| in vivo effects of the purified thrombin-like and anticoagulant principles of agkistrodon acutus (hundred pace snake) venom. | | 1978 | 153013 |
| [enzymochemical studies on snake venoms. v. purification of lethal protein ac3-proteinase in the venom of agkistrodon acutus (author's transl)]. | | 1979 | 397338 |
| the clotting activity of the thrombin-like enzyme of agkistrodon acutus (hundred-pace snake) venom. | | 1979 | 473246 |
| [enzymochemical studies on snake venoms. ii. purification of lethal protein ac1-proteinase in the venom of agkistrodon acutus (author's transl)]. | | 1977 | 560456 |
| the effects of the purified thrombin-like and anticoagulant principles of agkistrodon acutus venom on blood coagulation in vivo. | | 1976 | 1258068 |
| [alpha 2 megaloglobulin inhibits the activation of rabbit platelet by chinese agkistrodon acutus venom]. | an in vitro study of alpha 2-mengaloglobulin (alpha 2mg) in the inhibition of the activation of washed rabbit platelet by chinese agkistrodon acutus venom (caav) was reported. results showed that caav induced aggregation rate of washed rabbit platelet was positively related to the caav concentration, and the maximal aggregation rate was 43.8 +/- 9.9% at the concentration of 100 micrograms/ml. meanwhile the release of serotonin (5-ht) and platelet factor 4(pf4) from the platelet reached maximum a ... | 1992 | 1284793 |
| [the influence of chinese agkistrodon acutus enzyme (caae) on the functions of washed human platelets]. | the effects of the activation and influence of caae on washed human platelets were investigated. our findings were: (1) caae could induce aggregation and alpha-granule release reaction in the washed human platelet suspension; thus it could activate the platelets; (2) the aggregation effect of caae was inhibited by albumin and affected by ca2+, mg2+ concentration; (3) heparin and/or at iii did not inhibit the aggregation activation of caae, but alpha 2mg markedly inhibited it; (4) the aggregation ... | 1991 | 1814829 |
| immunological properties of the fibrinolytic enzyme (fibrolase) from southern copperhead (agkistrodon contortrix contortrix) venom and its purification by immunoaffinity chromatography. | an antibody to the fibrinolytic enzyme in southern copperhead venom was produced by immunizing rabbits with chromatographically purified enzyme. the antibody was purified from rabbit blood by ammonium sulfate fractionation and protein-a affinity chromatography. the purified antibody reacted only with the fibrinolytic enzyme in southern copperhead venom as demonstrated by immunodiffusion and immunoelectrophoresis. western immunoblotting revealed that several snake venoms, including agkistrodon pi ... | 1991 | 1926169 |
| isolation of an acidic phospholipase a2 from the venom of agkistrodon acutus (five pace snake) and its effect on platelet aggregation. | a phospholipase a2 from the venom of the snake agkistrodon acutus was purified by immunoaffinity chromatography and fast protein liquid chromatography (fplc) as a single band by page and sds-page. the estimated mol.wt was 16,400 by sds-page and 16,900 by gel filtration and the isoelectric point was 4.9. the ten n-terminal amino acid residues are homologous to those of the acidic phospholipases a2 from other crotalid venoms. the purified enzyme showed a potent inhibitory effect on platelet aggreg ... | 1989 | 2749764 |
| characterization of clotting factors from agkistrodon acutus venom. | 1. four clotting factors, cf-1(c), cf-2(c), cf-1(t) and cf-2(t) were isolated from agkistrodon acutus (collected on mainland china and taiwan) venom by komori et al. (1987). it was reported that all factors possessed coagulant activity in the conversion of fibrinogen to fibrin, although they showed different chemical properties and antigenicities. 2. their role in the clot formation system was clarified and compared with that of thrombin. clotting factors from a. acutus venom released only fibri ... | 1988 | 2896611 |
| platelet aggregation inhibitors from agkistrodon acutus snake venom. | among all the purified components from a. acutus venom, including adpase, 5'-nucleotidase, phospholipase a2 and fibrinogenases, only the venom adpase (50-100 micrograms/ml) shows marked inhibitory action on adp (10 microm)-, collagen (10 micrograms/ml)- and sodium arachidonate (100 microm)-induced platelet aggregations of rabbit platelet-rich plasma. the venom 5'-nucleotidase (100 micrograms/ml) inhibited adp-induced platelet aggregation by 31 +/- 4% (n = 4, p less than 0.05). fibrinogenolytic e ... | 1986 | 3031852 |
| [purification and characterization of depressor component of agkistrodon acutus venom]. | | 1988 | 3195344 |
| comparison of the platelet aggregation induced by three thrombin-like enzymes of snake venoms and thrombin. | platelet aggregation induced by three thrombin-like enzymes of snake venoms was compared with that by thrombin. acutin was isolated from agkistrodon acutus venom and thrombocytin and batroxobin were from bothrops atrox venom. the fibrinogen-clotting activities were 700, 170 and 7 u/mg for batroxobin, acutin and thrombocytin, respectively. they induced aggregation and atp release of washed rabbit platelets. the aggregating activity of thrombin was 10(2), 10(4) and 10(5) times more potent than tho ... | 1988 | 3291184 |
| purification and properties of the anticoagulant principle of agkistrodon acutus venom. | | 1972 | 5069588 |
| purification and properties of the thrombin-like principle of agkistrodon acutus venom and its comparison with bovine thrombin. | | 1971 | 5167421 |
| isolation of coagulant and anticoagulant principles from the venom of agkistrodon acutus. | | 1967 | 5618974 |
| presence of zinc in proteolytic hemorrhagic toxin isolated from agkistrodon acutus venom. | 1. hemorrhagic toxin (ac1-proteinase) was isolated from the venom of agkistrodon acutus (formosa) and the zinc content was determined (1.15 mol/mol protein). the results we extensively compared with hemorrhagic toxin e of crotalus atrox venom (u.s.a.). comparable results were obtained for zinc content, hemorrhagic and proteolytic activities for native hemorrhagic toxins from two different venoms. it is of interest that the zinc content of hemorrhagic toxins is identical even though the venoms ar ... | 1982 | 6125319 |
| [anti-ophidic toxin action of agkistrodon acutus serum]. | | 1982 | 6219541 |
| classification of agkistrodon species in china. | the wide geographical distribution of agkistrodon and the slight morphological differences among the snakes of the genus agkistrodon in china have posed a problem to taxonomists. we have employed polyacrylamide gel electrophoresis and immunological diffusion techniques for comparison of the venoms of different species and subspecies of agkistrodon from various localities. the electrophoretic patterns of the proteins of the venoms were different from each other, but showed certain relations withi ... | 1984 | 6426095 |
| purification of a proteinase (ac5-proteinase) and characterization of hemorrhagic toxins from the venom of the hundred-pace snake (agkistrodon acutus). | ac5-proteinase (15.2 mg) was isolated from agkistrodon acutus venom (1 g) by column chromatography on sephadex g-75, cm-sephadex c-50 and cm-cellulose. ac5-proteinase was homogeneous by disc electrophoresis on polyacrylamide gel at ph 4.3 and also by sds-disc polyacrylamide gel electrophoresis. ac1-, ac2-, ac3- and ac5-proteinases possessed lethal and hemorrhagic activities, but ac4-proteinase had no lethal activity. these activities were inhibited completely by ethylenediaminetetraacetic acid ( ... | 1984 | 6433514 |
| agkistrodon acutus snake venom inhibits prothrombinase complex formation. | | 1981 | 7302928 |
| primary structure of ac1-proteinase from the venom of deinagkistrodon acutus (hundred-pace snake) from taiwan. | the entire amino acid sequence of ac1-proteinase from deinagkistrodon acutus venom was determined by using lysyl endopeptidase, metalloendopeptidase, trypsin and v8 protease. the hemorrhagic toxin had a typical zinc-chelating sequence his-glu-x-x-his found in thermolysin. | 1995 | 7655443 |
| [experimental study of chinese agkistrodon acutus venom in activation of rabbit platelets in vivo]. | fourteen albino rabbits, male and female, were allocated randomly into two groups: control group which had intravenous infusion of normal saline, and experimental group which had intravenous infusion of chinese agkistrodon acutus venom (caav) 0.075 mg/kg. platelet was reduced, plasma pf4 activity and 5-ht concentration increased, 5-ht content in platelets was reduced in the experimental group 10, 20, and 50 minutes after the infusion. it had a significant difference (p < 0.01), compared with tha ... | 1994 | 8070769 |
| coagulation factor x inhibitor from hundred-pace snake (deinagkistrodon acutus) venom. | deinagkistrodon acutus venom contains a collection of anticoagulant proteins that has been reported to prevent prothrombinase assembly (teng and seegers, 1981, thromb. res. 23, 255). a partial sequence indicates that these proteins are related to the functionally equivalent protein in trimeresurus flavoviridis (atoda et al., 1991, j. biochem. 106, 808). inhibition of prothrombinase, the complex of factors xa and va combined with phospholipids, is expressed in bovine, human, and rat plasmas as in ... | 1993 | 8310445 |
| molecular cloning and deduced primary structures of acidic and basic phospholipases a2 from the venom of deinagkistrodon acutus. | this paper presents the nucleotide sequences of the cdnas encoding three acidic phospholipases a2 and one basic phospholipase a2 from deinagkistrodon acutus venom. the deduced primary structure of the basic enzyme is closest to that of the basic neurotoxic enzyme from trimeresurus mucrosquamatus venom, while the acidic phospholipases from d. acutus have highest sequence similarity to that from agkistrodon halys pallas. the phylogeny of this monotypic species is discussed. | 1996 | 8931260 |
| purification, characterization and conformational analysis of a haemorrhagin from the venom of agkistrodon acutus. | aahiv, a medium-sized toxin with a mol. wt of 44,000, a pi of 5.0 and a low cysteine content, was isolated from the venom of agkistrodon acutus by ion-exchange and gel filtration chromatography. it had haemorrhagic, lethal and caseinolytic activities, the last of which was inhibited by edta, zn(ch3coo)2 or cuso4. the circular dichroism spectrum at ph 7.0 showed two negative bands at 210 nm and 219 nm, corresponding to secondary structure contents of 18.2% alpha-helix, 31.0% beta-sheet, 17.2% bet ... | 1997 | 9080585 |
| [armillifer agkistrodontis disease: report of case]. | a case of armillifer agkistrodontis disease was reported. armillifer agkistrodontis is a species of the armillifer genus of the linguatulida order and parasitizing agkistrodon acutus. according to literature reviewed, there has been no report of this disease caused by infection of armillifer agkistrodontis in human being prior to this case all over the world. the clinical features of this disease are long-term high fever, abdominal pain, diarrhea, mild anemia, hepatosplenomegaly, eosinophilia in ... | 1996 | 9592342 |
| purification, cdna cloning and molecular characteristic of a fibrinolytic enzyme from the venom of agkistrodon acutus. | a nonglycoprotein-like fibrinolytic enzyme ((fib-i) was purified from the crude venom of agkistrodon acutus by cm-sepharose cl-6b and deae-sepharose cl-6b ion exchange chromatography and then by fplc through superose 12 gel filtration. its molecular weight is about 23 kda and isoelectric point is near 6.0. it not only has fibrinolytic and caseinolytic activity, but also can hydrolyze baee. the local hemorrhagic activity was found in mice after the subcutaneous injection of this enzyme. edta can ... | 1998 | 9678189 |
| accutin, a new disintegrin, inhibits angiogenesis in vitro and in vivo by acting as integrin alphavbeta3 antagonist and inducing apoptosis. | endothelial integrins play an essential role in angiogenesis and cell survival. accutin, a new member of disintegrin family derived from venom of agkistrodon acutus, potently inhibited human platelet aggregation caused by various agonists (eg, thrombin, collagen, and, adenosine diphosphate [adp]) through the blockade of fibrinogen binding to platelet glycoprotein iib/iiia (ie, integrin alphaiibbeta3). in this report, we describe that accutin specifically inhibited the binding of monoclonal antib ... | 1998 | 9787163 |
| a new short chain rgd-containing disintegrin, accutin, inhibits the common pathway of human platelet aggregation. | a new short-chain disintegrin, accutin, was purified from the formosan agkistrodon acutus venom by using of gel filtration, ion exchanger and reverse phase hplc. the homogeneous protein is a 47-residue polypeptide with a molecular mass of 5241 da containing an arg-gly-asp sequence and seven cysteinyl residues at positions highly homologous to other disintegrins. accutin dose-dependently inhibited human platelet aggregation stimulated by adp, collagen, thrombin or the thromboxane analogue u46619 ... | 1998 | 9838213 |
| coagulation factor x-binding protein from deinagkistrodon acutus venom is a gla domain-binding protein. | factor ix/factor x-binding protein (ix/x-bp) is an anticoagulant isolated from the venom of trimeresurus flavoviridis (habu snake) and binds predominantly to factor ix. in this study, we isolated ix/x-bp-like proteins from the venom of deinagkistrodon acutus (hundred pace snake) with binding characteristics different from those of ix/x-bp. the complete amino acid sequence and binding characteristics of the main anticoagulant protein, named x-bp, were investigated. the concentrations of x-bp at h ... | 1998 | 9860851 |
| cdna cloning and expression of acutin. | acutin, a thrombin-like enzyme was purified from agkistrodon acutus venom in three steps by deae-sepharose cl-6b, superose 12 column on fplc and mono-q column chromatographies. its first 15 n-terminal amino acid residues sequence <viggvecdinehrfl> was then determined and the acutin cdna was isolated from venom gland total rna using rt-pcr. determination of its nucleotide sequence allowed elucidation of the amino acid sequence of mature peptide for the first time. the mature acutin has 233 amino ... | 1999 | 10049722 |
| purification, characterization, crystallization and preliminary x-ray diffraction of acuthrombin-b, a thrombin-like enzyme from agkistrodon acutus venom. | acuthrombin-b, a thrombin-like enzyme from agkistrodon acutus venom, has been isolated and purified to homogeneity by ion-exchange chromatography on deae-sepharose, gel filtration on sephacryl s-100 and fast performance liquid chromatography on deae-8hr. the protease is an acid protein (pi 6.0) consisting of two non-identical polypeptide chains (14.4 and 16 kda) and there is no disulfide bond between the subunits. its molecular weight is 27 kda as estimated by gel filtration on sephacryl s-100. ... | 1999 | 10329783 |
| purification and characterization of two fibrinogen-clotting enzymes from five-pace snake (agkistrodon acutus) venom. | from the snake venom of agkistrodon acutus, two proteases, acuthrombin-a and acuthrombin-c, were isolated and purified to homogeneity. they can cleave the human fibrinogen to release the fibrinopeptide a and fibrinopeptide b with specific activity of 120 and 370 nih units/mg, respectively; the fibrinogen-clotting activity can be inhibited distinctly by pmsf or dfp or edta, but not by heparin. the two proteases show also arginine-esterase activity hydrolyzing some synthetic substrates such as tam ... | 1999 | 10484747 |
| hemostatic disturbances observed in patients with snakebite in south china. | to investigate the hematological disorders after snakebite, we measured the maximum platelet aggregation rate (mar), antithrombin iii (at-iii) activity, alpha(2)-plasmin inhibitor (alpha(2)-pi) activity, concentration of fibrinogen (fg) and fibrin degradation products (fdp) in 25 samples from 17 patients with snakebite in south china. the results obtained in the patients before application of antivenom and patients with ophiophagus hannah (oh.) bite were as follows: (1) the mean mar values were ... | 2000 | 10758271 |
| influential factors affecting prognosis of snakebite patients management: kaohsiung chang gung memorial hospital experience. | the objective of this study was to determine the most influential factors affecting the prognosis of snakebite patients in kaohsiung chang gung memorial hospital. | 2000 | 11126148 |
| pharmacological characterization and antithrombotic effect of agkistin, a platelet glycoprotein ib antagonist. | 1. agkistin, purified from the snake venom of formosan agkistrodon acutus, belongs to the family of c-type lectin gpib binding proteins. it is a heterodimeric molecule, consisting of alpha- (16.5 kda) and beta- (15.5 kda) subunits with a molecular mass of 32,512 daltons examined by sds - page and mass spectrometry. 2. in vitro, agkistin concentration-dependently inhibited ristocetin-induced human platelet agglutination and aggregation in the presence of vwf. it also inhibited txa2 formation and ... | 2001 | 11181425 |
| binding of anticoagulation factor ii from the venom of agkistrodon acutus with activated coagulation factor x. | anticoagulation factor ii (acf ii) from the venom of agkistrodon acutus has been identified as a binding protein to activated bovine coagulation factor x (fxa) by the method of polyacrylamide gel electrophoresis and high performance liquid chromatography. this protein formed a 1:1 complex with fxa in the presence of ca2+ ions, and the maximal binding of acf ii to fxa occurred at the concentration of ca2+ ions of about 1mm. the binding of ca2+ ions to acf ii was analyzed by equilibrium dialysis a ... | 2001 | 11384724 |
| purification, sequencing, and phylogenetic analyses of novel lys-49 phospholipases a(2) from the venoms of rattlesnakes and other pit vipers. | basic phospholipase a(2) homologs with lys49 substitution at the essential ca(2+)-binding site are present in the venom of pit vipers under many genera. however, they have not been found in rattlesnake venoms before. we have now screened for this protein in the venom of rattlesnakes and other less studied pit vipers. by gel filtration chromatography and rp-hplc, lys49-phospholipase-like proteins were purified from the venoms of two rattlers, crotalus atrox and crotalus m. molossus, and five nonr ... | 2001 | 11594738 |
| a novel tetrameric venom protein, agglucetin from agkistrodon acutus, acts as a glycoprotein ib agonist. | a novel platelet agglutination inducer, agglucetin, was purified from the formosan agkistrodon acutus snake venom. it migrated as a single band with an apparent molecular mass of 58.8 kda and two distinct bands of 16.2/14.5 kda under non-reducing and reducing conditions by sds-page, respectively. further confirmed by fplc, electrospray ionization mass spectrometry and 2d-page, native agglucetin exists as a tetramer composed of disulfide-linked alpha1, alpha2, beta1 and beta2 subunits. partial n- ... | 2001 | 11686327 |
| thrombolysis effect with fiia from agkistrodon acutus venom in different thrombosis model. | a fibrinolytic enzyme from agkistrodon acutus venom, called fiia, was tested for thrombolytic activity in animals. | 2001 | 11743889 |
| antithrombotic and thrombolytic activities of agkisacutacin, a snake venom proteinase, in experimental models. | the antithrombotic and thrombolytic activities of agkisacutacin (agk), a component isolated from agkistrodon acutus, were determined in vitro and in vivo. the models employed included chandler's model, arterio-venous shunt model and pulmonary embolus model. the effects of agkisacutacin on coagulation, plasma fibrinogen and platelet aggregation induced by collagen, adenosine diphosphate (adp) and thrombin were also investigated. the results showed that agkisacutacin can significantly inhibit thro ... | 2000 | 11827724 |
| isolation and characterization of a neurotrophic factor-like substance from venom of agkistrodon acutus. | a neurotrophic factor-like substance from agkistrodon acutus was isolated by ion exchange and gel filtration chromatography and was found to be homogenous by electrophoresis. itsmolecular weight was estimated to be approximately 26 kd by gel filtration. a characteristic of the substance was that the protein consisted of two subunits which were bound one to another noncovalently. the analytical isoelectric focusing revealed its isoelectric point of 7.8. the biological activity of the substance wa ... | 1999 | 12136218 |
| cdna cloning and high-level expression of a thrombin-like enzyme from agkistrodon acutus venom. | agkistrodon acutus (guenther), a poisonous snake species of the family of crotalidae, is mainly found south of the yellow river in china. the main symptom of this poison is massive hemorrhage, in which thrombin-like enzymes (tles) in the venom play an important role. tles are abundant, especially in the venom of a. acutus. we isolated the total rna from the venom gland tissue of a. acutus and amplified the cdnas of the tles using reverse transcription-polymerase chain reaction (rt-pcr). the cdna ... | 2003 | 12808469 |
| taiwan's venomous snakebite: epidemiological, evolution and geographic differences. | located at the juncture of tropical and subtropical regions, taiwan has a warm and humid climate with abundant precipitation and food, which coupled with the island's diverse vegetation and landscape, makes it a suitable environment for many snake species. among these, naja atra, bungarus multicinctus, deinagkistrodon acutus, trimeresurus mucrosquamatus, trimeresurus stejnegeri, daboia russelii siamensis are the 6 principal venomous species, and have caused significant injuries and death over th ... | 2004 | 14964809 |
| cdna cloning, sequence analysis, and recombinant expression of akitonin beta, a c-type lectin-like protein from agkistrodon acutus. | to clone the cdna of a new member of snake venom c-type lectin-like proteins, to study its structure-function relationships and to achieve its recombinant production. | 2004 | 15000893 |
| hemorrhagic activity and mechanism of fiia, a fibrinolytic enzyme from agkistrodon acutus venom. | to study the local hemorrhagic activity of a fibrinolytic enzyme (fii(a)) from agkistrodon acutus venom and its mechanism. | 2004 | 15066223 |
| reduction of brain injury by antithrombotic agent acutobin after middle cerebral artery ischemia/reperfusion in the hyperglycemic rat. | in vivo magnetic resonance imaging (mri) was used to observe the effect of acutobin, a purified thrombin-like enzyme (tle), isolated from the snake venom of deinagkistrodon acutus, on mri-detected brain lesion volume and tissue perfusion deficit in a hyperglycemic rat right middle cerebral artery occlusion/reperfusion (mcao/r) model. acutobin (0.75 u/ml) was intravenously injected with a dosage of 2.5 u/kg body weight 30 min after mcao (mcao duration=60 min) and again 24 h after reperfusion. mul ... | 2004 | 15353234 |
| purification, characterization, crystallization and preliminary x-ray crystallographic analysis of two novel c-type lectin-like proteins: aall-a and aall-b from deinagkistrodon acutus venom. | aall-a and aall-b, two novel heterodimeric snake-venom c-type lectin-like proteins (sv-clps), were purified from the venom of deinagkistrodon acutus from anhui, china. strikingly, both these proteins can localize on and congregate human erythrocytes, instead of aiming at the common targets of sv-clps such as platelet glycoproteins, von willebrand factors, coagulant factors etc. the crystals of aall-a belong to space group p2, with unit-cell parameters a = 105.2, b = 56.2, c = 108.7 a, beta = 100 ... | 2004 | 15502319 |
| how does agkicetin-c bind on platelet glycoprotein ibalpha and achieve its platelet effects? | the platelet glycoprotein (gp) ib-ix-v receptor complex has a central role in primary haemostasis and possesses binding sites for the plasmatic adhesive protein von willebrand factor (vwf) and thrombin. several snake venom components have been identified in recent years that target this receptor complex and modulate its functionality. among them, agkicetin-c is from deinagkistrodon acutus and proved to be a potent antagonist of gpib-ix-v. we further studied the structure-activity relationships o ... | 2005 | 15777951 |
| fibrin(ogen)olytic character of fiia isolated from agkistrodon acutus venom. | to investigate the fibrin(ogen)olytic character of fiia isolated from agkistrodon acutus venom in vitro and in vivo. | 2005 | 15916735 |
| [cloning and bioinformatics analysis of a thrombin-like enzyme gene from agkistrodon acutus]. | the venoms of viperidae and crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. to obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' atggtgctgatcagagtgctagc 3' and 2 5' ctcctcttaa-ctttttcaaaagttt 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. total rna was prepared from the venom glands of a d. acutus s ... | 2005 | 16129030 |
| penetrating ocular injury caused by venomous snakebite. | to report the case of a patient who experienced a penetrating ocular injury with direct intraocular injection of venom from a snakebite. | 2005 | 16139013 |
| expression of a recombinant anticoagulant c-type lectin-like protein acfi in pichia pastoris: heterodimerization of two subunits is required for its function. | acfi is an anticoagulant c-type lectin-like protein (clp) isolated from agkistrodon acutus venom. to investigate the function of acfi and its subunits, the cdnas of two subunits were transformed and expressed in pichia pastoris separately or together by a novel strategy using two vectors with different selectable markers. the results showed that recombinant homodimers were secreted when the subunits were expressed alone, while heterodimers (racfi) were secreted when two subunits were co-expresse ... | 2005 | 16199073 |
| crystal structure of a non-hemorrhagic fibrin(ogen)olytic metalloproteinase complexed with a novel natural tri-peptide inhibitor from venom of agkistrodon acutus. | thrombotic occlusive diseases pose a great threat to human health. thrombolytic agents are in widespread use for the dissolution of arterial and venous pathologic thrombi in these kinds of diseases. snake venom metalloproteinases (svmps) can act directly on fibrin/fibrinogen and are therefore potential candidates for therapeutic use against thrombotic occlusive diseases. in this study, we have determined the crystal structure of fii, a novel non-hemorrhagic svmp isolated from anhui agkistrodon a ... | 2005 | 16330227 |
| recombinant production of fibrinogenase iv from agkistrodon acutus venom and its preliminary evaluation. | a novel metalloproteinase, recombinant fibrinogenase iv (rfiva), was expressed and purified from agkistrodon acutus venom. it is a single-chain protein with an apparent molecular weight of 27 kda. western blot showed that it had a good immunological reaction against anti-fiva rabbit serum. the kinetic parameters km and kcat of rfiva on the substrate t6140 were 7.471 x 10(-4) mol/l and 5.103 x 10(-5) s(-1). rfiva cleaved preferentially the alpha-chain, and the beta- and gamma-chains of fibrinogen ... | 2006 | 16429282 |
| structural models of the snake venom factor v activators from daboia russelli and daboia lebetina. | blood coagulation factor v (fv) is a multifunctional protein that circulates in human plasma as a precursor molecule which can be activated by thrombin or activated factor x (fxa) in order to express its cofactor activity in prothrombin activation. fv activation is achieved by limited proteolysis after arg709, arg1018, and arg1545 in the fv molecule. the venoms of daboia russelli and daboia lebetina contain a serine protease that specifically activates fv by a single cleavage at arg1545. we have ... | 2006 | 16807918 |
| purification and functional characterization of aav1, a novel p-iii metalloproteinase, from formosan agkistrodon acutus venom. | aav1, an alkaline glycoprotein (gp), was purified from agkistrodon acutus venom by two chromatographic steps on successive deae-sephadex a-50 and superdex 75 fplc columns. aav1 on sds-page under non-reducing conditions migrated as a monomeric and a polymeric forms with apparent molecular mass of 57 and 180 kda, respectively. upon reduction, it appeared as a single broad band with a mass of 50.3 kda corresponding to the size of a typical p-iii metalloproteinase acurhagin. the n-terminal sequence ... | 2007 | 17029743 |
| molecular phylogeography of endangered sharp-snouted pitviper (deinagkistrodon acutus; reptilia, viperidae) in mainland china. | using phylogenetic and population genetic approaches, the present study reports the phylogeographic structure of the sharp-snouted pitviper (deinagkistrodon acutus), a threatened snake species with commercial and medicinal importance in china. the entire mitochondrial nd2 gene (nadh dehydrogenase subunit 2) sequences of 86 individuals of d. acutus from 14 localities across its range in china were determined. based on the results of phylogenetic analyses, distribution of diagnostic sites, haploty ... | 2007 | 17643319 |
| the effect of fibrinolytic enzyme fiia from agkistrodon acutus venom on disseminated intravascular coagulation in rabbits. | a novel fibrinolytic enzyme, fii(a), was isolated from agkistrodon acutus venom, which can degrade fibrin/fibrinogen and dissolve thrombus without activating plasminogen or influencing the activities of tissue plasminogen activator (t-pa) and plasminogen activator inhibitor type-1 (pai-1). in this study, we evaluated the effect of fii(a) on lipopolysaccharide (lps)-induced experimental disseminated intravascular coagulation (dic) in rabbits, through the continuous infusion of 100-microg/kg/h lps ... | 2007 | 17964518 |
| agglucetin, a tetrameric c-type lectin-like venom protein, regulates endothelial cell survival and promotes angiogenesis by activating integrin alphavbeta3 signaling. | agglucetin, a platelet glycoprotein (gp)ib binding protein from formosan agkistrodon acutus (a. acutus) venom, could sustain human umbilical vein endothelial cell (huvec) proliferation and huvec adhering to immobilized agglucetin showed extensive spreading, which was strongly abrogated by integrin antagonists 7e3 and triflavin. flow cytometric analyses confirmed the expression of gpib complex on huvec is absent and fluorescein isothiocyanate (fitc)-agglucetin binds to huvec in a dose-dependent a ... | 2008 | 18312855 |
| recombinant fibrinogenase from agkistrodon acutus venom protects against sepsis via direct degradation of fibrin and tnf-alpha. | severe sepsis remains a leading cause of death and disability because of less effective therapy available for this disease. a complex interplay between the inflammatory factors and the coagulation pathways seems to be the fundamental mechanisms for the pathogenesis of sepsis. here we report that recombinant fibrinogenase ii (rf ii) from agkistrodon acutus plasmin-independently degraded the thrombi, and inhibited inflammatory responses by direct and specific degradation of tumor necrosis factor a ... | 2008 | 18634754 |
| identification of an unusual at(d)pase-like activity in multifunctional nad glycohydrolase from the venom of agkistrodon acutus. | nad-glycohydrolases (nadases) are ubiquitous enzymes that possess nad glycohydrolase, adpr cyclase or cadpr hydrolase activity. all these activities are attributed to the nadase-catalyzed cleavage of c-n glycosyl bond. aa-nadase purified from the venom of agkistrodon acutus is different from the known nadases, for it consists of two chains linked with disulfide-bond(s) and contains one cu(2+) ion. here, we show that aa-nadase is not only able to cleave the c-n glycosyl bond of nad to produce adp ... | 2009 | 18952139 |
| novel recombinant fibrinogenase of agkistrodon acutus venom protects against lps-induced dic. | disseminated intravascular coagulation (dic) is an acquired syndrome characterized by the widespread activation of coagulation. this leads to failure of multiple organs in the body and finally death. because there is no effective therapy for dic, the clinical prognosis is poor and the mortality is high. | 2009 | 19070354 |
| effect of metal ion substitutions in anticoagulation factor i from the venom of agkistrodon acutus on the binding of activated coagulation factor x and on structural stability. | anticoagulation factor i (acf i) isolated from the venom of agkistrodon acutus is an activated coagulation factor x (fxa)-binding protein that binds in a ca(2+)-dependent fashion with marked anticoagulant activity. the thermodynamics of the binding of alkaline earth metal ions to acf i and the effects of alkaline earth metal ions on the guanidine hydrochloride (gdnhcl)-induced unfolding of acf i and the binding of acf i to fxa were studied by isothermal titration calorimetry, fluorescence, circu ... | 2009 | 19184130 |
| a novel anti-platelet aggregation tripeptide from agkistrodon acutus venom: isolation and characterization. | aap, a tripeptide that inhibited rabbit platelet aggregation, was isolated from agkistrodon acutus venom by ion-exchange, gel filtration and reverse-phase chromatography. amino acid sequences which determined mainly by amino acid analyses and nmr spectroscopy indicated it was a tripeptide including pyroglutamic acid, asparagine and tryptophane residues. the esms experiment assigned a molecular weight of 429 da. aap inhibited rabbit platelet aggregation induced by adp, paf-acether, collagen and t ... | 2009 | 19345702 |
| biochemical and hemostatic mechanism of a novel thrombin-like enzyme. | thrombin-like enzyme (tle) plays a significant role in vessel injury hemostasis. a novel snake venom tle (agacutin) was purified from agkistrodon acutus snake venom. structural analysis indicated that agacutin is a heterodimer that has a mw of 29,402 da, a pi value of 5.39, and optimum activity at 35 degrees c and ph 7.5. the n-terminal 15 amino acid sequences of agacutin are dssgwssyegheyyv (small subunit) and dcssgwssyeehqyy (large subunit). in vitro studies indicated that the coagulation acti ... | 2009 | 19683796 |
| identification of a nitric oxide-dependent hypotensive effect of anticoagulation factor ii from the venom of agkistrodon acutus. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is a member of the coagulation factor ix/coagulation factor x-binding protein (ix/x-bp) family. acf ii forms a 1:1 complex with activated coagulation factor x in a ca(2+)-dependent fashion and thereby blocks the amplification of the coagulation cascade. in the present study, we have investigated the effect of acf ii on the mean arterial blood pressure (mabp) and heart rate (hr) in anaesthetized rats. the results ind ... | 2010 | 19723511 |
| structural characterization of n-linked oligosaccharides of defibrase from agkistrodon acutus by sequential exoglycosidase digestion and maldi-tof mass spectrometry. | detailed structures of n-linked oligosaccharides of defibrase, a highly active thrombin like enzyme (tle) purified from the venom of agkistrodon acutus, were successfully characterized using maldi-tof mass spectrometry in combination with sequential exoglycosidase digestion. monosaccharide composition analysis was performed by high performance anion-exchange chromatography with pulsed amperometric detection (hpaec-pad). galactose(gal), mannose(man), fucose(fuc), n-acetylglucosamine (glcnac), and ... | 2010 | 19800908 |
| characterization and molecular cloning of one novel c-type lectin from the venom of taiwan habu (trimeresurus mucrosquamatus). | one novel snake venom factor (termed trimecetin) was isolated and purified from the venom of taiwan habu (trimeresurus mucrosquamatus). the purified venom factor was shown to consist of two subunit chains linked by one disulfide bond. this two-chain factor showed high sequence homology at their n-terminal segments to some previously reported venom proteins such as alboaggregin-b isolated from trimeresurus albolabris and agkicetin from agkistrodon acutus. the cdna clones corresponding to the two ... | 2010 | 19931300 |
| effects of heating on the immunogenicity and biological toxicity of deinagkistrodon acutus venom and its fractions. | to improve toxoid preparation, the effects of selective heat denaturation were assessed on deinagkistrodon acutus venom. the venom and its fractions (peak 1 and peak 2 separated by gel filtration chromatography) were heated to various temperatures (45-70 degrees c) for 30 min, after which protein concentration, immunoreactivity, lethality, myotoxicity and hemorrhagic and membrane lysis activities of the samples were determined. in addition, the synergistic effects of the venom fractions were eva ... | 2010 | 20331994 |
| multi-host model-based identification of armillifer agkistrodontis (pentastomida), a new zoonotic parasite from china. | pentastomiasis is a rare parasitic infection of humans. pentastomids are dioecious obligate parasites requiring multiple hosts to complete their lifecycle. despite their worm-like appearance, they are commonly placed into a separate sub-class of the subphylum crustacea, phylum arthropoda. however, their systematic position is not uncontested and historically, they have been considered as a separate phylum. | 2010 | 20386597 |
| acurhagin-c, an ecd disintegrin, inhibits integrin alphavbeta3-mediated human endothelial cell functions by inducing apoptosis via caspase-3 activation. | acurhagin, a member of versatile metalloproteinase disintegrins from agkistrodon acutus venom, has been identified as a platelet aggregation inhibitor, previously. here, acurhagin-c, the c-terminal glu-cys-asp (ecd)-containing fragment of acurhagin, was evaluated for its biological activities and potential applications in anti-angiogenic therapy. | 2010 | 20590625 |
| a novel recombinant snake venom metalloproteinase from agkistrodon acutus protects against taurocholate-induced severe acute pancreatitis in rats. | severe acute pancreatitis (sap) remains a challenging disease to manage, with high mortality, limited understanding of pathogenesis and lack of specific therapy. recombinant fibrinogenase ii (rfii) from agkistrodon acutus venom has been found to degrade tumor necrosis factor-alpha (tnf-α) which is vital in mortality of sap. here we investigate the in vivo effects of rfii in rat sap and confirm the degradation effect of rfii for tnf-αin vitro. the sap model was prepared by retrograde infusion of ... | 2010 | 20600562 |
| terminal disialylated multiantennary complex-type n-glycans carried on acutobin define the glycosylation characteristics of the deinagkistrodon acutus venom. | glycosylation analysis of nonmammalian sources often springs surprises and conjures up intriguing views of evolutionary adaptation. many of the constituents of snake venoms are known to be glycosylated and yet very few were fully characterized and accorded specific functions. in the process of glycomic screening through the venoms from asian pit vipers, a partially o-acetylated neuacα2-8neuacα2-3galβ1-4glcnacβ1-terminal epitope was found to be the predominant glycosylation characteristic of the ... | 2010 | 21106559 |
| the effect of the fibrinolytic enzyme fiia from agkistrodon acutus venom on acute pulmonary thromboembolism. | to evaluate the effects of the fibrinolytic enzyme fii(a) from agkistrodon acutus venom on acute pulmonary thromboembolism (apt) in animal models. | 2011 | 21293476 |
| glomerular injury in mice induced by agkistrodon venom. | glomerular injury was produced in mice after a single ld50 intravenous dose of purified 100-pace snake venom (agkistrodon acutus). characteristic features in glomeruli where the venom was demonstrated immunohistochemically included cystic lesions of the capillary tufts, thrombosis, subsequent proliferative and sclerotic changes, and crescent formation. venom was recognized immunohistochemically in the glomerular endothelium, visceral basement membrane, mesangium, epithelium, and bowman's capsule ... | 2012 | 3511722 |
| the properties of the purified fibrinolytic principle from agkistrodon acutus snake venom. | | 1993 | 193216 |
| a novel direct factor xa inhibitory peptide with anti-platelet aggregation activity from agkistrodon acutus venom hydrolysates. | snake venom is a natural substance that contains numerous bioactive proteins and peptides, nearly all of which have been identified over the last several decades. in this study, we subjected snake venom to enzymatic hydrolysis to identify previously unreported bioactive peptides. the novel peptide ach-11 with the sequence ltfprivfvlg was identified with both fxa inhibition and anti-platelet aggregation activities. ach-11 inhibited the catalytic function of fxa towards its substrate s-2222 via a ... | 2015 | 26035670 |
| [expression, refolding and biological activity of recombinant type-i metalloproteinase acutolysin a from agkistrodon acutus]. | type-i snake venom metalloproteinase acutolysin a gene was cloned into the prokaryotic expression vector pbad/giiia and the resulting recombinant plasmid pds was obtained. by the induction with 0.02% l-(+)-arabinose, the recombinant metalloproteinase was expressed in insoluble inclusion body in e. coli top10 and reached up to 5%--10% of total bacterial proteins. the recombinant metalloproteinase has an additional sequence of n-terminal 22 amino acids and c-terminal 8 amino acids (housing 6 histi ... | 2002 | 12198576 |
| molecular cloning and expression of the cdna for disintegrin from agkistrodon acutus. | in order to clone novel and valuable genes from natural resources and develop genetic engineering drugs, total rna was extracted from the venom gland of agkistrodon acutus by one step method. the cdnas for low molecular weight metalloproteinase were amplified by rt-pcr and cloned into the pgemt vector. their sequence were determined. one of the deduced amino acid sequences included a metalloproteinase and a disintegrin (acugrin) at the carboxyl terminus. this result further confirms that metallo ... | 1999 | 12114966 |
| expression and biochemical characterization of acidic phospholipase a(2)i from agkistrodon acutus. | a cdna encoding acidic phospholipase a(2)i(a.aapla(2)i)from agkistrodon acutus was inserted into a bacterial expression vector and effectively expressed in e.coli rr1. the protein was produced as insoluble inclusion bodies. after partial purification by washing the inclusion bodies with triton x-100, denaturing and refolding, the renatured recombinant protein was purified by fplc column superose(tm)12. the enzymatic acti-vity and platelet aggregation inhibiting effect of the expressed a.aapla(2) ... | 1999 | 12114959 |
| balancing the expression and production of a heterodimeric protein: recombinant agkisacutacin as a novel antithrombotic drug candidate. | agkisacucetin extracted from the venom of agkistrodon acutus has been demonstrated to be a promising antithrombotic drug candidate in clinical studies due to its function as a novel platelet membrane glycoprotein (gp) ib inhibitor. agkisacucetin is a heterodimeric protein composed of α- and β-subunits with seven disulphide bonds. both subunits form inactive homodimeric products, which cause difficulties for recombinant production. in this study, agkisacucetin α- and β-subunits were inserted sequ ... | 2015 | 26144864 |
| rosmarinic acid in argusia argentea inhibits snake venom-induced hemorrhage. | a methanolic extract of argusia (or messerschmidia or tournefortia) argentea (boraginaceae) significantly inhibited hemorrhage induced by crude venom of trimeresurus flavoviridis. the extract was then separated according to antivenom activity by using silica gel column chromatography and hplc equipped with an octadecylsilanized silica gel (ods) column to afford rosmarinic acid (ra) (1) as an active principle. ra (1) significantly inhibited the hemorrhagic effect of crude venoms of t. flavoviridi ... | 2010 | 20512530 |
| cross-neutralization of thrombin-like enzymes in snake venoms by polyvalent antivenoms. | five polyvalent antivenoms (crotalidae; orient, north, central and south africa) were tested for their ability to neutralize the thrombin-like activity of snake venoms (bitis gabonica, agkistrodon acutus, bothrops asper, b. atrox, crotalus adamanteus). considerable cross-neutralization was observed. anti-coagulase antibodies were isolated from an antivenom by affinity chromatography using a purified enzyme from bitis gabonica venom. these antibodies neutralized the activity of most snake venom c ... | 1989 | 2629180 |
| [extraction, purification and identification of type ii collagen from agkistrodon acutus]. | the object of the research was to extract, purify and identify the type ii collagen of agkistrodon acutus. type ii collagen of a. acutus was extracted by enzyme decomposition method, and purified by ion exchange column chromatography. it was characterized by sds-page gel electrophoresis, ultraviolet spectrophotometry, infrared absorption spectroscopy and mass spectroscopy. the results showed that the size of c ii was about 130 kda. it absorbed at 223 nm. ir spectrum obtained showed that the trip ... | 2013 | 24494552 |
| crystallization and preliminary x-ray analysis of jararhagin, a metalloproteinase/disintegrin from bothrops jararaca snake venom. | jararhagin is a toxic protein, isolated from the venom of the snake bothrops jararaca, which is composed of a metalloprotease domain coupled to a disintegrin/cysteine-rich domain. it induces local haemorrhage owing to the proteolytic digestion of the basement membrane of capillaries. jararhagin also cleaves the alpha(2)beta(1) integrin on the surface of platelets, thereby acting as a potent inhibitor of collagen-induced platelet aggregation. crystals of jararhagin were obtained by the vapour-dif ... | 2001 | 11468397 |
| a novel recombinant fibrinogenase of agkistrodon acutus venom protects against hyperacute rejection via degradation of complements. | hyperacute rejection (har) is a main barrier in xenotransplantation, which is mediated by the combination of natural antibody to the xenograft and complement activation. current therapies have focus on the inhibition of complement by development of complement inhibitor and transgenic animal organ. here, we investigated the effects of rfii, a recombinant fibrinogenase from agkistrodon acutus venom, on complement and har. the degradation effect of rfii on complement was tested by sds-page, ch50 ex ... | 2013 | 23178656 |
| purification and characterization of anti-clotting protein component (acpf-7221) from venom of agkistrodon acutus. | snake venom contains a number of components with different pharmacological and biological activities, especially in cancer therapy, and has increasingly become a research focus. this study was designed to isolate and purify a novel anti-clotting protein component from the venom of agkistrodon acutus, and to explore its physico-chemical properties and biological activity. | 2009 | 19781305 |
| purification, n-terminal sequencing, partial characterization, crystallization and preliminary crystallographic analysis of two glycosylated serine proteinases from agkistrodon acutus venom. | aav-sp-i and aav-sp-ii, two glycosylated serine proteinases from agkistrodon acutus venom with fibrinogenolysis and esterolysis activities, have been purified to homogeneity by three-step ion-exchange chromatography. estimated by sds-page, the molecular weights of aav-sp-i and aav-sp-ii are about 32 and 31 kda under reducing conditions and 26 and 25 kda under non-reducing conditions, respectively. the first 24 n-terminal amino-acid residues are the same in both sequences and display a high homol ... | 2003 | 12595722 |
| new pentastomida, sambonia parapodum n. sp. from varanus salvator, and armillifer agkistrodontis n. sp. from agkistrodon acutus. | | 1966 | 5936511 |
| preparation and neutralization efficacy of igy antibodies raised againstdeinagkistrodon acutusvenom. | the five-paced pit viper (deinagkistrodon acutus), endemic to china and northern vietnam, is responsible for most snakebites in the chinese territory. antivenom produced from horses is the main treatment for snakebites, but it may cause numerous clinical side effects and have other disadvantages involved in their production such as the welfare of animals. the present study was conducted aiming to develop an alternative antibody (igy) from the egg yolk of leghorn chickens immunized with snake ven ... | 2017 | 28396683 |
| [studies on hemorrhagic toxins from the venoms of trimeresurus mucrosquamatus, crotalus ruber ruber, vipera aspis aspis and agkistrodon acutus and arginine ester hydrolases from trimeresurus mucrosquamatus venom]. | venom samples were corrected from several poisonous snakes, such as bungarus multicinctus, trimeresurus mucrosquamatus, t. gramineus, t. flavoviridis, and agkistrodon acutus, and stored in a desiccator at room temperature for 25 to 31 years. then they were compared with fresh venoms as to their biological activities. the characteristic local symptoms produced by the bite of venomous snakes of crotalidae and viperidae are hemorrhage, necrosis and muscular degeneration. hemorrhagic toxins were pur ... | 2000 | 10774254 |
| increased efficacy of antivenom combined with hyperbaric oxygen ondeinagkistrodon acutusenvenomation in adult rats. | snakebites are a neglected threat to global human health with a high morbidity rate. the present study explored the efficacy of antivenom with hyperbaric oxygen (hbo) intervention on snakebites, which could provide the experimental basis for clinical adjuvant therapy. | 2018 | 29363648 |
| ulnar artery pseudoaneurysm and compartment syndrome formation after snake bite to the left forearm. | to report the outcome of a patient who developed pseudoaneurysms and compartment syndrome after a deinagkistrodon acutus snakebite. | 2017 | 29124975 |
| cloning, expression, purification and bioactivity evaluation of a thrombin-like enzyme from deinagkistrodon acutus venom gland library. | to identify a new member of serine proteases from deinagkistrodon acutus via phage display technique and appraise its biocatalytic activities. | 2018 | 28936710 |
| investigation of the inhibitory potential of phospholipase a2inhibitor gamma from sinonatrix annularis to snake envenomation. | sapliγ is a novel gamma phospholipase a2inhibitor (pli) recently isolated from sinonatrix annularis, a chinese endemic non-venomous snake. to explore the neutralization effects of sapliγ in snakebite envenomation, a dose equivalent to ld50of deinagkistrodon acutus, agkistrodon halys and naja atra venom with/without sapliγ was inoculated into the gastrocnemius muscle of female kunming mice. the ability of sapliγ to inhibit myonecrosis and systemic toxicity were evaluated through investigations of ... | 2017 | 28746861 |
| dacin, one metalloproteinase from deinagkistrodon acutus venom inhibiting contraction of mouse ileum muscle. | mice were bitten by five-pace vipers (deinagkistrodon acutus), and then envenomed. it was well-known that the snake venom mainly disturbed the blood homeostasis of the envenomed victims. ocassionally, we found that the venom of d. acutus could inhibit the contraction tension of mouse ileum, so in this study we aimed to identify the active component inhibiting the contraction tension of mouse ileum in the snake venom. | 2017 | 28701157 |
| [effect of agkistrodon acutus venom pca on huvec activity]. | to investigate the effects of agkistrodon acutus venom protein c activator(pca) on ultrastructure of human umbilical vein endothelial cells(huvec), and the levels of tissue factor(tf), vascular von willebrand factor (vwf) and endothelin-1 secreted by huvec and to clarify the anti-thrombotic mechanism of pca. | 2017 | 28446313 |
| deinagkistrodon acutusenvenomation: a report of three cases. | deinagkistrodon acutusenvenomation is associated with severe hematological and wound complications but is rarely described. | 2017 | 28344596 |