electron microscope observations of four forms of the fungus paecilomyces farinosus (dicks) brown and smith. | | 1975 | 1192247 |
defensive reactions of l3, l4 larvae of the colorado beetle to the insecticidal fungi paecilomyces farinosus (dicks) brown et smith, paecilomyces fumoso--roseus (wize), beauveria bassiana (bols/vuill.) (fungi imperfecti: moniliales). | | 1975 | 1238153 |
cerebral paecilomyces javanicus infection. an ultrastructural study. | a 41-year-old diabetic woman developed paecilomyces javanicus endocarditis and subsequent cerebral fungal embolism and vasculitis with massive infarction and hemorrhage 6 years after a mitral valve replacement with porcine heterograft. the organism was identified by the culture from the infected brain tissue and aortic valve. cerebral infection due to fungus paecilomyces is rare. this report documents the cerebral manifestations of fungus paecilomyces javanicus and describes for the first time t ... | 1986 | 3825513 |
effect of soil fungistasis on zoopathogenic fungi. | the inhibiting action of west-siberian soils on spore germination and the growth and development of zoopathogenic fungi such as emmonsia (chrysosporium) crescens , trichophyton mentagrophytes, beauveria bassiana , metarrhizium anisopliae , paecilomyces farinosus , p. fumoso -roseus and chrysosporium keratinophilum have been studied by the authors. the influence of carbon sources and the root exudates of plants on fungistasis have also been studied. | 1984 | 6727979 |
entomopathogenic fungi associated with ixodes ricinus ticks. | the objective of this study was to demonstrate the occurrence of entomopathogenic fungi on ixodes ricinus ticks in relation to the tick stage, engorgement and season. ticks were collected from the vegetation, from small rodents and from deer. all entomopathogenic fungi found belonged to the hyphomycetes. paecilomyces farinosus and verticillium lecanii were the predominant species. other species, found only on engorged females were: beauveria bassiana, b. brongniartii, p. fumosoroseus and v. aran ... | 1995 | 7621711 |
comparative analysis of phagocytosis of fungal cells by insect hemocytes versus horse neutrophils. | in this study, the phagocytic ability of spodoptera exigua hemocytes was compared to horse neutrophils. in vitro assays showed that the insect granulocytes and horse neutrophils actively phagocytose fitc-labeled paecilomyces farinosus blastospores opsonized with s. exigua hemolymph lectin or horse serum, respectively. killing of fungal cells by the neutrophils and hemocytes was analyzed under in vitro conditions. neutrophils reduced the growth of p. farinosus up to 65% whereas no fungicidal acti ... | 1994 | 7768313 |
manipulation of intracellular glycerol and erythritol enhances germination of conidia at low water availability. | the insect pathogens beauveria bassiana, metarhizium anisopliae and paecilomyces farinosus can be effective biocontrol agents when relative humidity (rh) is close to 100%. at reduced water availability, germination of propagules, and therefore host infection, cannot occur. cultures of b. bassiana, m. anisopliae and p. farinosus were grown under different conditions to obtain conidia with a modified polyol and trehalose content. conidia with higher intracellular concentrations of glycerol and ery ... | 1995 | 7773406 |
survey of mycotic and bacterial keratitis in sri lanka. | over a two-year period (1976-1977 and 1980-1981), 66 cases of bacterial and mycotic cases of keratitis were diagnosed in the eye clinic of the general hospital in kandy, sri lanka. the clinical and microbiologic aspects of these cases are described. noteworthy was the first known human case caused by paecilomyces farinosus, a geophilic species, commonly encountered as an insect parasite throughout the world. the bacterial and the other fungal etiologic agents isolated and identified were: pseudo ... | 1994 | 7984216 |
variations in the ability of galactose and mannose-specific lectins to bind to cell wall surfaces during growth of the insect pathogenic fungus paecilomyces farinosus. | the arrangement of carbohydrate molecules on surfaces of fungal cells may play an important role in nonself recognition of these microorganisms by potential invertebrate hosts. changes in the ability of various galactose and mannose-specific lectins to bind to surface components on cell walls of the insect pathogen paecilomyces farinosus were therefore examined during growth and differentiation of the fungus. fluorescein isothiocyanate conjugates of concanavalin a (con a, specific for alpha-d-ma ... | 1993 | 8330630 |
identification and differentiation of the entomopathogenic fungus beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis. | a series of genomic dna probes which exhibit specificity for beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal dna (hegedus and khachatourians, 1993a). to improve the sensitivity of a dna-based monitoring system for detection of this entomopathogenic fungus we have developed a pcr-based method. using sequence information from a region of the b. bassiana-specific probe pbb22, primers p1 (5'aagcttcgacatggtctg) and p3 (5ggaggtggtgaggttctgtt) were generated. th ... | 1996 | 8812610 |
an antigenic water-soluble glucogalactomannan extracted from cell walls of paecilomyces fumosoroseus and paecilomyces farinosus. | the water-soluble fraction (f1s) obtained after solubilizing in alkali the cell walls of four strains of paecilomyces fumosoroseus and two of paecilomyces farinosus amounted to 8.3-14.5% of the dry cell wall material. two polysaccharides, f1s-a (13-20%) and f1s-b (57-68%) were separated from f1s by gel permeation through sepharose cl-6b. 1h and 13c nmr spectra of f1s-b were recorded and showed analogous structural features in the six isolates of the two species. the fractions isolated from p. fu ... | 1996 | 9004512 |
[laboratory determination of the activity of insecticidal fungus paecilomyces farinosus in reducing the numbers of cockroaches blattella germanica l]. | the strains of p. farinosus capable of killing the cockroach blattella germanica l. were selected. the experiment was carried out using mature insects in age groups and sex groups. the results showed differences in the insecticidal capability of the tested strains in this population of insects. strains 5, l, p of p. farinosus were accepted as possibly useful against blattella since at relatively low concentration of spores they produced a high mortality of the insects. | 1997 | 9381075 |
pathogenicity of the entomopathogenic fungi paecilomyces spp. and beauveria bassiana against the silverleaf whitefly, bemisia argentifolii. | pathogenicities of three species of entomopathogenic fungi against preimaginal bemisia argentifolii were measured and compared. third-instar nymphs on excised leaves of hibiscus rosa-sinensis were exposed to spray applications of 14 isolates of beauveria bassiana, 22 isolates of paecilomyces fumosoroseus, and five isolates of paecilomyces farinosus. b. bassiana and p. fumosoroseus isolates of diverse origins were highly pathogenic to the whitefly nymphs; median lethal doses of 14 of the 22 p. fu ... | 1998 | 9538026 |
characterization of monoclonal antibodies against cell wall epitopes of the insect pathogenic fungus, nomuraea rileyi: differential binding to fungal surfaces and cross-reactivity with host hemocytes and basement membrane components. | monoclonal antibodies (mabs) were generated against epitopes on yeast-like hyphal bodies and hyphae of the entomopathogenic hyphomycete, nomuraea rileyi. two mabs (4c10, 2h4) bind to epitopes common to both hyphal bodies and hyphae, whereas mab 4e9 binds only to hyphal surfaces. 4c10 and 2h4 appear to be directed towards carbohydrate portions of cell surface mannoproteins, as evidenced by similarities in staining patterns between these mabs and concanavalin a on western blots of n. rileyi cell w ... | 1998 | 9548369 |
water and temperature relations of growth of the entomogenous fungi beauveria bassiana, metarhizium anisopliae, and paecilomyces farinosus | the effects of temperature (5-50 degrees c), water availability (0. 998-0.88 water activity, a(w)), and a(w) x temperature interactions (15-45 degrees c) on growth of three entomogenous fungi, beauveria bassiana, metarhizium anisopliae, and paecilomyces farinosus, were evaluated on a sabouraud dextrose-based medium modified with the ionic solute kcl, the non-ionic solute glycerol, and an inert solute, polyethylene glycol (peg) 600. the temperature ranges for growth of b. bassiana, m. anisopliae, ... | 1999 | 10534413 |
constitutive and heat-inducible heat shock element binding activities of heat shock factor in a group of filamentous fungi. | this study represents the initial characterization of the heat shock factor (hsf) in filamentous fungi. we demonstrate that hsfs from beauveria bassiana, metarhizium anisopliae, tolypocladium nivea, paecilomyces farinosus, and verticillium lecanii bind to the heat shock element (hse) constitutively (non-shocked), and that heat shock resulted in increased quantities and decreased mobility of hsf-hse complexes. the monomeric molecular mass of both heat-induced and constitutive hsfs was determined ... | 1999 | 10590835 |
[the effect of infestation by mixed culture of beauveria bassiana and paecilomyces farinosus on reduction in numbers of experimental culture blattella germanica l]. | in this paper results of infestation of blatella germanica l with mixed culture of insecticidal fungi belonging to one two species are presented. in the first stage of experiment the insects were infested first with b. bassiana spores and later with p. farinosus spores (strains l and p) was used as first and b. bassiana as second with time sequence of only 24 and 72 hours. out of one species cultures tests were done alternately with strains l and p of p. farinosus. the control insects were alway ... | 1999 | 10628229 |
laboratory evaluation of chemical-biological control of the rice weevil (sitophilus oryzae l.) in stored grains. | the virulence of ten different fungal isolates of: beauveria bassiana, metarhizium anisopliae, verticillium lecanii and paecilomyces farinosus to the rice weevil sitophilus oryzae was tested. a fungal mix of the most efficient isolates, b. bassiana arsef 5500+m. anisopliae arsef 2974, which caused the highest mortality, was assayed in combination with fenitrothion at a concentration lower (3 ppm) than the normal 6 ppm. fungal inoculation of insects was done by spraying conidial suspensions of ea ... | 2000 | 11124371 |
phylogeny of mitosporic entomopathogenic fungi: is the genus paecilomyces polyphyletic? | we analyzed sequences of the divergent domain at the 5' end of the large subunit rrna gene from the mitosporic entomopathogenic fungi paecilomyces sp., paecilomyces fumosoroseus, paecilomyces farinosus, paecilomyces lilacinus, verticillium lecanii, verticillium psalliotae, beauveria bassiana, aschersonia sp., aschersonia placenta, ascomycetous cordyceps sp., and cordyceps militaris. phylogenetic analysis showed p. fumosorseus as the best characterized out of the analyzed species with the b. bass ... | 2001 | 11683463 |
distribution, occurrence and characterization of entomopathogenic fungi in agricultural soil in the palestinian area. | the occurrence of entomopathogenic fungi was investigated in irrigated vegetable fields and citrus orchards soils, over a nine-month period (april-december 1999), using the galleria bait method (gbm). entomopathogenic fungi were found to occur in 33.6% of the soil samples studied, with positive samples yielding 70 fungal isolates, belonging to 20 species from 13 genera. conidiobolus coronatus was the most frequent and abundant entomopathogenic species recovered, comprising 31.4% of the total num ... | 2002 | 12749589 |
restriction fragment length polymorphism of mitochondrial genome of the entomopathogenic fungus beauveria bassiana reveals high intraspecific variation. | beauveria bassiana is an entomopathogenic fungus with a growing potential for pest control in different agro-ecosystems worldwide. such potential brings the necessity of developing a strain specific typing system. in a previous study, we reported the identification of molecular variants in mitochondrial dna (mtdna) polymorphism in 15 north american isolates. results indicated a highly conserved mitochondrial genome showing only two mitochondrial genotypes (mitotypes). in this study we used whole ... | 2004 | 15506018 |
farinosones a-c, neurotrophic alkaloidal metabolites from the entomogenous deuteromycete paecilomyces farinosus. | two new yellow pigments, farinosones a (1) and b (2), were isolated from the mycelial extract of the entomogenous fungal strain paecilomyces farinosus rcef 0101, together with farinosone c (3), a new metabolite derived from an early step of pyridone alkaloid biosynthesis. the structures were determined by spectroscopic means, in particular by extensive nmr experiments. compounds 1 and 3 induced neurite outgrowth in the pc-12 cell line at concentrations of 50 microm, while compound 2 was inactive ... | 2004 | 15568775 |
paecilosetin, a new bioactive fungal metabolite from a new zealand isolate of paecilomyces farinosus. | a new tetramic acid derivative, paecilosetin (1), along with a recently characterized n-hydroxypyridone, farinosone b (2), was isolated from the fungus paecilomyces farinosus. each compound showed activity against the p388 cell line with ic50 values of 3.1 and 1.1 microg/ml, respectively. paecilosetin was also active against the microorganisms bacillus subtilis, trichophyton mentagrophytes, and cladosporium resinae. | 2005 | 15921439 |
assessment of fungal isolates for development of a myco-acaricide for cattle tick control. | entomopathogenic fungal isolates of arachnid origin were assessed for their ability to produce mortality and inhibit egg hatching in boophilus microplus with the aim of selecting an isolate for development into a myco-acaricide for control of cattle ticks. the ability of the most promising isolate to target developmental stages of more than one tick species and the optimum concentration of fungal inoculum to be used for future studies were determined. metarhizium anisopliae was the most pathogen ... | 2005 | 16187897 |
identification of molecular variants in mitochondrial dnas of members of the genera beauveria, verticillium, paecilomyces, tolypocladium, and metarhizium. | a set of five mitochondrial (mt) probes derived from a strain of beauveria bassiana was used to evaluate the similarity of mtdnas from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. the probes and genes encoded for (shown in parentheses) were pbbmte2 (nadi, atp6), pbbmte3 (atp6, small rrna [srrna]), pbbmte4 (srrna, co3, nad6), pbbse1 (nad6, trna, large rrna [lrrna]), and pbbxs1 (lrrna). the probes produced identical hybridization patterns in ecori-digested ... | 1993 | 16349124 |
comparison of biomass dry weights and radial growth rates of fungal colonies on media solidified with different gelling compounds. | penicillium commune, aureobasidium pullulans, and paecilomyces farinosus were grown on two different media solidified with agar, pluronic f-127, carrageenan x-4910, or carrageenan x-4910 overlaid with cellophane. growth on carrageenan x-4910 was generally the same as that on agar, as was the visual appearance of the colonies, e.g., the pigmentation. the carrageenan x-4910 gels had a melting point, depending on the medium, of 41 to 46(deg)c, and the dry weights of the colonies were readily determ ... | 1995 | 16535179 |
culture age, temperature, and ph affect the polyol and trehalose contents of fungal propagules. | the growth and conidial physiology of the entomopathogenic fungi beauveria bassiana, metarhizium anisopliae, and paecilomyces farinosus were studied under different conditions. the effects of culture age (up to 120 days), temperature (5 to 35(deg)c), and ph (2.9 to 11.1) were determined. growth was optimal at ph 5 to 8 for each isolate and between 20 and 35(deg)c, depending on the isolate. the predominant polyol in conidia was mannitol, with up to 39, 134, and 61 mg g of conidia(sup-1) for b. ba ... | 1996 | 16535354 |
(+)-n-deoxymilitarinone a, a neuritogenic pyridone alkaloid from the insect pathogenic fungus paecilomyces farinosus. | a new pyridone alkaloid, (+)-n-deoxymilitarinone a (1), was isolated from paecilomyces farinosus rcef 0097 along with the related metabolites, militarinone d and militarinone b. the sterol 22e,4r-ergosta-7,22-diene-3beta,5alpha,6beta,9alpha-tetraol was also identified. the structures were established by spectroscopic methods, in particular with the aid of extensive nmr experiments. compound 1 induced neurite sprouting in pc 12 cells when tested at 33 and 100 microm concentrations. a cytotoxic ef ... | 2006 | 16562854 |
nucleotide excision repair and photoreactivation in the entomopathogenic fungi beauveria bassiana, beauveria brongniartii, beauveria nivea, metarhizium anisopliae, paecilomyces farinosus and verticillium lecanii. | to compare the dna repair capabilities of the entomopathogenic fungus (epf) bassiana to the epf beauveria brongniartii, beauveria nivea, metarhizium anisopliae, paecilomyces farinosus, verticillium lecanii, and the fungi aspergillus niger and neurospora crassa. | 2006 | 16629997 |
the antitumor and antioxidative activities of polysaccharides isolated from isaria farinosa b05. | the water-soluble intra-polysaccharides wips1 and water-soluble extra-polysaccharides weps1 were isolated from isaria farinosa b05 through ethanol precipitation and gel permeation chromatography (gpc). their characteristics were determined by chemical analysis, gas chromatography, gpc and ir spectroscopy. the results show that wips1 contained 90.3% carbohydrate, 8.00% uronic acid, 7.15% protein and three kinds of monosaccharides including mannose, galactose and glucose with a molar ratio of 8.0: ... | 2008 | 16899356 |
phylogenetic and structural analyses of the mating-type loci in clavicipitaceae. | entomopathogens and other econutritional fungi belonging to clavicipitaceae were phylogenetically analyzed on the basis of the 18s rrna gene and mating-type genes (mat1-1-1 and mat1-2-1). the phylogenies of the mating-type genes yielded better resolutions than that of 18s rrna gene. entomopathogens (cordyceps bassiana, cordyceps brongniartii, cordyceps militaris, cordyceps sinclairii, cordyceps takaomontana, isaria cateniannulata, isaria farinosa, isaria fumosorosea, isaria javanica, lecanicilli ... | 2006 | 17064371 |
pathogenicity of fungal isolates (ascomycota: hypocreales) against peregrinus maidis, delphacodes kuscheli (hemiptera: delphacidae), and dalbulus maidis (hemiptera: cicadellidae), vectors of corn diseases. | preliminary screening assays were carried out on 17 isolates from five fungal species beauveria bassiana, lecanicillium muscarium, metarhizium anisopliae, isaria farinosa, and i. fumosorosea. the three most effective isolates against peregrinus maidis (hemiptera: delphacidae) were b. bassiana cep 147, cep 150, and cep 189. there were no consistent differences found in males and females regarding fungal susceptibility. however, more females than males were proportionally infected. there was not a ... | 2007 | 17407003 |
ovicidal activity of entomopathogenic hyphomycetes on aedes aegypti (diptera: culicidae) under laboratory conditions. | the ovicidal activity of 21 hyphomycete fungi species against aedes aegypti (l.) (diptera: culicidae) was tested. fungi with ovicidal activity developed on high numbers of eggs (> or =70%) during 25 d of exposure. a clear ovicidal activity with low values of hatch (1.3-40%) was observed after 25 d of incubation with isaria farinosa (holm: fries) fries, paecilomyces carneus (duché & heim) brown & smith, paecilomyces marquandii (massee) hughes, isaria fumosorosea (wize), metarhizium anisopliae (me ... | 2007 | 17915511 |
[species diversity and seasonal change of entomogenous fungi in langya mountains nature reserve]. | 672 specimens of entomogenous fungi belonging to 20 species, 8 genera and 4 families were collected from 20 sampling quadrates in the langya mountains nature reserve of east anhui. the dominant species were beauveria bassiana, paecilomyces farinosus, p. cateinannulatus, b. brongniartii and p. fumosoroseus, and b. bassiana was most dominant, with the relative abundance of 73.8%. the entomogenous fungi in the reserve were high in amount but low in diversity. the amount of isolates and the abundanc ... | 2007 | 18062316 |
selection of entomopathogenic fungi for aphid control. | twelve strains of entomopathogenic fungi such as lecanicillium lecanii, paecilomyces farinosus, beauveria bassiana, metarhizium anisopliae, cordyceps scarabaeicola, and nomuraea rileyi were screened for aphid control. at 25 degrees c and 75% relative humidity (rh), among tested entomopathogenic fungi, l. lecanii 41185 showed the highest virulent pathogenicity for both myzus persicae and aphis gossypii, and their control values were both nearly 100% 5 and 2 d after treatment, respectively. moreov ... | 2007 | 18215637 |
perspectives for the biological control of cameraria ohridella. | the horse chestnut leaf-miner, cameraria ohridella deschka et dimic (lepidoptera, gracillariidae) is a serious invasive pest of aesculus hippocastanum in europe. the larvae of this species feed on leaf parenchyma and can reduce the tree growth. we studied the impact of parasitoids on c. ohridella in the czech republic and also searched for entomopathogenic fungi associated with this pest. the results showed that the rate of parasitism varied between 5% and 15% in most cases. the most parasitized ... | 2007 | 18399483 |
optimization of fermentation medium and conditions for mycelial growth and water-soluble exo-polysaccharides production by isaria farinosa b05. | the optimal fermentation medium and conditions for mycelial growth and water-soluble exo-polysaccharides production by isaria farinosa b05 were investigated. the medium components and fermentation conditions were optimized according to the one at a time method, while the concentration of medium components was determined by the orthogonal matrix method. the results showed that the optimal fermentation medium was as follows: sucrose 3.5% (w/v), peptone 0.5%, yeast extract 0.2%, k(2)hpo(4) 0.1%, an ... | 2008 | 18569876 |
pathogenicity and thermotolerance of entomopathogenic fungi for the control of the scab mite, psoroptes ovis. | psoroptes ovis is responsible for a highly contagious skin condition, both in sheep and cattle. this parasite has a marked economical impact in the sheep and cattle industry. biological control is considered as a realistic alternative to chemotherapeutic control. laboratory experiments were carried out to evaluate the pathogenicity and the thermotolerance of twelve isolates of entomopathogenic fungi from four genera (beauveria vuillemin, metarhizium sorokin, paecilomyces bainier and verticillium ... | 2008 | 18584130 |
cycloaspeptides f and g, cyclic pentapeptides from a cordyceps-colonizing isolate of isaria farinosa. | cycloaspeptides f (1) and g (2), two new cyclic pentapeptides, and the known cycloaspeptides a (3), c (4), and bisdethiodi(methylthio)hyalodendrin (5) have been isolated from the crude extract of the fungus isaria farinosa that colonizes cordyceps sinensis. the structures of 1 and 2 were elucidated primarily by nmr and ms methods. the absolute configuration of 1 was assigned using marfey's method on its acid hydrolysate. compounds 1 and 2 showed cytotoxic effects against hela and mcf7 cell lines ... | 2009 | 19572613 |
entomopathogenic fungi recorded from the harlequin ladybird, harmonia axyridis. | entomopathogenic fungi were recorded from field samples of the harlequin ladybird harmonia axyridis, an invasive coccinellid that has recently arrived in denmark. larvae, pupae and adults were found to be infected by isaria farinosa, beauveria bassiana and species of lecanicillium. this is the first record of entomopathogenic fungi infecting larvae and pupae. winter mortality due to fungal infection reached 17.9% in adults collected at one location. the larval stage was most susceptible to funga ... | 2009 | 19596334 |
farinomalein, a maleimide-bearing compound from the entomopathogenic fungus paecilomyces farinosus. | a new maleimide-bearing compound, farinomalein (1), was isolated from the entomopathogenic fungus paecilomyces farinosus hf599. the structure was determined on the basis of spectroscopic analyses and chemical conversion. compound 1 showed potent activity (5 mug/disk) against the plant pathogenic phytophthora sojae p6497. | 2009 | 19670877 |
geranylgeranyl diphosphate synthase genes in entomopathogenic fungi. | based on comparative amino-acid sequence alignment of geranylgeranyl diphosphate (ggpp) synthase from filamentous fungi, degenerated oligonucleotide primers were designed for searching ggpp synthase gene(s) in entomopathogenic fungi. polymerase chain reaction with the designed primers amplified ggpp synthase homologues from five representative entomopathogenic fungi: metarhizium anisopliae, beauveria bassiana, verticillium lecanii, paecilomyces farinosus, and nomuraea rileyi. sequence comparison ... | 2010 | 19690851 |
entomopathogenic fungal activity against pupae and adult haematobia irritans (diptera: muscidae). | the horn fly haematobia irritans is one of the most important ectoparasites associated with grazing bovines. this study investigated the pathogenic activity of metarhizium anisopliae (e9, ibcb425 and ibcb159), beauveria bassiana (jab06, jab07 and am09), isaria fumosorosea (=paecilomyces fumosoroseus) (ibcb133 and cb75) and isaria farinosa (=paecilomyces farinosus) (cg189 and cg195) fungi isolates on pupae and adult h. irritans. groups of 20 pupae and 30 adult flies were respectively bathed and s ... | 2010 | 19880254 |
efficiency of entomopathogenic fungi in the control of eggs and larvae of the horn fly haematobia irritans (diptera: muscidae). | the present study assessed the pathogenic effect of isolates e9, ibcb425 and ibcb159 of the metarhizium anisopliae fungus, jab06, jab07 and am09 of beauveria bassiana, ibcb133 and cb75 of isaria fumosorosea (=paecilomyces fumosoroseus) and cg189 and cg195 of isaria farinosa (=paecilomyces farinosus) against eggs and larvae of the horn fly haematobia irritans. eggs were inoculated with suspensions containing 10(6), 10(7) and 10(8)conidiaml(-1) of the fungal isolates and observed after 48h to dete ... | 2010 | 19880255 |
effect of light on growth, intracellular and extracellular pigment production by five pigment-producing filamentous fungi in synthetic medium. | the competence of the living creatures to sense and respond to light is well known. the effect of darkness and different color light quality on biomass, extracellular and intracellular pigment yield of five potent pigment producers monascus purpureus, isaria farinosa, emericella nidulans, fusarium verticillioides and penicillium purpurogenum, with different color shades such as red, pink, reddish brown and yellow, were investigated. incubation in total darkness increased the biomass, extracellul ... | 2010 | 20226375 |
hypoglycaemic effects of fermented mycelium of paecilomyces farinosus (g30801) on high-fat fed rats with streptozotocin-induced diabetes. | paceilomyces farinosus is an entomogenous fungus with a powerful insecticidal activity against the larvae of lipidoptera, coleoptera and hymenoptera. however, the hypoglycaemic activity of p. farinosus extract has not been studied. this study was undertaken to investigate the hypoglycaemic and anti-diabetic effects of p. farinosus (g30801) in rats with streptozotocin (stz)-induced diabetes given a high-fat and compared with normal rats. | 2010 | 20516543 |
fungi associated with the hemlock woolly adelgid, adelges tsugae, and assessment of entomopathogenic isolates for management. | fungi associated with the hemlock wooly adelgid, adelges tsugae annand (hemiptera: adelgidae), were collected throughout the eastern usa and southern china. twenty fungal genera were identified, as were 79 entomopathogenic isolates, including: lecanicillium lecanii (zimmermann) (hypocreales: insertae sedis), isaria farinosa (holm: fries.) (cordycipitaceae), beauveria bassiana (balasamo) (hyphomycetes), and fusarium spp (nectriaceae). the remaining fungal genera associated with insect cadavers we ... | 2010 | 20672977 |
water-soluble red pigments from isaria farinosa and structural characterization of the main colored component. | the present study describes the red pigment synthesized by the filamentous fungi isaria farinosa under submerged culture conditions. the pigment production was optimal under the following conditions: ph 5, agitation speed 150 rpm, temperature 27 °c, incubation time 192 h, light source total darkness, sucrose and glucose as carbon source, yeast extract, meat peptone and monosodium glutamate at a fixed concentration of 3% as nitrogen source. the addition of 10 mm cacl₂ to the culture medium increa ... | 2010 | 20806258 |
the polyphyletic nature of paecilomyces sensu lato based on 18s-generated rdna phylogeny. | nuclear-encoded small-subunit ribosomal dna was used to examine phylogenetic relationships in paecilomyces sensu lato. phylogenetic analysis of the 18s nr dna demonstrates that paecilomyces is polyphyletic across two subclasses, sordariomycetidae and eurotiomycetidae. the type species, paecilomyces variotii, and thermophilic relatives belong in the order eurotiales (trichocomaceae), while mesophilic species related to paecilomyces farinosus are in the order hypocreales (clavicipitaceae and hypoc ... | 2004 | 21148898 |
production of xyloglucanolytic enzymes by trichoderma viride, paecilomyces farinosus, wardomyces inflatus, and pleurotus ostreatus. | different conditions of culture medium, incubation time, concentration and surfactant were tested to determine xyloglucanase activity. trichoderma viride, paecilomyces farinosus, wardomyces inflatus and pleurotus ostreatus showed increased xyloglucanase activities when the fungi grown on microcrystalline cellulose as the sole carbon source. endoxyloglucanase activity increased with the growth of the fungi and reached a peak on day 14 of incubation, practically 95% of the activity was associated ... | 2002 | 21156511 |
n-hydroxypyridones, phenylhydrazones, and a quinazolinone from isaria farinosa. | new n-hydroxypyridones, militarinones e (1) and f (2), phenylhydrazones, farylhydrazones a (3) and b (4), a quinazolinone, 2-(4-hydroxybenzyl)quinazolin-4(3h)-one (5), and the known militarinones a (6) and b (7) were isolated from cultures of the cordyceps-colonizing fungus isaria farinosa. the structures of 1-5 were elucidated by spectroscopic methods, and 3 was confirmed by x-ray crystallography. the absolute configuration of the c-4' secondary alcohol in 1 was deduced via the circular dichroi ... | 2010 | 21158423 |
characterization of a hydrophobin of the ascomycete paecilomyces farinosus. | the entomopathogenic ascomycete paecilomyces farinosus (alternative name isaria farinosa) synthesized a hydrophobin, irrespective of being grown in submerged or surface culture. the protein was extracted using trifluoroacetic acid and purified using preparative hplc and sds-page. partial sequences were obtained using esi-ms/ms. the peptides were used as a start to apply a 'template switching oligo' protocol to elucidate the complete open reading frame of p. farinosus hydrophobin 1 (pfah1). the d ... | 2011 | 21656798 |
[genetic differentiation of isaria farinosa populations in anhui province of east china]. | isaria farinosa is an important entomopathogenic fungus. by using issr, this paper studied the genetic heterogeneity of six i. farinosa populations at different localities of anhui province, east china. a total of 98.5% polymorphic loci were amplified with ten polymorphic primers, but the polymorphism at population level varied greatly, within the range of 59.6%-93.2%. the genetic differentiation index (g(st)) between the populations based on nei's genetic heterogenesis analysis was 0.3365, and ... | 2011 | 22303685 |
evaluating the lethal and pre-lethal effects of a range of fungi against adult anopheles stephensi mosquitoes. | insecticide resistance is seriously undermining efforts to eliminate malaria. in response, research on alternatives to the use of chemical insecticides against adult mosquito vectors has been increasing. fungal entomopathogens formulated as biopesticides have received much attention and have shown considerable potential. this research has necessarily focused on relatively few fungal isolates in order to 'prove concept'. further, most attention has been paid to examining fungal virulence (lethali ... | 2012 | 23126549 |
occurrence and prevalence of insect pathogens in populations of the codling moth, cydia pomonella l.: a long-term diagnostic survey. | about 20,550 larvae, pupae and adults of the codling moth, cydia pomonella l., were diagnosed for pathogens during long-term investigations (1955-2012) at the institute for biological control in darmstadt, germany. the prevailing entomopathogens diagnosed in these studies were insect pathogenic fungi, especially beauveria bassiana and isaria farinosa, the microsporidium, nosema carpocapsae, the cydia pomonella granulovirus (cpgv), as well as mostly undetermined bacteria. while the cpgv was obser ... | 2013 | 26462428 |
plant and fungal diversity in gut microbiota as revealed by molecular and culture investigations. | few studies describing eukaryotic communities in the human gut microbiota have been published. the objective of this study was to investigate comprehensively the repertoire of plant and fungal species in the gut microbiota of an obese patient. | 2013 | 23555039 |
spatial and taxonomical overlap of fungi on phylloplanes and invasive alien ladybirds with fungal infections in tree crowns of urban green spaces. | occurrence of entomopathogenic fungi on phylloplanes in tilia × europaea crowns between 1 and 13 m was assessed in urban parks. prevalence of fungal infections in ladybirds (coleoptera: coccinellidae) collected from tilia × europaea was assessed to determine whether fungi found on phylloplanes also occurred as infections in ladybirds. isaria spp. was most abundant on phylloplanes (mean colony forming units (cfu) per leaf ± se, 0.33 ± 0.03) followed by beauveria spp. (0.22 ± 0.02 cfu per leaf) an ... | 2016 | 27353660 |
prevalence of beauveria pseudobassiana among entomopathogenic fungi isolated from the hard tick, ixodes ricinus. | human and animal disease-transmitting hard ticks (acari: ixodidae) are of great concern for public health and animal farming. alternatives to tick control by chemical acaricides are urgently needed, and one intensively evaluated biocontrol strategy is based on the use of tick-pathogenic filamentous fungi. an indispensable prerequisite for the development of tick-derived fungal isolates into registered myco-acaricides is their sound taxonomic characterisation. a set of fungal strains isolated fro ... | 2014 | 25065606 |
efficacy of entomopathogenic hypocrealean fungi against periplaneta americana. | the american cockroach periplaneta americana, one of the worlds' most important urban insect pests was tested with entomopathogenic fungi. most promising metarhizium anisopliae, metarhizium robertsii and beauveria bassiana killed nymphs (≥ 81.7% mortality, 25 days after treatment), and these fungi developed on all dead insects. other fungi tested were less virulent (metarhizium frigidum and purpureocillium lilacinum) or avirulent (isaria cateniobliqua, isaria farinosa, simplicillium lanosoniveum ... | 2013 | 23899866 |
potential of native beauveria pseudobassiana strain for biological control of pine wood nematode vector monochamus galloprovincialis. | three entomopathogenic fungal strains, isaria farinosa (holmsk.) fr., lecanicillium attenuatum (zare & w. games) and beauveria pseudobassiana (bals.) vuill. were isolated in spain from naturally infected monochamus galloprovincialis (olivier) (coleoptera: cerambycidae), the european vector of pine wilt disease (pwd). this is the first time that these entomopathogenic fungi have been isolated from m. galloprovincialis beetles. assays showed the b. pseudobassiana eabps 11/01-mg strain to be highly ... | 2015 | 26283466 |
nutritional effects on the mycelial growth and enzymatic activity of isaria farinosa, and hepialus larvae growth. | to investigate the nutritional requirements of the mycelial growth and pathogenesis-related enzymatic activity on isaria farinosa and the nutritional effect of fungus on its host hepialus larvae. | 2016 | 26929413 |
species clarification of isaria isolates used as biocontrol agents against diaphorina citri (hemiptera: liviidae) in mexico. | entomopathogenic fungi belonging to the genus isaria (hypocreales: cordycipitaceae) are promising candidates for microbial control of insect pests. currently, the mexican government is developing a biological control program based on extensive application of isaria isolates against diaphorina citri (hemiptera: liviidae), a vector of citrus huanglongbing disease. previous research identified three promising isaria isolates (che-cnrcb 303, 305, and 307; tentatively identified as isaria fumosorosea ... | 2016 | 26895870 |
production of antioomycete compounds active against the phytopathogens phytophthora sojae and aphanomyces cochlioides by clavicipitoid entomopathogenic fungi. | a total of 412 strains belonging to 14 genera of clavicipitoid entomopathogenic fungi (epf) were screened for activities against two economically important plant pathogenic oomycetes, phytophthora sojae and aphanomyces cochlioides. to identify the antioomycete compounds produced by epf, the extracts of 13 highly active epf strains were characterized in detail by high performance liquid chromatography with diode array detection and high-resolution mass spectrometric detection and antioomycete ass ... | 2014 | 24268864 |
characterization and phylogeny of isaria spp. strains (ascomycota: hypocreales) using its1-5.8s-its2 and elongation factor 1-alpha sequences. | the elongation factor 1-alpha (ef1-α) and the internal transcribed spacer (its) regions its1 and its2 (its1-5.8s-its2) sequences were used to characterize and to identify isaria isolates from argentina, mexico, and brazil, as well as to study the phylogenetic relationships among these isolates and other related fungi from the order hypocreales. the molecular characterization, which was performed by pcr-rflp of ef1-α and its1-5.8-its2 genes, was useful for resolving representative isolates of isa ... | 2014 | 24222441 |
virulence of isaria sp. and purpureocillium lilacinum to rhipicephalus microplus tick under laboratory conditions. | rhipicephalus microplus (canestrini) is an ectoparasite accountable for great economic losses. the use of entomopathogenic fungi to control arthropods has shown promising responses. the present study evaluated the virulence of isaria farinosa (holmsk.) fr., isaria fumosorosea (wize) brown and smith, and purpureocillium lilacinum (=paecilomyces lilacinus) (thom.) samson to engorged females, eggs, and larvae of r. microplus. there were four treatment groups (10(5), 10(6), 10(7), and 10(8) conidia ... | 2012 | 22710525 |