Publications

TitleAbstractYear
Filter
PMID
Filter
antimutagenic activity of extracts from anticancer drugs in chinese medicine.the antimutagenic activities of extracts of 36 commonly used anticancer crude drugs from chinese herbs were studied by using the salmonella/microsomal system in the presence of picrolonic acid or benzo[a]pyrene to test whether they contain direct or indirect antimutagens. each crude drug was extracted with boiling water for 2 h, the method which is commonly used by chinese people to prepare the drug for oral intake. the extracts of pteris multifida p. showed the highest antimutagenic activity ag ...19883278214
[observation on the biological properties of cotton root skin (gossypium herbaceum l.) extract upon fertility and gestation in rats (author's transl)]. 19807399111
effect of grewia asiatica, gossypium herbacium and gymnema sylvestre on blood glucose, cholesterol and triglycerides levels in normoglycaemic and alloxan diabetic rabbits. 19883148751
distinguishing the biomass allocation variance resulting from ontogenetic drift or acclimation to soil texture.in resource-poor environments, adjustment in plant biomass allocation implies a complex interplay between environmental signals and plant development rather than a delay in plant development alone. to understand how environmental factors influence biomass allocation or the developing phenotype, it is necessary to distinguish the biomass allocations resulting from environmental gradients or ontogenetic drift. here, we compared the development trajectories of cotton plants (gossypium herbaceum l.) ...201222911802
physiological performance and differential expression profiling of genes associated with drought tolerance in contrasting varieties of two gossypium species.cotton is mostly cultivated under rain-fed conditions in india, thus faces frequent drought conditions during its life cycle. drought being a major stress factor responsible for yield penalty, there has always been a high priority to generate knowledge on adaptation and tolerance of cotton. in the present study, four cotton varieties, jkc-770 and kc-2 (gossypium hirsutum), and jkc-717 and rahs-187(gossypium herbaceum), were imposed to drought. under drought condition, differential changes in phy ...201525149149
identification of centromeric regions on the linkage map of cotton using centromere-related repeats.centromere usually contains high-copy-number retrotransposons and satellite repeats, which are difficult to map, clone and sequence. currently, very little is known about the centromere in cotton. here, we sequenced a bacterial artificial chromosome (bac) mapping to the centromeric region and predicted four long-terminal-repeat (ltr) retrotransposons. they were located in the heterochromatic centromeric regions of all 52 pachytene chromosomes in gossypium hirsutum. fiber-fish mapping revealed th ...201425238895
genome-wide transcriptomic comparison of cotton (gossypium herbaceum) leaf and root under drought stress.in this study, the 454 pyrosequencing platform was used for analyzing the comparative transcriptomic profiles of leaf and root tissues of 1-month-old cotton (gossypium herbaceum) plants under drought stress. a total of 56,354 and 49,308 reads were generated from leaf and root tissues, respectively, and clustered into 6,313 and 5,858 unigenes. the differentially expressed unigenes that showed up-regulation (≥2-fold) or down-regulation (2≤-fold) were considered for further analysis. a total of 3,5 ...201528324561
construction of cytogenetic map of gossypium herbaceum chromosome 1 and its integration with genetic maps.cytogenetic map can provide not only information of the genome structure, but also can build a solid foundation for genetic research. with the developments of molecular and cytogenetic studies in cotton (gossypium), the construction of cytogenetic map is becoming more and more imperative.201525628758
physiological performance and differential expression profiling of genes associated with drought tolerance in root tissue of four contrasting varieties of two gossypium species.root growth in drying soil is generally limited by a combination of mechanical impedance and water stress. as the major function of root tissue is water and nutrient uptake, so it imparts an important role in plant growth and stress management. previously, we have studied physiological performance and expression profiling of gene associated with drought tolerance in leaf tissue of four cotton varieties. here, we have further continued our studies with the root tissue of these varieties. the goss ...201625802007
phylogenetic analysis of gossypium l. using restriction fragment length polymorphism of repeated sequences.cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. we have reconstructed the phylogeny of the cotton genus, gossypium l., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. nuclear dna of 84 accessions ...201525877517
a new synthetic allotetraploid (a1a1g2g2) between gossypium herbaceum and g. australe: bridging for simultaneously transferring favorable genes from these two diploid species into upland cotton.gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, a1a1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. g. australe, a wild diploid cotton species (2n = 2x = 26, g2g2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistan ...201525879660
rapid recovery of photosynthetic rate following soil water deficit and re-watering in cotton plants (gossypium herbaceum l.) is related to the stability of the photosystems.the responses of gas exchange, chlorophyll fluorescence and the anti-oxidative system of cotton leaves were studied during water deficit and recovery. the results show that water deficit led to a reversible reduction in the photosynthetic rate. this reduction was mainly accompanied by stomatal limitation. the activity of photosystem ii (psii) and photosystem i (psi) was relatively stable during water deficit and recovery. water deficit caused an enhanced production of reactive oxygen species (ro ...201626948982
a new sythetic hybrid (a1d5) between gossypium herbaceum and g. raimondii and its morphological, cytogenetic, molecular characterization.the diploid species g. herbaceum (a1) and g. raimondii (d5) are the progenitors of allotetraploid cotton, respectively. however, hybrids between g. herbaceum and g. raimondii haven't been reported. in the present study, hybridization between g. herbaceum and g. raimondii was explored. morphological, cytogenetic and molecular analyses were used to assess the hybridity. the interspecific hybrid plants were successfully obtained. most of the morphological characteristics of the hybrids were interme ...201728187145
repeated polyploidization of gossypium genomes and the evolution of spinnable cotton fibres.polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (myr) ago, and allopolyploidy reuniting divergent gossypium genomes approximately 1-2 myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (gossypium hirsutum and gossypium barb ...201223257886
independent domestication of two old world cotton species.domesticated cotton species provide raw material for the majority of the world's textile industry. two independent domestication events have been identified in allopolyploid cotton, one in upland cotton (gossypium hirsutum l.) and the other to egyptian cotton (gossypium barbadense l.). however, two diploid cotton species, gossypium arboreum l. and gossypium herbaceum l., have been cultivated for several millennia, but their status as independent domesticates has long been in question. using geno ...201627289095
antennal electrophysiological responses of three parasitic wasps to caterpillar-induced volatiles from maize (zea mays mays), cotton (gossypium herbaceum), and cowpea (vigna unguiculata).many parasitic wasps are attracted to volatiles that are released by plants when attacked by potential hosts. the attractiveness of these semiochemicals from damaged plants has been demonstrated in many tritrophic systems, but the physiological mechanisms underlying the insect responses are poorly understood. we recorded the antennal perception by three parasitoids (cotesia marginiventris, microplitis rufiventris, and campoletis sonorensis) to volatiles emitted by maize, cowpea, and cotton plant ...200516124230
changes in the sugar composition and molecular mass distribution of matrix polysaccharides during cotton fiber development.cotton (gossypium herbaceum l.) fiber development consists of a fiber elongation stage (up to 20 d post-anthesis) and a subsequent cell wall thickening stage. cell wall analysis revealed that the extractable matrix (pectic and hemicellulosic) polysaccharides accounted for 30-50% of total sugar content in the fiber elongation stage but less than 3% in the cell wall thickening stage. by contrast, cellulose increased dramatically after the fiber elongation ceased. the amounts of extractable xyloglu ...200211978869
[molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction].using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to c-terminal peptides ggaactcccttttctggatagctcacc and cctggtccgaacccaaacaggacgcccc, were used to amplify, via polymerase chain reaction, genomic sequences from two gossypium species, a diploid gossypium herbaceum, and a tetraploid gossypium hirsutum cv. 108f. amplified dna was separated into individual sequences by cloning into an m13 vector. six diff ...20061339958
[anti-hbsag herbs employing elisa technique].with the aid of the elisa system this schema represented a laboratory approach to the recognition of anti-hbsag capability of herbs by using 300 herbal extracts. altogether 10 herbs (3.0%) were identified as effective. when forming a multiplex plan by employing 10 average p/n ratios as exemplified by 5 varying doses of herb (0.3, 0.6, 1.2, 2.5, 5.0 mg/100 microliters), 2 varying concentrations of hbsag (10.92, 14.26 p/n ratio), and 3 varying contact time periods (immediate, 1h, 2h) for the compr ...19902268945
relative amount of symbionts in insect hosts changes with host-plant adaptation and insecticide resistance.the impact of symbionts on their hosts depends on their infection density. in the current study, we investigated the effects of host plant and insecticide resistance on the relative amount of symbionts portiera, hamiltonella, rickettsia, and cardinium in the whitefly bemisia tabaci (gennadius) b biotype. the relative amount of symbionts in three host plant-adapted subpopulations (cucumber, cucumis sativus l.; cabbage, brassica oleracea l.; and cotton, gossypium herbaceum l.) with the same geneti ...201323339787
above- and below-ground terpenoid aldehyde induction in cotton, gossypium herbaceum, following root and leaf injury.studies on induced defenses have predominantly focused on foliar induction by above-ground herbivores and pathogens. however, roots are attacked by as many if not more phytophages than shoots, so in reality plants are exposed to above- and below-ground attack. here, we report effects of foliar and/or root damage on terpenoid aldehyde accumulation in cotton (gossypium herbaceum). using hplc, we analyzed concentrations of individual terpenoid aldehydes in foliage and root tissue. in undamaged plan ...200415074657
antifungal activity of alkyl and heterocyclic aza-derivatives of gossypol as well as their complexes with naclo4 against fusarium oxysporum f. sp. lupini.eight alkyl and six heterocyclic aza-derivatives of gossypol (2-15) have been synthesized using gossypol (1) extracted from gossypium herbaceum cottonseeds. the ability of gossypol aza-derivatives to form complexes with naclo(4) has been investigated by electrospray ionisation (esi) mass spectra recorded in the positive and negative ion detection modes. the gossypol aza-derivatives have been characterized by ft-ir, (1)h and (13)c nmr spectroscopic methods and subsequently tested for their antifu ...200919264482
[hepatoprotective effect of gossipium hirsutum extract on acute experimental hepatitis on rat liver injury].to investigate the protective effect on the mice acute experimental hepatic injury by flos gossypium herbaceum extracts (fgf-i, fgf-ii).200819007020
ethnomedicine of dharwad district in karnataka, india--plants used in oral health care.the present ethnomedicine survey covers the dharwad district of karnataka in southern india. it was revealed that 35 plants belonging to 26 families are being used to treat different types of oral ailments like toothache, plaque and caries, pyorrhea and aphthae. sixteen of these plants were new claims for the treatment of oral ailments not previously reported in the ethnomedicinal literature of india. basella alba, blepharis repens, capparis sepiaria, oxalis corniculata and ricinus communis are ...200415325728
hemoglobin-stimulated growth and antioxidant activities in cultured cotton cells.changes in cellular reactive oxygen scavenging enzymes were assessed in suspension-derived cells of cotton (gossypium herbaceum) cv. dhumad following culture with a commercial bovine hemoglobin (hb) solution (erythrogen) at 1:100-1:1000 (v:v). mean (+/- sem) fresh (f.wt.) and dry weights (d.wt.) of cells after 25 d of culture were significantly (p <.05) greater in medium supplemented with 1:750 and 1:1000 (v:v) erythrogen, compared to controls lacking erythrogen. for example, with 1:750 (v:v) er ...200111705693
oral administration of pectin-rich plant extract enhances c3 and c4 complement concentration in woman colostrum.c3 and c4 components of the complement are normally present in human colostrum. these compounds are natural antibacterial agents. pectin-rich plant extracts have been shown to induce prolactin release and milk synthesis when administered by the oral route in rat. in the present work, extract from a plant rich in pectin, gossypium herbaceum was given orally to women 2 days after parturition. the extract enhanced concentration of c3 and c4 in colostrum but did not modify the total hemolytic comple ...19989698276
antifertility screening of plants. vi. effect of five indigenous plants on early pregnancy in albino rats.the petroleum ether, alcoholic and aqueous extracts of apium graveolens linn., butea monosperma lam. kuntz., and gossypium herbaceum linn., the aqueous extract of aloe barbadensis mill.syn., and the juice of unripe fruits of ananas comosus were tested on albino rats by a method which detects any antizygotic, blastocystotoxic, antiimplantation, and early abortifacient activity. the extracts were administered for 1-7 days. the dosages for a. graveolens, b. monosperma, and g. herbaceum were 100 ...19705505214
an evaluation of total and digestible lysine as a predictor of lysine availability in protein concentrates for young pigs.forty pigs between 23 and 51 d of age were given, ad lib., diets containing 7.9 g lysine/kg. the diets contained wheat and one of five protein concentrates: milk, peanut (arachis hypogaea) meal, cotton-seed (gossypium herbaceum) meal, meat meal or lupins (lupinus augustifolius). twenty of the pigs were given an indigestible marker, 103ru-labelled tris-(1,10-phenanthroline)-ruthenium(ii) chloride, between 51 and 56 d of age and were killed at 56 d of age. a further forty pigs, between 23 and 51 d ...19853933552
the histone h1 variant accumulates in response to water stress in the drought tolerant genotype of gossypium herbaceum l.we have optimized and improved the protocol for extraction of histone proteins from gossypium herbaceum. histone proteins were isolated by acid extraction method and fractionation of histone proteins were performed using rp-hplc (reverse-phase high performance liquid chromatography). analysis of histones from drought tolerant (vagad) and drought sensitive genotype (rahs-14) indicated that the tolerant genotype vagad encodes a 29 kda protein. protein sequencing on maldi tof/tof revealed that the ...201222644313
types, levels and patterns of low-copy dna sequence divergence, and phylogenetic implications, for gossypium genome types.to explore types, levels and patterns of genetic divergence among diploid gossypium (cotton) genomes, 780 cdna, genomic dna and simple sequence repeat (ssr) loci were re-sequenced in gossypium herbaceum (a1 genome), g. arboreum (a2), g. raimondii (d5), g. trilobum (d8), g. sturtianum (c1) and an outgroup, gossypioides kirkii. divergence among these genomes ranged from 7.32 polymorphic base pairs per 100 between g. kirkii and g. herbaceum (a1) to only 1.44 between g. herbaceum (a1) and g. arboreu ...201222511177
comparative transcriptomic analysis of roots of contrasting gossypium herbaceum genotypes revealing adaptation to drought.root length and its architecture govern the adaptability of plants to various stress conditions, including drought stress. genetic variations in root growth, length, and architecture are genotypes dependent. in this study, we compared the drought-induced transcriptome of four genotypes of gossypium herbaceum that differed in their drought tolerance adaptability. three different methodologies, namely, microarray, pyrosequencing, and qrt-pcr, were used for transcriptome analysis and validation.201223194183
insights into the evolution of cotton diploids and polyploids from whole-genome re-sequencing.understanding the composition, evolution, and function of the gossypium hirsutum (cotton) genome is complicated by the joint presence of two genomes in its nucleus (at and dt genomes). these two genomes were derived from progenitor a-genome and d-genome diploids involved in ancestral allopolyploidization. to better understand the allopolyploid genome, we re-sequenced the genomes of extant diploid relatives that contain the a1 (gossypium herbaceum), a2 (gossypium arboreum), or d5 (gossypium raimo ...201323979935
genome wide expression profiling of two accession of g. herbaceum l. in response to drought.genome-wide gene expression profiling and detailed physiological investigation were used for understanding the molecular mechanism and physiological response of gossypium herbaceum, which governs the adaptability of plants in drought conditions. recently, microarray-based gene expression analysis is commonly used to decipher genes and genetic networks controlling the traits of interest. however, the results of such an analysis are often plagued due to a limited number of genes (probe sets) on mi ...201222424186
physiological and proteomic responses of cotton (gossypium herbaceum l.) to drought stress.cotton genotype rahs 187 was analyzed for changes in physiology, biochemistry and proteome due to drought stress. the deleterious effect of drought in cotton plants was mainly targeted towards photosynthesis. the gas-exchange parameters of net photosynthesis (a), stomatal conductance (g(s)) and transpiration (e) showed a decreasing trend as the drought intensity increased. the fluorescence parameters of, effective quantum yield of psii (φ(psii)), and electron transport rates (etr), also showed a ...201222285410
development and characterization of genomic and expressed ssrs for levant cotton (gossypium herbaceum l.).four microsatellite-enriched genomic libraries for ca(15), ga(15), aag(8) and atg(8) repeats and transcriptome sequences of five cdna libraries of gossypium herbaceum were explored to develop simple sequence repeat (ssr) markers. a total of 428 unique clones from repeat enriched genomic libraries were mined for 584 genomic ssrs (gssrs). in addition, 99,780 unigenes from transcriptome sequencing were explored for 8,900 ssr containing sequences with 12,471 expressed ssrs. the present study adds 1, ...201222038488
studies on amendment of different biopolymers in sandy loam and their effect on germination, seedling growth of gossypium herbaceum l.different biopolymers, agar, cellulose, alginate, psyllium gaur gum, and bacterial exopolysaccharide (eps) powders were amended to check their efficacy in enhancing maximum water holding capacity (mwhc), permanent wilting point (pwp), and germination and seedling growth of the gossypium herbaceum in a laboratory scale. the efficacy of all biopolymers for enhancement of mwhc, pwp, and growth was also analyzed by measuring organic carbon, organic matter, total nitrogen, respiration rate, and micro ...201120859704
identification of micro-rnas in cotton.the plant genome has conserved small non-coding micrornas (mirnas) genes about 20-24 nucleotides long. they play a vital role in the gene regulation at various stages of plant life. their conserved nature among the various organisms not only suggests their early evolution in eukaryotes but also makes them a good source of new mirna discovery by homology search using bioinformatics tools. a systematic search approach was used for interspecies orthologues of mirna precursors, from known sequences ...201618603441
chromosome structural changes in diploid and tetraploid a genomes of gossypium.the genus gossypium, which comprises a divergent group of diploid species and several recently formed allotetraploids, offers an excellent opportunity to study polyploid genome evolution. in this study, chromosome structural variation among the a, at, and d genomes of gossypium was evaluated by comparative genetic linkage mapping. we constructed a fully resolved rflp linkage map for the diploid a genome consisting of 275 loci using an f2 interspecific gossypium arboreum x gossypium herbaceum fam ...200616699553
scanning electron microscope studies on genetically modified (gm) crops--g.m. cotton fiber (gossypium herbaceum). 200515934511
an integrated chemical, thermal, and microbiological approach to compost stability evaluation.the evaluation of compost stability is of the utmost importance for the reliability of composting as a recycling strategy. to date there is no single parameter that can give a sure indication of the stability of composts from different starting materials. this paper investigates different methods of evaluating the dynamics of transformation of materials and the stability level of the end products in a composting process. the following parameters were determined on compost samples of different ag ...201314674563
xyloglucan breakdown during cotton fiber development.cotton (gossypium herbaceum l.) fibers elongated almost linearly up to about 20 days post anthesis. the molecular mass of xyloglucans in fiber cell walls decreased gradually during the elongation stage. when enzymatically active (native) cell wall preparations of fibers were autolyzed, the molecular mass of xyloglucans decreased. the decrease was most prominent in wall preparations obtained from the rapidly elongating fibers. the xyloglucan-degrading activity was recovered from the fiber cell wa ...200314658396
the dna sequence of a gypsy element from gossypium hirsutum l. and characterization of gypsy elements in three gossypium species.a strategy was developed to isolate a complete gypsy-element from gossypium hirsutum l. based on the sequence of a rapd that was polymorphic in near isoganic lines of cotton that varied in leaf shape. a 5998 nt clone was isolated and its gene order and sequence confirmed it was a gypsy-type retroelement. sequences homologous to the gag portion of this clone were also found in gossypium herbaceum l. and gossypium raimondii l. a portion of the open reading frame of the integrase gene was amplified ...200314631654
salinity tolerance and antioxidant status in cotton cultures.this investigation focuses upon cell growth and antioxidant status in cultured cells of cotton (gossypium herbaceum) cvs. dhumad (salt-tolerant, tol), h-14 (medium salt-tolerant, med), and rahs-2 (salt-sensitive, sen) exposed to saline stress (50-200 mm nacl). mean (+/- sem) callus fresh weight (f.wt.) and dry weight (d.wt.) gains were significantly (p <.05) greater on murashige and skoog (ms) [1]-based medium with 50 mm nacl for the tol cv. (62% and 16%, respectively) over nacl-free controls (2 ...200212160932
new world tetraploid cottons contain old world cytoplasm.new world tetraploid cottons (gossypium spp.) originated through hybridization of ancestral diploid species that presently have allopatric ranges in asia-africa (the a genome) and the new world tropics and subtropics (the d genome). despite intensive study, the identity of the parental diploids and the antiquity of polyploidization remain unresolved. in this study, variation in the maternally inherited chloroplast genome was assessed among species representing both of the parental genomes and th ...198916594050
localization of isocitrate lyase in germinating seeds of cotton (gossypium herbaceum l.). 19725085633
[localization of the acid phosphatase in the embryo of gossypium herbaceum with light and electron microscopes]. 20005898038
genetic investigations of the whorled mutant in gossypium herbaceum. 195617247673
transcriptomic profiling of developing fiber in levant cotton (gossypium herbaceum l.).cotton (gossypium spp.) is an imperative economic crop of the globe due to its natural textile fiber. molecular mechanisms of fiber development have been greatly revealed in allotetraploid cotton but remained unexplored in gossypium herbaceum. g. herbaceum can withstand the rigors of nature like drought and pests but produce coarse lint. this undesirable characteristic strongly needs the knowledge of fiber development at molecular basis. the present study reported the transcriptome sequence of t ...201829332190
anti-diabetic and hypolipidemic effects of extract from the seed of gossypium herbaceum l. in alloxan-induced diabetic rabbits.anti-diabetic and hypolipidemic effects of seed of gossypium herbaceum l (gh) and its aqueous and ethanol extracts were investigated in alloxan-induced diabetic rabbits. normal, alloxan-induced diabetic and treated groups of rabbit were examined for their serum glucose, triglyceride, cholesterol, creatinine and urea levels. water/food intake and toxic effect of test substances were also observed in treated rabbits. effect of test agents on architecture of pancreatic β-cells was evaluated histopa ...201728603116
assessment of gene flow between gossypium hirsutum and g. herbaceum: evidence of unreduced gametes in the diploid progenitor.in the framework of a gene flow assessment, we investigated the natural hybridization rate between gossypium hirsutum (aadd genome) and g. herbaceum (aa genome). the latter species, a diploid progenitor of g. hirsutum, is spontaneously present in south africa. reciprocal crosses were performed without emasculation between g. herbaceum and g. hirsutum neither examination of the morphological characteristics nor flow cytometry analysis of the 335 plants resulting from the g. hirsutum × g. herbaceu ...201728546386
Displaying items 1 - 50 of 50