| the degradation of the cuticle proteins of greater wax moth larvae (galleria mellonella) by toxic proteolytic enzymes, secreted by the entomophagous fungus beauveria bassiana (author's transl). | | 1976 | 8934 |
| crude oil utilization by fungi. | sixty fungal isolates, 34 obtained by a static enrichment technique from soils of northern canadian oil-producing areas and 26 from culture collections, were screened for their ability to grow on n-tetradecane, toluene, naphthalene, and seven crude oils of varying composition. forty cultures, including 28 soil isolates, were capable of growth on one or more crude oils. the genera most frequently isolated from soils were those producing abundant small condida, e.g. penicillium and verticillium sp ... | 1979 | 436012 |
| fatal mycotic pulmonary disease of captive american alligators. | fatal pulmonary disease occurred in two captive american alligators. the entomopathogenic fungus, beauveria bassiana, was isolated from pulmonary lesions in both alligators. an extended hibernation period because of a severe winter and a failure of the zoo heating system may have predisposed the alligators to infection. | 1979 | 452316 |
| fatal beauveria bassiana infection in a captive american alligator. | the entomopathogenic fungus, beauveria bassiana, was isolated from pulmonary lesions of a dead american alligator (alligator mississipiensis) at the oklahoma city zoo. colonies of the fungus, which had sporulated in vivo, were found in the thoracic air spaces. septate, branching hyphae and fungal spores were seen in stained histologic sections of pleura and lung. dissemination to other viscera had not occurred. this case indicated that b bassiana, a rare vertebrate pathogen, may be a fatal mycot ... | 1979 | 521377 |
| cyclodepsipeptides from beauveria bassiana bals. part 1. beauverolides h and i. | | 1977 | 557053 |
| [sedimentation of the conidia of beauveria bassiana (bals) vuill by aluminum sulfate]. | | 1977 | 559230 |
| use of 13c in biosynthetic studies. the labelling pattern in tenellin enriched from isotope-labelled acetate, methionine, and phenylalanine. | the biogenetic origin of the carbon atoms in tenellin has been established by adding 13c-enriched compounds to cultures of beauveria bassiana, and determining the isotopic distribution in the metabolite by 13c nuclear magnetic resonance spectrometry. tenellin is formed by condensation of an acetate-derived polyketide chain with a phenylpropanoid unit that may be phenylalanine. alternate carbon atoms of the polyketide chain were labelled with sodium [1(-13c)]- and [2-(13c]-acetate; sodium [1,2-(1 ... | 1977 | 560900 |
| [influence of clay on microorganisms conservation. i. ultrastructural study of the biodegradation of beauveria bassiana (bals). vuill. (entomopathogenous hyphomycete) in soil (author's transl)]. | blastospores of b. bassiana enclosed in fine mesh bags were submitted to soil microflora. clay minerals coating fungal spores protected from by decreasing bacterial activity. the role of amoeba in biodegradation of fungi is also considered. | 1977 | 563207 |
| [nature of the parasite-host relations of the entomopathogenic fungi, metarrhizium anisopliae (metsch.) sorokin and beauveria bassiana (bals.) vouill. (fungi imperfecti) to ceratophyllus fasciatus bosc. (siphonaptera) fleas]. | | 1978 | 567273 |
| noninvolvement of beauvericin in the entomopathogenicity of beauveria bassiana. | development of a microbiological autobiographic assay procedure permitted a detailed investigation of the possible role of beauvericin (a toxic ionophoric antibiotic produced by beauveria bassiana) in the entomopathogenicity of b. bassiana against corn earworm (heliothis zea) larvae. analysis of spent media of b. bassiana and the hemolymph of infected and moribund larvae revealed that beauvericin was not present in a soluble form during the time that most (about 90%) larvae died of fungal infect ... | 1979 | 573587 |
| [drosophila and the entomopathogenic fungus beauveria bassiana as a model for the study of host and parasite interrelationships]. | | 1975 | 810991 |
| age of three dipteran hosts as a factor governing the pathogenicity of beauveria bassiana and metarrhizium anisopliae. | | 1977 | 908836 |
| a mechanism of pathogenicity of beauveria bassiana on larvae of the imported fire ant, solenopsis richteri. | | 1976 | 932482 |
| defensive reactions of l3, l4 larvae of the colorado beetle to the insecticidal fungi paecilomyces farinosus (dicks) brown et smith, paecilomyces fumoso--roseus (wize), beauveria bassiana (bols/vuill.) (fungi imperfecti: moniliales). | | 1975 | 1238153 |
| hemagglutinins of beauveria bassiana strains: the effect of growth conditions on their production. | forty strains of beauveria bassiana were screened for their ability to produce hemagglutinins. it has been found that majority of mycelial extracts but not cultural broth display non specific hemagglutinating activity toward animal and human type ab and a, b, o erythrocytes when microorganisms are cultivated on rich in amino acids media supplemented with saccharose. the formation of hemagglutinins in mycelia is strongly dependent on composition of medium and associated with a production of extra ... | 1992 | 1340188 |
| purification and some properties of hemagglutinin from beauveria bassiana. | a novel hemagglutinin produced by insect pathogen beauveria bassiana was isolated from mycelium of the stationary growing microorganism and purified by adsorption on carboxymethyl cellulose followed by separation on spherogel tsk--phenyl 5 pw column using high performance liquid chromatography. the purified hemagglutinin was homogeneous in polyacrylamide gel electrophoresis and isoelectric focusing. its molecular weight was estimated to be around 25,000, isoelectric point was found at ph 8.6 +/- ... | 1992 | 1340189 |
| relative susceptibility of different stages of rhodnius prolixus to the entomopathogenic hyphomycete beauveria bassiana. | laboratory bioassays were conducted to determine the relative susceptibility of eggs, 1st-, 3rd-, 5th-instar nymphs and adults of rhodnius prolixus to one isolate of the entomopathogenic hyphomycete, beauveria bassiana. treatments consisted of directly spraying on insects of increasing doses of inoculum (3 x 10(2) to 3 x 10(5) conidia per cm2). mortality due to all doses of conidia was very high in the five tested stages of the target insect. experiments on eggs demonstrated that the fungal isol ... | 1992 | 1343645 |
| use of a colorimetric system to detect enzymes expressed by germinating conidia of entomopathogenic fungi. | an apizym system, with 19 substrates, was used to detect enzymes expressed by germinating conidia of nomuraea rileyi (5 isolates), nomuraea atypicola, nomuraea anemonoides, beauveria bassiana and metarhizium anisopliae. similar enzyme profiles were obtained for two of the n. rileyi isolates (mississippi, ecuador) regardless of whether culture medium (sabouraud-maltose-yeast) or cuticle (from larvae of trichoplusia ni, heliothis zea or heliothis virescens) were used as substrates. centroid-cluste ... | 1992 | 1406899 |
| effects of beauveria bassiana on embryos of the inland silverside fish (menidia beryllina). | a chemical toxicity and teratogenicity test was adapted to assess potential adverse effects of a microbial pest control agent on a nontarget fish. developing embryos of the inland silverside, menidia beryllina, were exposed to conidiospores of the insect-pathogenic fungus beauveria bassiana. embryo rupture and death were observed. embryo rupture did not always result in death, nor was death always associated with embryo rupture. adherence of spores to the chorion, followed by germination and pen ... | 1992 | 1444395 |
| pathogenicity of beauveria bassiana in mice. | the potential pathogenicity of beauveria bassiana was examined by intramuscular injection of high (2 x 10(8)) or low (2 x 10(5)) concentrations of conidia spores, into the left or right quadriceps muscles of cd-1 mice, respectively. the injection sites were monitored over a period of 28 days by both microbiological and histopathological methods. focal muscle necrosis, edema and inflammation occurred rapidly (within 12 hours) at the high dose application (2 x 10(8)) site, but such lesions were fa ... | 1992 | 1621478 |
| genomic analysis of a virulent and a less virulent strain of the entomopathogenic fungus beauveria bassiana, using restriction fragment length polymorphisms. | the genomic dna of two strains of the entomopathogenic fungus beauveria bassiana, strain gk2016, a "wild type" (virulent), and strain gk2051, a less virulent mutant to grasshoppers, was digested with 12 restriction endonucleases. gel electrophoresis conditions were established to show restriction fragment length patterns visually in the digested dna stained with ethidium bromide. the less virulent mutant was generated by ultraviolet illumination of conidiospores at a 95% lethal dose. both strain ... | 1991 | 1680543 |
| cloning and analysis of five mitochondrial trna-encoding genes from the fungus beauveria bassiana. | five mitochondrial (mt) trna genes from the filamentous fungus, beauveria bassiana, were cloned and sequenced. the genes encoding the val-, ile-, ser-, trp- and pro-accepting trnas were found clustered in the region 5' to the lrrna-encoding gene. the genes were 64-77% homologous with the equivalent genes from other filamentous fungi, 49-58% to yeasts with the exception of the val-accepting trna-encoding gene which was 76%, and only slightly homologous with escherichia coli. the b. bassiana mt ge ... | 1991 | 1756976 |
| formation of beauvericin by selected strains of beauveria bassiana. | various strains of beauveria bassiana were cultivated in submerged cultures and examined for their abilities to produce beauvericin, cyclodepsipeptide antibiotic displaying antibacterial and insecticidal properties. it has been found that among twenty four strains of beauveria bassiana only three produced beauvericin. apparently, the striking differences among tested strains concerning several secondary product formations have been observed. | 1991 | 1804050 |
| production of beauvericin by beauveria bassiana on l-methionine enriched medium. | beauveria bassiana strain isolated from curculionid beetle (coleoptera) was cultivated in fermentation tank on the medium composed of protein hydrolysate and glucose. it has been found that l-methionine addition to the medium increases significantly the yield of beauvericin biosynthesis. apparently, for the optimal antibiotic production, low aeration conditions are preferable. | 1991 | 1804051 |
| novel metabolite structures from biotransformation of a sesquiterpenoid ketone by selected fungal strains. | the sesquiterpenoid ketone, 1,4,4-trimethyltricyclo[5.4.0.0(3.5)]undec-7-en-9-one (1), was subjected to microbial transformation by six fungal strains: aspergillus niger atcc 9142, aspergillus ochraceus dsm 824, beauveria bassiana atcc 7159, cunninghamella echinulata atcc 9244, rhizopus arrhizus atcc 11.145, and absidia blakesleeana atcc 10.148. four main metabolites were formed from 1: 10(r)- and 10(s)-hydroxy-1,4,4-trimethyltricyclo-[5.4.0.0(3.5)]undec-7- en- 9-one (2 and 3, respectively), bes ... | 1991 | 1872996 |
| rrna sequence comparison of beauveria bassiana, tolypocladium cylindrosporum, and tolypocladium extinguens. | five strains of tolypocladium cylindrosporum, one strain of tolypocladium extinguens, and nine strains of beauveria bassiana were analyzed using a rapid rrna sequencing technique. the sequences of two highly variable domains (d1 and d2) located at the 5' end of the 28s-like rrna molecule were determined. the phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus beauveria and the genus tolypocladium and points out that t. cylindrospor ... | 1991 | 2002243 |
| larvicidal activity of blastospores and conidiospores of beauveria bassiana (strain gk 2016) against age groups of aedes aegypti. | laboratory bioassays of two development stages, blastospores (bs) and conidiospores (cs) of beauveria bassiana (strain gk 2016) against aedes aegypti larvae were conducted at 27 degrees c. in study 1, against 24 h post-hatched larvae, both bs and cs stages showed significant difference in their respective larvicidal efficacy over the control (p less than 0.0001). larval mortality between 24 and 96 h post-exposure was significantly higher than any other time period investigated. significantly hig ... | 1990 | 2251749 |
| glossina morsitans morsitans: mortalities caused in adults by experimental infection with entomopathogenic fungi. | various strains of the entomopathogenic fungi: beauveria bassiana, metarhizium anisopliae, paecilomyces fumosoroseus and p. farinosus were found to be pathogenic for adult tsetse, glossina morsitans morsitans but b. bassiana and m. anisopliae were the most pathogenic, often causing mortalities of up to 100%. dose-mortality relationships were demonstrated for both b. bassiana and m. anisopliae and male tsetse were observed to be more susceptible to infection than females. pure cultures of b. bass ... | 1989 | 2565071 |
| [experimental study on farmer's lung-like lesions caused by beauveria bassiana]. | 113 lung specimens from rats and mice were observed under both lm and tem, after inhalation of gonidiospores of beauveria bassiana for 18 months 78.8% of the 113 cases developed chronic interstitial pneumonia (ip). there were desquamative pneumonitis mainly with macrophage; granuloma with multinucleate giant cells or fibrosis, and localized pulmonary edema. these lesions were firstly described to be caused by the spores here. it was considered that if lesions might be related to types iii, iv hy ... | 1989 | 2582546 |
| [natural microbial control of crickets populations (orthoptera: gryllotalpidae: scapteriscus borellii): regulation of populations aggregated in time and space]. | from 1983 through 1988, a total of 1,762 collections, containing 31,312 individuals of the mole cricket, scapteriscus borellii, were made, principally in the state of são paulo, brazil. collections were found to fit a negative binomial distribution both as whole and when divided into monthly collections. in these collections, an iridovirus, a entomogenous nematode, and the fungi metarhizium anisopliae, beauveria bassiana, paecilomyces sp., and entomophtora sp., were found to be agents of natural ... | 1989 | 2640737 |
| [method of biological control of triatominae, vectors of chagas disease, using entomopathogenic hyphomycetes. preliminary study]. | bioassays determined the pathogenic activity of 14 strains of 5 entomopathogenic hyphomycetous species (fungi imperfecti), beauveria bassiana, beauveria brongniartii, metarhizium anisopliae, nomuraea rileyi and paecilomyces fumosoroseus to rhodnius prolixus. treatments consisted of direct spraying with conidial titrated suspensions on first instar larvae. when tested at 3 x 10(5) conidia/cm2, only 2 strains, b. bassiana n. 297 and b. bassiana n. 326 killed 100% of larvae at 10 days post-exposure ... | 1987 | 3111731 |
| [effect of entomopathogenic fungus inoculum on the control of corythycha ciliata say adults, wintering on plane-trees of city groves]. | within a three years research program, infection tests were carried on adults of corythucha ciliata wintering on the plane-trees of same city avenues, inoculating entomopathogenic deuteromycetes beauveria bassiana, verticillium lecanii, paecilomyces farinsus, microorganisms which are known to be naturally present in such an environment. inoculated fungi were able to settle only where the trees were free from any kind of disturbance, while this failed to occur in the areas of intense car traffic. ... | 1988 | 3274763 |
| the pathogenicity of beauveria bassiana in the rabbit cornea. | | 1987 | 3295537 |
| distribution of chymoelastases and trypsin-like enzymes in five species of entomopathogenic deuteromycetes. | nine isolates of the entomopathogenic deuteromycetes metarhizium anisopliae, beauveria bassiana, verticillium lecanii, nomuraea rileyi, and aschersonia aleyrodis produced basic (pi greater than 7.0) chymoelastases that possessed extended binding sites, comprising at least four or five subsites, with preference for hydrophobic residues at the primary binding site. most isolates also produced additional acidic enzymes with similar specificities against ester and amide substrates but which lacked a ... | 1987 | 3310895 |
| synthesis of beauvericin by a multifunctional enzyme. | beauvericin synthetase, a multifunctional enzyme catalyzing depsipeptide formation in beauveria bassiana was purified to near homogeneity. the enzyme consists of a single polypeptide chain with a molecular mass of about 250 kdaltons. the mechanism of beauvericin formation is very similar to that of the cyclohexadepsipeptide enniatin. the constituents of the beauvericin molecule, l-phenylalanine and d-alpha-hydroxyisovaleric acid are activated as thioesters via the corresponding adenylates. n-met ... | 1988 | 3366693 |
| microbial transformation studies on arteannuin b. | the microbial transformation of the sesquiterpene lactone arreannuin b [3] using aspergillus flavipes produced dihydroarteannuin b [4] as the main transformation product. preparative-scale fermentation of 3 with beauveria bassiana, on the other hand, has resulted in the production of two metabolites, 3 beta-hydroxyarteannuin b [5] and 13-hydroxy-11-epi-dihydroarteannuin b [6]. the structure of these metabolites, all of which are new compounds, was established using chemical and spectroscopic tec ... | 1987 | 3437286 |
| microbial transformation of azacarbazoles. ix. preliminary studies on hydroxylation of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline by paecilomyces flavinosus. | microbial transformation of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline performed with several strains of fungi beauveria bassiana, verticillum lecani and paecilomyces flavinosus yielded common products which were expected to be hydroxylated derivatives of starting compound. among the microorganisms tested, strain paecilomyces flavinosus p-5 was selected to perform quantitative bioconversion of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline for preparative scale. | 1987 | 3447531 |
| [genetics and selection of the entomopathogenic fungus beauveria bassiana (bals.) vuill. ii. virulence of auxotrophic mutants of beauveria bassiana on drosophila melanogaster]. | | 1973 | 4219928 |
| [biochemical features of four strains of the fungus beauveria bassiana]. | | 1974 | 4478020 |
| [effect of the medium ph on the growth and virulence of beauveria bassiana (bals.) vuill]. | | 1972 | 4676998 |
| [enzymic character of toxic substances released by the entomophagous fungus beauveria bassiana and their stimulation of their production]. | | 1973 | 4740802 |
| genetics and selection of the entemopathogenic fungus beauveria bassiana (bals.) vuill. communication i. lethal and mutagenic effects of ultraviolet and x-rays. | | 1973 | 4807847 |
| [toxins of the entomophagous fungus beauveria bassiana. ii. effect of nitrogen sources on formation of the toxic protease in submerged culture]. | | 1971 | 4930316 |
| phenol oxidase activity in the integument of the silkworm bombyx mori infected with beauveria bassiana and spicaria fumoso-rosea. | | 1970 | 4993487 |
| [the effect of aeration on the development of the entomopathogenic fungus beauveria bassiana (bals) vuill. in submerged cultures]. | | 1972 | 5077290 |
| [mass culture of the insect pathogen fungus beauveria bassiana (bals) vuill]. | | 1970 | 5531111 |
| field and laboratory studies on the pathogenicity of the fungus beauveria bassiana to three genera of mosquitoes. | | 1968 | 5654770 |
| infection of the alfalfa weevil, hypera postica, by the fungus beauveria bassiana. | | 1968 | 5654771 |
| toxins of the entomophagous fungus beauveria bassiana. | | 1968 | 5752486 |
| microbial transformations of steroids. xxv. the effect of substituents on the direction of the transformation of steroids by beauveria bassiana. | | 1966 | 5916363 |
| biosynthesis of oosporein in beauveria bassiana (bals.) vuill. | | 1966 | 6006742 |
| the effect of certain insecticides on the entomogenous fungi beauveria bassiana and metarrhizium anisopliae. | | 1967 | 6064157 |
| [submerged culture of the fungus beauveria bassiana]. | | 1983 | 6228339 |
| hemocyte lysate enhancement of fungal spore encapsulation by crayfish hemocytes. | crayfish hemocytes exhibited a stronger encapsulation reaction to fungal blastospores of beauveria bassiana coated with hemocyte lysate, than to blastospores treated with plasma or buffer, indicating an opsonic function of hemocyte lysate proteins. five proteins of the prophenoloxidase activating system in the hemocytes were attached to foreign surfaces (including the blastospores) after activation and it is suggested that these attaching proteins (one being phenoloxidase) are responsible for th ... | 1984 | 6427033 |
| cell-free synthesis of the depsipeptide beauvericin. | the enzymatic formation of the cyclodepsipeptide beauvericin was demonstrated in cell-free extracts from beauveria bassiana. in analogy to the enniatin synthetase system formation of beauvericin is strictly dependent on the presence of the constituent amino and hydroxy acid, s-adenosylmethionine, and atp/mg2+. synthesizing activity could be enriched about 12-fold by fractional ammonium sulfate precipitation. besides the enniatin synthetase system this represents another example of the cell-free ... | 1983 | 6686599 |
| effect of soil fungistasis on zoopathogenic fungi. | the inhibiting action of west-siberian soils on spore germination and the growth and development of zoopathogenic fungi such as emmonsia (chrysosporium) crescens , trichophyton mentagrophytes, beauveria bassiana , metarrhizium anisopliae , paecilomyces farinosus , p. fumoso -roseus and chrysosporium keratinophilum have been studied by the authors. the influence of carbon sources and the root exudates of plants on fungistasis have also been studied. | 1984 | 6727979 |
| inhibitory effect of bassianolide, a cyclodepsipeptide, on drug-induced contractions of isolated smooth muscle preparations. | bassianolide (bass) is a cyclodepsipeptide isolated from cultured mycelia of beauveria bassiana and is pathogenic to insects. in a longitudinal muscle preparation from guinea pig ileum, 10(-6) m bass almost irreversibly inhibited an isotonic contraction induced by acetylcholine (ach) and made the dose-response curve shift in parallel to the right (pa2: 7.6). it also inhibited the contractions induced by carbachol, pilocarpine, histamine, 5-hydroxytriptamine (5-ht) and prostaglandin e2, but did n ... | 1982 | 6953262 |
| antibacterial and antimycotic effect of a newly discovered secretion from larvae of an endoparasitic insect, pimpla turionellae l. (hym.). | the larvae of pimpla turionellae, that develop in pupae of various lepidoptera, discharged through their anus up to 8 microliters/h of a hyaline liquid, which is termed "anal secretion". it exerted a strong bacteriostatic effect on enterobacter cloacae, a highly virulent intestinal microorganism isolated from the midgut of the host pupa, pieris brassicae. growth inhibition of escherichia coli, micrococcus luteus and pseudomonas phaseolicola was also evident, but less pronounced. inhibition depen ... | 1982 | 7171286 |
| [studies on the pathogenesis of beauveria bassiana (author's transl)]. | | 1981 | 7341103 |
| investigation of the safety of industrial strains of microorganisms and microbial insecticides. | toxicology-hygienic studies of insecticidal preparations produced on the basis of fungi of the species beauveria bassiana and bacteria of the species bac. thuringiensis, recommended for use in plant-growing, were carried out. it has been established that the industrial strains of entomopathogenic microorganisms and insecticidal preparations produced on the basis of these microorganisms are harmless in the epidemiological sense and of low toxicity, but they may have a sensitizing effect on the hu ... | 1980 | 7462611 |
| mycotic pulmonary disease by beauveria bassiana in a captive tortoise. | a case of fatal pulmonary infection in a female tortoise (tachemys scripta) imported into spain from cuba is reported. necropsy revealed general pulmonary congestion with pleuritis and a large number of yellowish nodules of the granulomatous type, similar to aspergillomata. histological examination showed some infiltration of round cells, surrounding a small mass of fungal hyphae. culturing on sabouraud glucose agar, demonstrated the presence of a fungus whose macroscopic and microscopic charact ... | 1995 | 7477096 |
| keratinolysis and its morphological expression in hair digestion by airborne fungi. | the morphological expression of keratinolysis in fungi isolated from the air of torino (98 isolates belonging to 36 species) was studied. light microscopy on whole material and on semithin sections, as well as scanning electron microscopy was used. there were 19 keratinolytically active species, with seven in the genus chrysosporium (c. indicum, c. keratinophilum, c. pannicola, c. tropicum, c. an. arthroderma cuniculi, c. an. pectinotrichum llanense, c. an. renispora flavissima), four in the gen ... | 1994 | 7527126 |
| entomopathogenic fungi associated with ixodes ricinus ticks. | the objective of this study was to demonstrate the occurrence of entomopathogenic fungi on ixodes ricinus ticks in relation to the tick stage, engorgement and season. ticks were collected from the vegetation, from small rodents and from deer. all entomopathogenic fungi found belonged to the hyphomycetes. paecilomyces farinosus and verticillium lecanii were the predominant species. other species, found only on engorged females were: beauveria bassiana, b. brongniartii, p. fumosoroseus and v. aran ... | 1995 | 7621711 |
| an inner cell wall protein (cwp1) from conidia of the entomopathogenic fungus beauveria bassiana. | following the removal of the rodlet layer from aerial or submerged conidia of the entomopathogenic deuteromycetous fungus beauveria bassiana, sds-insoluble, formic-acid-extractable proteins were found in the residual cell wall material. two major proteins (12.8 and 14.0 kda) were extracted with formic acid from fractured aerial and submerged conidia but not from blastospores. oxidation of the sample extracted by formic acid resulted in a single protein band (15.4 kda) as judged by sds-page. anti ... | 1995 | 7773402 |
| manipulation of intracellular glycerol and erythritol enhances germination of conidia at low water availability. | the insect pathogens beauveria bassiana, metarhizium anisopliae and paecilomyces farinosus can be effective biocontrol agents when relative humidity (rh) is close to 100%. at reduced water availability, germination of propagules, and therefore host infection, cannot occur. cultures of b. bassiana, m. anisopliae and p. farinosus were grown under different conditions to obtain conidia with a modified polyol and trehalose content. conidia with higher intracellular concentrations of glycerol and ery ... | 1995 | 7773406 |
| cloning of a cuticle-degrading protease from the entomopathogenic fungus, beauveria bassiana. | a beauveria bassiana extracellular subtilisin-like serine endoprotease is a potential virulence factor by virtue of its activity against insect cuticles. a cdna clone of the protease was isolated from mycelia of b. bassiana grown on cuticle/chitin cultures. the amino acid sequence of this gene was compared to that of metarhizium anisopliae pr1, the only pathogenicity determinant so far described from an entomopathogenic fungus, and proteinase k, isolated from tritirachium album, a saprophytic fu ... | 1995 | 7875568 |
| infectivity and teratogenicity of beauveria bassiana in menidia beryllina embryos. | developing embryos of the inland silverside fish, menidia beryllina, were exposed to conidiospores of the insect pathogenic fungus, beauveria bassiana, that possessed activity against the migratory grasshopper, melanoplus sanguinipes. various adverse effects were observed in menidia beryllina embryos and larvae. they included rupture of the chorion, embryo death, developmental defects (vertebral abnormalities) in the embryo or hatched larvae, and fungal infections on the mandibles of larvae. alt ... | 1994 | 8024326 |
| differentiation of species and strains of entomopathogenic fungi by random amplification of polymorphic dna (rapd). | polymerase chain reaction (pcr)-based technology, involving random amplification of polymorphic dna (rapd), was used to assess the genomic variability between 24 isolates of deuteromycetous fungi (metarhizium anisopliae, metarhizium flavoviride, unidentified strains of metarhizium and beauveria bassiana) which were found to infect grasshoppers or locusts. m. flavoviride showed little intraspecific variability in pcr-amplified fragments when compared to m. anisopliae. the high level of variabilit ... | 1994 | 8087878 |
| metabolism of xenobiotics by beauveria bassiana. | 1. diazepam, warfarin and testosterone were metabolized by whole resting cells of the fungus beauveria bassiana imi 12939 via oxidative reactions such as hydroxylation and n-demethylation. 2. metabolism of each substrate was inhibited by the cytochrome p450 inhibitors skf-525a and metyrapone, consistent with the involvement of this enzyme system in the metabolism of these drugs by b. bassiana. 3. substrate concentration-dependent inhibition was observed during diazepam metabolism by this organis ... | 1993 | 8259691 |
| evasion of host defense by in vivo-produced protoplast-like cells of the insect mycopathogen beauveria bassiana. | in vivo cells (hyphal bodies) of the hyphomycetous insect pathogen beauveria bassiana collected from host spodoptera exigua larval hemolymph were osmotically sensitive and lacked a well-defined cell wall. in light and electron microscope studies, a galactose-specific lectin purified from s. exigua hemolymph, concanavalin a (specific for alpha-mannose), and a polyclonal antibody to b. bassiana cell walls all bound to surfaces of in vitro-produced b. bassiana blastospores; however, none of these p ... | 1993 | 8376342 |
| the mitochondrial genome of the entomopathogenic fungus beauveria bassiana: analysis of the ribosomal rna region. | the 28.5-kbp mitochondrial (mt) genome from the entomopathogenic fungus beauveria bassiana was studied using restriction enzyme analysis, gene probe hybridization, and dna sequence comparisons. a detailed restriction enzyme map allowed cloning of the entire genome into a number of segments. hybridization of heterologous gene probes to the mtdna resulted in the identification of the large ribosomal rna (lrrna) and small ribosomal rna (srrna) genes. gene probes derived from several yeasts and fung ... | 1993 | 8439871 |
| partial purification and characterization of two extracellular n-acetyl-d-glucosaminidases produced by the entomopathogenic fungus beauveria bassiana. | beauveria bassiana grown in a liquid medium containing n-acetyl-d-glucosamine and colloidal chitin produced two distinct n-acetyl-d-glucosaminidases, nagase 1 and nagase 2. nagase 1 had a molecular weight of 97,000 and nagase 2 was comprised of two subunits, of molecular weights 64,000 and 66,000. the optimal temperature and ph for nagase 1 were 57 degrees c and ph 5 and for nagase 2 they were 37 degrees c and ph 5. nagase 1 was more thermostable than nagase 2. the isolectric points of nagase 1 ... | 1993 | 8439872 |
| regulation of extracellular n-acetyl-d-glucosaminidase production in the entomopathogenic fungus beauveria bassiana. | the entomopathogenic fungus beauveria bassiana produces two extracellular n-acetylglucosaminidases (nagase) in liquid medium containing colloidal chitin as the sole source of carbon and nitrogen. to study the regulation of nagase synthesis, n-acetyl-d-glucosamine (glcnac), glucose nh4no3, or amino acids were added to the colloidal chitin medium and nagase activity was measured. nagase synthesis was (i) induced with glcnac, and no repression was observed with glcnac provided at 2% (w/v); (ii) rep ... | 1993 | 8439875 |
| comparative efficacies of soft contact lens disinfection systems against a fungal contaminant. | the efficacies of five fda-approved soft contact lens disinfecting solutions and heat disinfection were evaluated against the mold, beauveria bassiana. beauveria bassiana is a ubiquitous soil fungus with a demonstrated ability to grow into a soft contact lens matrix. a stock solution of the fungus was prepared and aliquots were added to each of the following disinfection solutions: renu multi-purpose disinfecting solution, opti-free, aosept disinfection/neutralization solution, lens plus oxysept ... | 1993 | 8454840 |
| effect of beauveria bassiana and candida albicans on the cellular defense response of spodoptera exigua. | a marked difference in the cellular response of spodoptera exigua was observed when larvae were challenged with the insect mycopathogen beauveria bassiana versus the yeast candida albicans. both fungi were rapidly phagocytized by circulating hemocytes. the relative growth rate of c. albicans as measured by daughter cell formation was partially suppressed, whereas b. bassiana blastospores produced germ tubes at rates equivalent to those under in vitro conditions. limited growth by c. albicans wit ... | 1993 | 8463710 |
| bassiatin, a new platelet aggregation inhibitor produced by beauveria bassiana k-717. | a new platelet aggregation inhibitor, bassiatin, was isolated from the cultured broth of beauveria bassiana which had been isolated from a soil sample collected in yunnan province, china. the structure of bassiatin was determined to be (3s, 6r)-4-methyl-6-(1-methylethyl)-3-phenylmethyl-1, 4-perhydrooxazine-2,5-dione by nmr analysis, x-ray crystallographic analysis and chemical synthesis. bassiatin inhibited adp-induced aggregation of rabbit platelets with the ic50 being 1.9 x 10(-4) m. | 1995 | 8557595 |
| biocontrol potential of the entomogenous fungi beauveria bassiana and metarhizium anisopliae for tsetse flies (glossina spp.) at developmental sites. | spores of two entomogenous fungi, beauveria bassiana and metarhizium anisopliae, were mixed with sterile sand at two different concentrations (1.0 and 0.5 g/liter) and larvae of tsetse flies glossina morsitans morsitans allowed to pupate in it, simulating field larviposition sites. one gram weight of b. bassiana-sand mixture was estimated to contain 1.4 x 10(6) spores/g and that of m. anisopliae-sand mixture 2.3 x 10(6) spores/g. adult tsetse emerging from pupae in sand-spore mixtures suffered h ... | 1995 | 8568279 |
| genetic nature, stability, and improved virulence of hybrids from protoplast fusion in beauveria | genetic improvement of two different strains of the entomopathogenic fungus beauveria bassiana for more effective control of ostrinia nubilalis and leptinotarsa decemlineata was obtained by crosses with the insecticidal toxin-producing strain beauveria sulfurescens. protoplast fusion between diauxotrophic mutants resulted in the recovery of some stable prototrophic fusion products. the low levels of virulence of the wild type strain b. bassiana 28 isolated originally from l. decemlineata were en ... | 1996 | 8661542 |
| complete nucleotide sequence of beauveria bassiana 5.8s rrna coding gene and flanking internal transcribed spacers. | the nucleotide sequence of two clones of beauveria bassiana in 5.8s rrna coding gene and its regions were completely sequenced. the overall sequence similarity of these two clones is 96%. the identities of internal transcribed spacer (its) regions are 91 % (itsi) and 100% (itsii), respectively. both of 5.8s rrna sequences have 98% homology. | 1995 | 8777317 |
| prospects for biological control of livestock ticks, rhipicephalus appendiculatus and amblyomma variegatum, using the entomogenous fungi beauveria bassiana and metarhizium anisopliae. | both beauveria bassiana and metarhizium anisopliae induced approximately 30% mortalities in adult rhipicephalus appendiculatus feeding on rabbits while m. anisopliae induced a mortality of 37% in adult amblyomma variegatum. both fungal species induced reductions in engorgement weights, fecundity, and egg hatchability in adult a. variegatum. m. anisopliae reduced fecundity by 94% in a. variegatum. furthermore, b. bassiana reduced egg hatchability to 0%, while 11% of the infected females failed to ... | 1996 | 8812559 |
| analysis and modeling of time-dose-mortality of melanoplus sanguinipes, locusta migratoria migratorioides, and schistocerca gregaria (orthoptera: acrididae) from beauveria, metarhizium, and paecilomyces isolates from madagascar | a complementary log-log (cll) model was used to model time-dose-mortality relationships from bioassay tests of 26 fungal isolates mostly from madagascar, africa, against three acridid species, all referred to here as "grasshoppers." the fungal pathogens included 15 isolates of beauveria bassiana, 9 isolates of metarhizium flavoviridae, and 2 isolates of paecilomyces spp. grasshopper species tested included melanoplus sanguinipes, locusta migratoria migratorioides, and schistocerca gregaria. the ... | 1996 | 8812605 |
| identification and differentiation of the entomopathogenic fungus beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis. | a series of genomic dna probes which exhibit specificity for beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal dna (hegedus and khachatourians, 1993a). to improve the sensitivity of a dna-based monitoring system for detection of this entomopathogenic fungus we have developed a pcr-based method. using sequence information from a region of the b. bassiana-specific probe pbb22, primers p1 (5'aagcttcgacatggtctg) and p3 (5ggaggtggtgaggttctgtt) were generated. th ... | 1996 | 8812610 |
| an oil-bait bioassay method used to test the efficacy of beauveria bassiana against grasshoppers | | 1996 | 8812614 |
| [studies of the usefulness of beauveria bassiana for eradication of cockroaches (blattella germanica l.)]. | the ability of killing cockroaches (blattella germanica l.) by various strains of the mushroom beauveria bassiana was studied, including also strains obtained by passaging. the study was conducted using adult insects, of varying age and sex, derived from laboratory cultures or caught in hospital rooms. the obtained results pointed out differences in the pathogenicity of b. bassiana strains for the studied populations of insects. the per cent of mortality among the insects depended on the pathoge ... | 1996 | 9026901 |
| novel metabolites of warfarin produced by beauveria bassiana and streptomyces rimosus: a novel application of hplc-nmr. | 1. biotransformation of warfarin by the fungus beauveria bassiana (atcc 7159) yielded the first reported phase ii warfarin metabolite, 3'4'-dihydroxywarfarin-3'-[4-methoxyglucoside], another previously unreported metabolite, 3',4'-dihydroxywarfarin and also 4'-hydroxywarfarin. 2. biotransformation of warfarin by streptomyces rimosus (nrrl 2234) yielded the previously unreported metabolites, 12-hydroxywarfarin, 4'-hydroxy-11-methoxywarfarin, and also 7-hydroxywarfarin and 4'-hydroxywarfarin, whic ... | 1997 | 9058529 |
| microbial models of mammalian metabolism. fungal metabolism of phenolic and nonphenolic p-cymene-related drugs and prodrugs. ii. metabolites of nonphenolic derivatives. | a cymene-derived drug, 3-[4'-(o-ethoxyphenyl)piperazin-1'-yl]-ethyloxy-p-cymene+ ++ (b1178), is not significantly metabolized by fungal microorganisms. on the contrary, one of its metabolites in rat, 3-(piperazin-1'-yl)ethoxy-p-cymene (b1071), is quantitatively converted by cunninghamella echinulata nrrl 3655 into two hydroxylated products: the corresponding phenol derivative and a benzylic alcohol derivative. other strains, such as beauveria bassiana atcc 7159 and mortierella isabellina mmp 108 ... | 1997 | 9172948 |
| adaptation of proteases and carbohydrates of saprophytic, phytopathogenic and entomopathogenic fungi to the requirements of their ecological niches. | the abilities of isolates of saprophytes (neurospora crassa, aspergillus nidulans), an opportunistic human pathogen (aspergillus fumigatus), an opportunistic insect pathogen (aspergillus flavus), plant pathogens (verticillium albo-atrum, verticillium dahliae, nectria haematococca), a mushroom pathogen (verticillium fungicola) and entomopathogens (verticillium lecanii, beauveria bassiana, metarhizium anisopliae) to utilize plant cell walls and insect cuticle components in different nutrient media ... | 1997 | 9202474 |
| entomopathogenous fungi degrade epicuticular hydrocarbons of triatoma infestans. | studies were undertaken to analyze the ability of entomopathogenous fungi to degrade insect hydrocarbons. strains of beauveria bassiana and metarhizium anisopliae pathogenic to the blood-sucking bug triatoma infestans were grown on hydrocarbon and non-hydrocarbon insect lipid extracts and on synthetic hydrocarbon-enriched media as the sole carbon source. entomopathogenous fungi were shown to utilize hydrocarbons as the only carbon source for their growth. insect-derived hydrocarbons served more ... | 1997 | 9244399 |
| evaluation of the fungus beauveria bassiana as a potential biological control agent against phlebotomine sand flies in colombian coffee plantations. | in colombia, the entomopathogenic fungus beauveria bassiana (deuteromycotina: hyphomycetes) is widely used to control the coffee berry borer hypothenemus hampei (coleoptera: scolytidae) in coffee plantations. recent studies suggested that this fungus is also pathogenic to several important vectors of disease, including phlebotomus papatasi and lutzomyia longipalpis (diptera: psychodidae). the present study evaluated the use of b. bassiana as a potential biological control agent against phlebotom ... | 1997 | 9281401 |
| effects on young american kestrels (falco sparverius) exposed to beauveria bassiana bioinsecticide. | | 1997 | 9307411 |
| isolation of the transposable element hupfer from the entomopathogenic fungus beauveria bassiana by insertion mutagenesis of the nitrate reductase structural gene. | a transposable element has been isolated from the entomopathogenic fungus beauveria bassiana by trapping it in the nitrate reductase structural gene, which has been cloned from this species. the element had inserted in the first exon of the nia gene and appeared to have duplicated the sequence ta at the site of insertion. it was 3336 bp long with 30-bp imperfect, inverted, terminal repeats. the element, called hupfer, contained an open reading frame encoding a 321-amino acid protein similar to t ... | 1997 | 9349711 |
| microbial biotransformations of a synthetic immunomodulating agent, hr325. | the microbial biotransformation of hr325 [2-cyano-3-cyclopropyl-3-hydroxy-n-(4'-trifluoromethyl-3'-methylphenyl)- propenamide], a synthetic immunomodulating agent, has been investigated in order to be compared with animal metabolism and to prepare some metabolites which are difficult to obtain by chemical methods. several fungal strains are able to completely metabolize this drug. mortierella isabellina nrrl 1757 only achieves a benzylic hydroxylation on the aromatic methyl group, affording in h ... | 1997 | 9377097 |
| beauveria bassiana keratitis cured by deep lamellar dissection. | | 1997 | 9395884 |
| antigenic relationships among pathogenic beauveria bassiana with engyodontium album (= b. alba) and non-pathogenic species of the genus beauveria. | exoantigenic extracts of 15 isolates belonging to hyalohyphomycosis-causing beauveria bassiana (1), and engyodontium album (1), as well as other species of the genus beauveria (one isolate each of b. brogniartii, b. densa, b. stephanoderis, b. velata, b. vermiconia and six isolates of unknown beauveria species) were studied. aqueous-merthiolated extracts derived from 10-day-old sabouraud's dextrose agar slant cultures (25 degrees c) were concentrated (25x), and reacted against rabbit anti-b. bas ... | 1997 | 9404019 |
| molecular analysis of hypervirulent somatic hybrids of the entomopathogenic fungi beauveria bassiana and beauveria sulfurescens. | protoplast fusion of diauxotrophic mutants of a beauveria bassiana entomopathogenic strain (bb28) and a beauveria sulfurescens toxinogenic strain (bs2) produced hybrids which were significantly different from the parents in pathogenicity. some of the hybrids were hypervirulent and killed insects more quickly than the bb28 strain, probably because these hybrids had acquired the toxic activity of the bs2 strain. by using six nuclear genes and a telomeric fingerprint probe, the molecular structures ... | 1998 | 9435064 |
| effect of soil texture and soil sterilization on susceptibility of ovipositing grasshoppers to beauveria bassiana | the effect of conidial concentration, soil texture, and soil sterilization on the efficacy of beauveria bassiana against ovipositing grasshoppers (melanoplus sanguinipes) was investigated in a controlled environment. in the first experiment, mortality of female grasshoppers ovipositing into a sterile loamy-sand soil containing conidia of b. bassiana was measured. the prevalence of mortality increased as the concentration of conidia in soil increased, and a median lethal concentration of 10(4) co ... | 1998 | 9446740 |
| susceptibility of colorado potato beetle (leptinotarsa decemlineata) eggs to beauveria bassiana | copyright | 1998 | 9500940 |
| laboratory and field studies on the infection of stink bugs, nezara viridula, piezodorus guildinii, and euschistus heros (hemiptera: pentatomidae) with metarhizium anisopliae and beauveria bassiana in brazil | isolates of metarhizium anisopliae (cnpso-ma12) and beauveria bassiana (cnpso-bb56) were tested under field conditions as biological control agents of soybean stink bugs (nezara viridula, piezodorus guildinii, and euschistus heros). kaolin-based powder formulations of m. anisopliae or b. bassiana were applied to soybean plots at a rate of 1.5 x 10(13) conidia per ha. after treatment, field cages (0.25 m2) were placed in plots and stink bug adults were introduced into the cages. mycosis for both ... | 1998 | 9500941 |
| genotyping isolates of the entomopathogenic fungus beauveria bassiana by rapd with fluorescent labels | random amplified polymorphic dna (rapd) with incorporation of fluorescent deoxynucleotides was used to examine the genetic diversity among beauveria bassiana isolates from argentina and brazil. high-resolution dna fingerprints were generated on line, during polyacrylamide gel electrophoresis of amplification products, by automated laser fluorescence analysis. each isolate displayed a distinct genotype. cluster analysis showed a high level of variability among these genotypes. no correlation with ... | 1998 | 9500948 |
| an improved colony-pcr method for filamentous fungi for amplification of pcr-fragments of several kilobases. | a method was developed to perform pcr directly on mycelial pellets or colonies treated with novozym 234. the method allows rapid screening of large numbers of transformants of both sporulating and non-sporulating fungi for the presence of (co)transforming plasmid copies or for specific genetic modifications such as gene disruption and site specific integration. pcr fragments of at least 3.2 kb can be obtained. using this method the identification of specific disruption mutants from aspergillus n ... | 1997 | 9519482 |