frequently host other arthropods, so-called myrmecophiles, in their nests. here, we tested the hypothesis that myrmecophily may partly arise from selection for exploiting the ants' social immunity. we used larvae of the wax moth galleria mellonella as 'model myrmecophiles' (baits) to test thi ... | 2015 | 26587252 |
| description and phylogenetic placement of beauveria hoplocheli sp. nov. used in the biological control of the sugarcane white grub, hoplochelus marginalis, on reunion island. | on reunion island successful biological control of the sugarcane white grub hoplochelus marginalis fairmaire (coleoptera: melolonthidae) has been conducted for decades with strains from the entomopathogenic fungal genus beauveria (ascomycota: hypocreales). a study based on morphological characters combined with a multisequence phylogenetic analysis of genes that encode the translation elongation factor 1-alpha (tef1), rna polymerase ii largest subunit (rpb1), rna polymerase ii second largest sub ... | 2016 | 26297783 |
| prospects for the use of biological control agents against anoplophora in europe. | this review summarises the literature on the biological control of anoplophora spp. (coleoptera: cerambycidae) and discusses its potential for use in europe. entomopathogenic fungi: beauveria brongniartii petch (hypocreales: cordycipitaceae) has already been developed into a commercial product in japan, and fungal infection results in high mortality rates. parasitic nematodes: steinernema feltiae filipjev (rhabditida: steinernematidae) and steinernema carpocapsae weiser have potential for use as ... | 2015 | 25216358 |
| the effect of beauveria brongniartii and its secondary metabolites on the detoxification enzymes of the pine caterpillar, dendrolimus tabulaeformis. | the mortality of pine caterpillar, dendrolimus tabulaeformis tsai et liu (lepidoptera: lasiocampidae), larvae treated with beauveria brongniartii (saccardo) petch (hypocreales: clavicipitaceae) conidia and cell-free culture supernatants enriched for the secondary metabolites of the fungus was investigated. in addition, the effects of the treatments on the activities of two insect-related defense response proteins, glutathione s-transferase (gst) and esterase (est), were measured over time. bioas ... | 2013 | 23909949 |