visualization of nucleolar organizer regions im mammalian chromosomes using silver staining. | a simple ammoniacal silver staining procedure, designated ag-as, differentially stains the chromosomal locations of ribosomal dna in certain mammalian species. this was critically demonstrated by ag-as staining of the nucleolus organizer regions in karyotypes of the same species and cell lines used for locating the ribosomal cistrons by dna/rna in situ hybridization. with ag-as, silver stained nors (ag-nors) are visualized as black spherical bodies on yellow-brown chromosome arms. ag-nors were v ... | 1975 | 53131 |
transformation of indian muntjac cells by murine and avian sarcoma viruses. | indian muntjac cells were efficiently transformed by murine sarcoma virus (msv) and avian sarcoma viruses (asv). when colony formation of the infected cells was examined in soft agar, many colonies were formed by the asv-injected cells but no colony was seen in the msv-infected cells. the asv-transformed cell clones differed among the clones in morphology, presence of inducible asv genome, and karyotypes. | 1978 | 208907 |
establishment and characterization of indian muntjak cell lines transformed with simian virus 40. | kidney cells of an indian muntjak were transformed with simian virus 40 (sv40). the transformation efficiency of the tertiary cultures was very high when estimated by the agar suspension culture method. the efficiency was about 0.015% when infected at an input multiplicity of 0.4 p.f.u./cell. clonal cell lines were established from the colonies in soft agar medium. most of the cell lines and their subclones produced a small amount of infectious sv40. the sv40 virion antigen-positive cells in a c ... | 1979 | 217958 |
visualization of the interphase chromosomes of ornithogalum virens and muntiacus muntjak. | a technique for visualizing "interphase chromosomes" was applied to nuclei of the angio-spermous plant, ornithogalum virens (2 n = 6), and the male mammal, muntiacus munjak (2 n = 7), in an attempt to correlate the numbers of "chromosomes" visible during interphase with the respective diploid chromosome numbers. the alterations in chromosome structure observed during g1, s, and g2 periods were comparable to those previously reported in allium cepa and chinese hamster (cho line) cells [33], but f ... | 1979 | 428620 |
tumorigenicity of indian muntjac diploid cells by the proviral integration of sarcoma gene of a mouse retrovirus. | the transformed clonal isolates of indian muntjac diploid cells by a mouse sarcoma virus, 43-2xv, were tested for tumorigenicity in athymic nude mice. in spite of the indistinguishable transformed morphology, the tumorigenicity exhibited four different patterns: (a) no tumor formation; (b) slowly growing regressive tumor formation; (c) rapidly growing regressive tumor formation; and (d) rapidly growing progressive tumor formation. this demonstrates that the same diploid host cells transformed by ... | 1979 | 501287 |
structural organization of chromosomes of the indian muntjac (muntiacus muntjak). | the identification, morphology, and banding pattern of the chromosomes of the indian muntjac (muntiacus muntjak) are described. a diagrammatic representation of the banding pattern as revealed by various techniques is presented following the nomenclature suggested by paris conference (1971) for human chromosomes. the y2 chromosome and the neck of the x chromosome are late replicating based on observations made with the use of a bromodeoxuridine plus giemsa technique. most of the g-bands are earl ... | 1979 | 509990 |
preferential occurrence of sister chromatid exchanges at heterochromatin-euchromatin junctions in the wallaby and hamster chromosomes. | chromosomes of two mammalian species, the white-throated wallaby and the rat-like hamster, possessed large amounts of constitutive heterochromatin which is detectable as c bands. by making use of this character the frequency of sister chromatid exchanges (sces) was determined for the c band and the euchromatic regions of the chromosome. in both species, the distribution of sces in the euchromatin of chromosomes was found to be proportional to its metaphase length, while the number of sces locali ... | 1979 | 510085 |
distribution of 18+28s ribosomal genes in mammalian genomes. | in situ hybridization with 3h 18s and 28s ribosomal rna from xenopus laevis has been used to study the distribution of dna sequences coding for these rnas (the nucleolus organizing regions) in the genomes of six mammals. several patterns of distribution have been found: 1) a single major site (rat kangaroo, seba's fruit bat), 2) two major sites (indian muntjac), 3) multiple sites in centromeric heterochromatin (field vole), 4) multiple sites in heterochromatic short arms (peromyscus eremicus), 5 ... | 1975 | 1104290 |
characterisation and correction of a mammalian cell mutant defective in late step of base excision repair. | an indian muntjac cell line, svm, is unusually sensitive to cell killing induced by a range of alkylating agents. cells transfected with the escherichia coli ada gene or human genomic dna have allowed the response of svm to alkylating agents to be dissociated into two distinct components. thus, in svm, which expresses very low levels of alkyltransferase (at), o6-alkylguanine appears to be the major cytotoxic, clastogenic, and recombinogenic lesion following exposure to agents such as methylnitro ... | 1992 | 1287851 |
[the effect of mycoplasma contamination on the karyotypic structure of a skin fibroblast cell line from the indian muntjac]. | the karyotypic variability has been studied in a low chromosomal cell line of the indian muntjak skin fibroblasts contaminated with mycoplasma arginini r-16 and acholeplasma laidlawii a. the mycoplasmal contamination exerted influence on the cell distribution for the chromosome number. the frequency of the modal class cells with 7 chromosomes, having the main structure variant of the karyotype (msvk) 2 + 2 + 1 + 1 + 1, was seen to decrease, while the frequency of the submodal class cells with 6 ... | 1992 | 1440934 |
comparative gene mapping in the species muntiacus muntjac. | an extreme case of chromosomal evolution is presented by the two muntjac species muntiacus muntjac (indian muntjac, 2n = 6 [females], 7 [males]) and m. reevesi (chinese muntjac, 2n = 46). despite disparate karyotypes, these phenotypically similar species produce viable hybrid offspring, indicating a high degree of dna-level conservation and genetic relatedness. as a first step toward development of a comparative gene map, several indian muntjac homologs of known human type i anchor loci were map ... | 1992 | 1486805 |
centromere autoantigens are associated with the nucleolus. | because of their importance as target antigens in scleroderma and since all other major autoantigens in scleroderma can be localized to the interphase nucleolus, we were interested in a further investigation of the potential relationship between interphase centromeres and the nucleolus. using human anticentromere autoantibodies (aca) from patients with the crest form of scleroderma as probes in indirect immunofluorescence microscopy, we observed nonrandom interphase "clumping" of centromeres in ... | 1992 | 1572401 |
abnormal sister-chromatid exchange induction by 3-aminobenzamide in an sv40-transformed indian muntjac cell line: relationships with dna maturation and dna-strand breakage. | in svm cells, an sv40-transformed line of indian muntjac fibroblasts, levels of sister-chromatid exchanges are known to be abnormally high after uv-irradiation or alkylation. the svm line is also known to have a defect in the processing of dna-strand breaks. sister-chromatid exchange in other cells is known to be stimulated by the poly(adp-ribose) transferase inhibitor, 3-aminobenzamide, which also retards dna-break sealing. sister-chromatid exchanges in svm cells are found to be hypersensitive ... | 1991 | 1702517 |
characterisation of a tandem repetitive sequence cloned from the deer capreolus capreolus and its chromosomal localisation in two muntjac species. | the isolation and characterisation of a highly repetitive dna sequence from the genome of the roe deer capreolus capreolus is reported. this sequence is characterised by tandem repetition and located within centric heterochromatin as demonstrated by non isotopic in situ hybridisation to the karyotypes of the indian and chinese muntjacs. amplification and/or clustering of these sequences during the drastic karyotype evolution of the genus muntiacus was noted in the large centromere of the x chrom ... | 1991 | 1774183 |
[the chromosome variability of the indian muntjac in somatic cell hybrids]. | hybrids were produced between the indian muntjak fibroblasts and rat jensen sarcoma cell line (jf1) auxotrophic for asparagine. they were selected without cloning under conditions providing survival of parental indian muntjak and hybrid cells. this allowed to compare the indian muntjak chromosome variability in the parental cells and hybrids under identical culture conditions. the frequency of muntjak chromosome aberrations proved to de higher in the hybrids (up to 47%) than in the parental cell ... | 1991 | 1821494 |
cadmium-induced multistep transformation of cultured indian muntjac skin fibroblasts. | during the past five years we have made a series of cadmium-transformed and resistant fibroblast cell lines by continuous low-level exposure to cadmium. in the present paper we describe the use of four of these lines with varying degrees of transformation to investigate the multistep nature of cadmium carcinogenesis. these include: (a) m cell, an immortal but nontransformed muntjac skin fibroblast line; (b) ccr5, a morphologically transformed and cadmium-resistant line derived from m cells after ... | 1990 | 2073461 |
structure of dna polymerase alpha-primase complexes from mammalian cells analyzed by using monoclonal antibodies. | the molecular masses of two of the four dna polymerase alpha-primase complex subunit peptides from various mammalian cells have been compared through the use of specific monoclonal antibodies. one monoclonal antibody (e4) binds to 77-kda peptide from hela cells and cognate peptides from other mammalian cells (monkey, mouse, bovine, indian muntjac, and hamster). another monoclonal antibody (a5) binds the 180-kda type peptide and its degradation product (160-kda peptide) of the mammalian dna polym ... | 1990 | 2113520 |
chromosomal evolution in cervidae. | on the basis of chromosome data obtained on 30 species and 20 subspecies of cervidae, a report is submitted on the karyosystematics of this family. the primitive karyotype of cervidae may be inferred to be composed of 35 acrocentric pairs (2n = 70 fn = 70). during the phyletic evolution of this family different types of chromosome rearrangements were probably selected and the group may have differentiated karyologically into three branches: (1) the cervinae that fixed a centric fusion resulting ... | 1990 | 2249009 |
molecular cloning of a mammalian gene involved in the fixation of uv-induced mutations. | a mammalian dna damage tolerance gene has been isolated by dna transfection and cosmid rescue. following cotransfection of mouse genomic dna and psv2neo into svm, the uv hypersensitive mutant indian muntjac cell line, clones with a 1.7 to 2.0-fold greater d37 value for uv killing were isolated. this trait was carried through three rounds of transfection. a neo gene and flanking sequences from a tertiary transfectant were cloned by cosmid rescue. the cosmid clone confers uv resistance to svm and ... | 1990 | 2267625 |
localization of cloned, repetitive dna sequences in deer species and its implications for maintenance of gene territory. | the deer family shows the largest variation in chromosome number known in mammals (2n = 6 to 2n = 70). the drastic rearrangement of the chromosomes allows to test the prediction, based on the chromosome field theory, according to which dna sequences tend to occupy specific territories within the eukaryotic chromosome. nuclear dnas were isolated from eight deer and two bovidae species. these dnas were cleaved with the restriction enzymes eco ri and alu i. following eco ri digestion highly repetit ... | 1990 | 2361878 |
localization of the repetitive telomeric sequence (ttaggg)n in two muntjac species and implications for their karyotypic evolution. | it has been suggested that the chromosome set of the indian muntjac, muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the chinese muntjac, m. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. the location of the highly conserved human telomeric sequence (ttaggg)n in the metaphase chromosomes of m.m. vaginalis and its close relative, m. reevesi, was investigated by non-radioact ... | 1990 | 2369836 |
in situ localization of a mammalian protamine gene: parameters affecting specificity of hybridization. | southern hybridization analysis of indian muntjac genomic dna with the eco-taq bovine genomic protamine probe revealed a simple banding pattern. the pattern of hybridization was identical with that previously observed in the genus bos. this suggested that the bovine probe specifically hybridized to the indian muntjac protamine gene. the opportunity was thus provided to assign the chromosomal location of the protamine gene in a comparatively simple system. accordingly, this probe and the correspo ... | 1990 | 2384210 |
molecular mechanisms of alkylation sensitivity in indian muntjac cell lines. | the responses of two indian muntjac cell lines to two monofunctional alkylating agents were investigated. an sv40-transformed line (svm) had an increased sensitivity to cell killing when compared to the other, euploid line (dm) after exposure both to methyl nitrosourea (mnu) and to dimethylsulphate (dms) and also exhibited higher frequencies of sister chromatid exchanges (sces) following alkylation. the hypersensitivity of svm to dms correlates with the defective repair of single-strand breaks t ... | 1989 | 2544312 |
reversible extinction of insulin gene expression in insulinoma x fibroblast somatic cell hybrids. | to investigate for the presence of regulator(s) repressing the expression of insulin gene in cells other than pancreatic beta cells, rat insulinoma (rin) cells secreting insulin were hybridized with fibroblasts from various species. in rin x l mouse fibroblast hybrids, which maintained most of the parental chromosomes, no insulin transcripts were detected. in three rin x indian muntjac fibroblast hybrids and one rin x human fibroblast hybrid which had lost dna from the fibroblast parent through ... | 1989 | 2553459 |
evolution of compound centromeres. a new phenomenon. | a new type of centromere aberration in a transformed cell line of rat cerebral endothelial origin is described. these cells exhibit normal monocentric, dicentric, and multicentric chromosomes. the centromeres in dicentrics and multicentrics express variable locations along the chromosome. the centromeres in some of the multicentrics are located next to each other, with small intervening noncentromeric chromatin. in others, the centromeres appear to be in the immediate vicinity of each other with ... | 1989 | 2790749 |
defective post-replication recovery and u.v. sensitivity in a simian virus 40-transformed indian muntjac cell line. | the responses to u.v. of two cell lines derived from the indian muntjac are described. the u.v. sensitivity of the diploid cell falls within the range of most normal mammalian cells while the other, a heteroploid cell, transformed by sv40, is much more sensitive to killing. this hypersensitivity cannot be explained by defective excision repair: the two cell types are indistinguishable in this activity as judged by inhibitor-associated dna break accumulation and unscheduled dna synthesis. rather, ... | 1986 | 3013792 |
localization and characterization of recombinant dna clones derived from the highly repetitive dna sequences in the indian muntjac cells: their presence in the chinese muntjac. | a total of seven, highly repeated, dna recombinant m13 mp8 clones derived from a hpa ii digest of cultured cells of the indian muntjac (muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and dna sequencing. two of the clones, b1 and b8, contain satellite dna inserts which are 80% homologous in their dna sequences. b1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. this consensus sequence, tccctgacgcaactcgagaggaatcctg ... | 1986 | 3015505 |
dna cloning and hybridization in deer species supporting the chromosome field theory. | the cervidae show the largest variation in chromosome number found within any mammalian family. the eight species of deer which are the subject of this study vary in chromosome number from 2n = 70 to 2n = 6. three species of bovidae are also included since they belong to a closely related family. digestion of nuclear dnas with the restriction endonucleases hae iii, hpa ii, msp i, eco ri, xba i, pst i and bam hi reveals that there is a series of highly repetitive sequences forming similar band pa ... | 1986 | 3022841 |
[karyological characteristics of cell sublines of the kidney of the kangaroo rat and of skin fibroblasts of the indian muntjac]. | a study was made of the karyotypic structure of sublines derived from the kangaroo rat's kidney (nbl-3) and skin fibroblasts of the indian muntjac, available in the cell culture bank of the institute of cytology acad. sci. ussr. a comparative karyologic analysis was made of subline nbl-3 both contaminated with mycoplasma (nblk) and decontaminated with antibiotics (nbld). authentic differences in cell distribution according to chromosome number in nblk and nbld variants were shown. modal numbers ... | 1988 | 3176180 |
caffeine induces uncoordinated expression of cell cycle functions after ultraviolet irradiation. accelerated cycle transit, sister chromatid exchanges and premature chromosome condensation in a transformed indian muntjac cell line. | caffeine enhances the lethal effect of dna-damaging agents. it also affects the timing of events in the cell cycle; the enhanced cytotoxicity may be partly due to caffeine's ability to overcome the protective damage-induced delay in s or g2 phase. when the effects of caffeine are compared in a normal indian muntjac cell line and a simian virus 40 (sv40)-transformed, ultraviolet light (u.v.)-sensitive line in which u.v. induces many sister chromatid exchanges, different cell cycle sensitivities a ... | 1988 | 3253296 |
mammalian kinetochore/centromere composition: a 50 kda antigen is present in the mammalian kinetochore/centromere. | the composition of the mammalian kinetochore/centromere was studied by indirect immunofluorescence and immunoblotting protocols using serum from a patient with the crest variant of scleroderma. the results of these studies suggest that a protein with a molecular weight of 50 kda is localized at the surface of the primary constrictions (the kinetochore region) of both human and indian muntjac chromosomes. in addition, we were able to verify the presence of a 19.5 kda antigen (cenp-a), previously ... | 1987 | 3315496 |
microtubule and microfilament distribution and tubulin content in the cell cycle of indian muntjac cells. | using dapi, rabbit antitubulin antibody, fitc-labeled goat anti-rabbit igg, and tritc-phalloidin to stain individual cells, the microspectrophotometric analysis showed that three markers that represent the nucleus, microtubules (mt), and microfilaments (mf), respectively, could be recognized in individual cells without interference. the phase of the cell cycle was determined by dna content. we found that in indian muntjac (im) cells, the amount of tubulin in g2 and m phases was about twice as mu ... | 1988 | 3402282 |
scanning electron microscope analysis of structural changes and aberrations in human chromosomes associated with the inhibition and reversal of inhibition of ultraviolet light induced dna repair. | metaphase chromosomes appear decondensed in preparations from mitotic cells that have been irradiated with ultraviolet light (uv) and incubated with inhibitors of dna synthesis; under these conditions dna repair is inhibited and both single and double strand dna breaks accumulate. after reversal of the inhibition chromosomes are condensed, but are often damaged. in this paper we show by scanning electron microscopy (sem) that decondensed hela chromosomes are composed of fibre clusters similar to ... | 1987 | 3436222 |
direct evidence for the non-random localization of mammalian chromosomes in the interphase nucleus. | indirect immunofluorescence staining with human anti-centromere autoantibodies from a patient (lu 851) suffering from the crest form of scleroderma was used to analyse chromosome topology in interphase nuclei of rat-kangaroo (pto) and indian muntjac (im) cells. in some cells, centromeres were arranged in pairs suggesting association of homologous chromosomes. clustering of centromeres at one pole of the nucleus (rabl configuration) and other patterns suggesting higher order organization were als ... | 1986 | 3530789 |
a highly repetitive dna component common to all cervidae: its organization and chromosomal distribution during evolution. | in recent work we have isolated and characterized a highly repetitive dna (mmv satellite ia) from muntiacus muntjak vaginalis, the species with the most reduced karyotype in the cervidae family. we have now analysed the genomes of nine related species for the presence of mmv satellite ia components, and have determined their organization and chromosomal distribution. repetitive satellite ia type dna is present in all species of the cervidae, and also in the bovine, but not in a species of the tr ... | 1987 | 3595313 |
the muntjak satellite ia sequence is composed of 31-base-pair internal repeats that are highly homologous to the 31-base-pair subrepeats of the bovine satellite 1.715. | the nucleotide sequence of a cloned muntjak satellite ia repeat unit (muntiacus muntjak vaginalis) was determined. the repeat is 807 base pairs (bp) long. by introducing minor deletions and insertions, the whole sequence of the satellite can be arranged in 27 subrepeats of 31 bp length. although diverged relative to each other, all subrepeats show a homology of more than 53% with the common consensus sequence. in 29 out of the 31 bp the consensus sequence of the muntjak satellite subrepeat is id ... | 1985 | 3979396 |
dna methylation and viral gene expression in adenovirus-transformed and -infected cells. | the level of dna methylation in adenovirus type 2 (ad2) and type 12 (ad12) dna was determined by comparing the cleavage patterns generated by the isoschizomeric restriction enzymes hpaii and mspi. as previously reported virion dna of ad2 and ad12 is not methylated. parental or newly synthesized ad2 dna in productively infected human kb or hek cells is not methylated either, nor is the integrated form of ad2 dna in productively infected cells. hamster cells and muntiacus muntjak cells are abortiv ... | 1980 | 6160461 |
sister chromatid differentiation and isolabeling of chromosomes. | isolabeling observed during sister chromatid differentiation (scd) was studied from human skin fibroblasts by the fluorescence-plus-giemsa (fpg) technique. bromodeoxyuridine (brdu) was fed to exponentially dividing cells for 52 h to enable completion of two consecutive cycles of dna replication. during this period, the late-replicating regions of some chromosomes were able to go through three replication cycles. these chromosome regions had evidently incorporated brdu bifiliarly in both chromati ... | 1981 | 6165669 |
mercury-induced segregational errors of chromosomes in human lymphocytes and in indian muntjac cells. | segregational errors of chromosomes were studied in human lymphocytes and in indian muntjac fibroblasts exposed to methylmercury chloride (ch3hgcl) or mercury chloride (hgcl2). the cells were exposed to the mercury compounds only during a limited period of the pre-dna synthetic stage of the cell cycle or from that stage up to mitosis. in the lymphocytes we observed a clear increase of c-mitotic figures for both mercury compounds and for both exposure times. segregational errors were, however, mu ... | 1984 | 6234683 |
double transformation of indian muntjac cells by avian and murine sarcoma viruses. | avian sarcoma virus-transformed indian muntjac cells, sr-mm-1, formed foci by murine sarcoma-xenotropic murine leukemia virus complex [msv(x-mulv)] superinfection. the response of sr-mm-1 and parental normal indian muntjac mm-2k cells to msv(x-mulv) infection was compared. focus formation by msv(x-mulv) followed two-hit kinetics in mm-2k, but one-hit kinetics in sr-mm-1 cells. msv(x-mulv)-infected sr-mm-1 cells formed larger colonies than uninfected sr-mm-1 cells in soft agar, while no colony wa ... | 1980 | 6247523 |
simian virus 40 causes persistent infection of muntjac cells in the absence of virus transformation. | sv40 infection of muntiacus muntjak cells (atcc, ccl: 157) resulted in abortive transformation with formation of t antigen and induction of cellular dna replication in the absence of virus production. these cells were resistant to stable transformation by sv40 regardless of the route of infection, including microinjection of virus into cell nuclei. the present studies show that t antigen-containing cells persist and that the number of t antigen-positive cells remains constant in infected culture ... | 1981 | 6271915 |
the inability of in vitro transforming sv40 subgenomes to cause tumors in vivo. | linear or subgenomic sv40 dnas were transfected into cells from a variety of species (including rodent, dog, muntjak, and monkey) and injected subcutaneously into neonate syrian hamsters for tumorigenicity testing. the 'early-region' subgenomes were capable of transforming cells in vitro. complete genomes or complementary subgenomes could transform nonpermissive and semipermissive cells, were infectious for permissive cells, and induced tumors from which infectious virus could be rescued. tumors ... | 1984 | 6321395 |
identification of an indian muntjac dna fragment preferentially hybridizing to the x-chromosome. | upon digestion of dna from male and female indian muntjac (muntiacus muntjak) fibroblasts with the restriction enzyme hae iii or alu i, a prominent fragment of dna (greater than 20 kb in length) was observed. this excluded dna (ex-dna) appeared not to contain sequences recognized by a variety of restriction enzymes and constituted about 0.6% of the total dna in the female genome. for equal amounts of dna digested, female dna contained more of this material. in situ hybridization indeed revealed ... | 1984 | 6325221 |
autographa californica nuclear polyhedrosis virus (acnpv) dna does not persist in mass cultures of mammalian cells. | autographa californica nuclear polyhedrosis virus (acnpv) is one of the most extensively studied baculoviruses. we have investigated whether acnpv or its dna can replicate and/or persist in cultures of mammalian cells. human hela cells or primary human embryonic kidney cells, simian cv1 cells, hamster bhk21 (b3) cells or muntiacus muntjak cells growing in monolayer cultures were used in these studies. cells were inoculated with acnpv at multiplicities ranging from 0.1 to 100 pfu/cell. subsequent ... | 1983 | 6402854 |
compound kinetochores of the indian muntjac. evolution by linear fusion of unit kinetochores. | the chromosomes of the indian muntjac (muntiacus muntjak vaginalis) are unique among mammals due to their low diploid number (2n = 6 female, 7 male) and large size. it has been proposed that the karyotype of this small asiatic deer evolved from a related deer the chinese muntjac (muntiacus reevesi) with a diploid chromosome number of 2n = 46 consisting of small telocentric chromosomes. in this study we utilized a kinetochore-specific antiserum derived from human patients with the autoimmune dise ... | 1984 | 6525895 |
genome size of man and animals relative to the plant allium cepa. | a direct feulgen-cytophotometric comparison of the genomic dna content (c value) was performed between the liliaceous plant species allium cepa and a number of animal species to reassess the genome size ratios between plants and animals. these appeared unduly ambiguous as a consequence of divergent picogram estimates in several animal reference species. taking 1c = 16.75 pg for allium cepa, the estimates were (1c value in picograms): man, 3.11; indian muntjak ccl 157 cell line, 2.68; domestic pi ... | 1983 | 6671147 |
enhanced frequency of chromosome aberrations in lymphocytes of male compared with female muntjacs after x-ray irradiation in vitro. | recently, there has been considerable interest in the study of radiation-induced dicentrics and other chromosome aberrations in phytohaemagglutinin (pha)-stimulated blood lymphocytes of various mammals, including man, with the aim of establishing a proper biological dosimetry for the assessment of genetic radiation hazards in human. these studies have revealed that the radiosensitivity of lymphocytes differs between species and even between individuals of the same species, but the cause(s) of th ... | 1981 | 7219547 |
persistent infection of muntiacus muntjak cells with adenovirus type 2 and abortive infection with adenovirus type 12. | | 1980 | 7355579 |
the clastogenic and mutagenic effects of ascorbigen and 1'-methylascorbigen. | ascorbigen, which occurs naturally in the human diet, and a synthetic analogue (1'-methylascorbigen), were assayed for cytotoxic and clastogenic activities in a sv40-transformed indian muntjac cell line (svm), and for mutagenic activity in the ames test using salmonella typhimurium strains ta98 and ta100. ascorbigen had no effect upon the clonal survival of svm at concentrations below 0.21 mg/ml and did not induce either chromosome aberrations or sister-chromatid exchanges (sces) at any concentr ... | 1994 | 7508569 |
anticentromere antibody specific to human cells directed against the cenp-b autoantigen. | we describe the generation of a new antipeptide antibody that binds to the centromeric region of human mitotic chromosomes. this antibody was raised against a synthetic peptide corresponding to the 481-493 amino acid sequence of the human cenp-b autoantigen. immunofluorescence analysis revealed that this anti-cenp-b serum showed an identical pattern to the human crest anticentromere autoantibody in both mitotic cells and interphase nuclei. immunoblotting showed that this antibody reacts with the ... | 1993 | 7680607 |
the clastogenic effects of isothiocyanates. | four isothiocyanates (itcs), three of which are commonly found in the human diet, were tested for the ability to induce chromosome aberrations in an sv40-transformed indian muntjac cell line. whilst allyl itc was found to be inactive the other three (benzyl itc, phenethyl itc and phenyl itc) were found to be significant inducers of chromosome damage in the absence of any metabolic activation. given that experimental data have demonstrated that itcs can also protect laboratory animals from the in ... | 1993 | 7685491 |
dna topoisomerase ii alpha is the major chromosome protein recognized by the mitotic phosphoprotein antibody mpm-2. | we have determined that the major mitotic phosphoprotein in chromosomes recognized by the antiphosphoprotein antibody mpm-2 is the 170-kda isoform of topoisomerase ii (topo ii), the isoform predominant in proliferating cells. as a prerequisite to making this discovery, it was necessary to develop protocols to protect chromosomal proteins from dephosphorylation during cell extraction and chromosome isolation procedures. immunofluorescence analysis of the large chromosomes prepared from indian mun ... | 1993 | 7690961 |
[the effect of mycoplasmal contamination of cultures of skin fibroblasts from the indian muntjac and of the subsequent decontamination of the cultures using ciprofloxacin on the karyotypic structure of the cell line]. | the karyotypic variability of indian muntjac skin fibroblast cell line, cultured for 95-168 days after contamination with acholeplasma laidlawii strain pg-8, has been investigated. the contaminated cultures differ from noncontaminated ones in cell distribution for chromosome number. the noncontaminated cultures have modal number of chromosomes equal to 7 with the main structure variant of the karyotype (svk) 2+2+1+1+1. in the contaminated cultures the cell number with 7 chromosomes and the main ... | 1994 | 7809977 |
cytotoxic and clastogenic effects of benzyl isothiocyanate towards cultured mammalian cells. | benzyl isothiocyanate (bitc), a compound found in cruciferous vegetables present in the human diet, has previously been shown to induce chromosome aberrations in an indian muntjac cell line. the results of this study show that it also induces both chromosome aberrations and sister chromatid exchanges (sces) in chinese hamster ovary (cho) cells in the absence of an exogenous metabolic activation system and induces dna strand breaks as measured by the single-cell gel electrophoresis assay. however ... | 1995 | 7821874 |
a tandemly repetitive, centromeric dna sequence from the canadian woodland caribou (rangifer tarandus caribou): its conservation and evolution in several deer species. | a highly repetitive dna clone, designated rt-pst3, was isolated from the psti digest of canadian woodland caribou (rangifer tarandus caribou; 2n = 70) genomic dna. it was found to be a 991 bp monomer of a tandemly repeated dna sequence comprising about 5.7% of the genome and localized to the centromeric regions of all caribou acrocentric autosomes. southern blot analyses revealed that this caribou satellite dna sequence was well conserved in the genomes of five other deer species studied. in sit ... | 1994 | 7921645 |
comparative chromosome painting discloses homologous segments in distantly related mammals. | comparative chromosome painting, termed zoo-fish, using dna libraries from flow sorted human chromosomes 1, 16, 17 and x, and mouse chromosome 11 discloses the presence of syntenic groups in distantly related mammalian orders ranging from primates (homo sapiens), rodents (mus musculus), even-toed ungulates (muntiacus muntjak vaginalis and muntiacus reevesi) and whales (balaenoptera physalus). these mammalian orders have evolved separately for 55-80 million years (myr). we conclude that zoo-fish ... | 1994 | 8054973 |
simple purification of human chromosomes to homogeneity using muntjac hybrid cells. | chromosome sorting from hybrid cells offers enormous advantages for gene mapping and cloning, but purification of most chromosomes has been largely hindered by their similarity in size to other chromosomes. we have developed a novel cell line and strategy that allows simple, mass purification of mammalian chromosomes, permitting significant target genome enrichment. this strategy takes advantage of the small number of giant chromosomes (1,2,x) of the female indian muntjac, a barking deer, avoidi ... | 1994 | 8075635 |
staurosporine- and radiation-induced g2-phase cell cycle blocks are equally released by caffeine. | we show here that the arrests of cells in g2 phase of the cell cycle induced by either staurosporine or ionizing radiation are closely related phenomena governed by a common kinase signaling pathway. the protein kinase inhibitor staurosporine induces a complete g2-phase arrest in exponentially growing tk6 human lymphoblastoid and v79 chinese hamster fibroblast cells. both cell types are equally sensitive to the kinase inhibitor and the arrest is dependent on its continued presence. caffeine comp ... | 1993 | 8378530 |
interstitial localization of telomeric dna sequences in the indian muntjac chromosomes: further evidence for tandem chromosome fusions in the karyotypic evolution of the asian muntjacs. | the indian muntjac is believed to have the lowest chromosome number in mammals (2n = 6 in females and 2n = 7 in males). it has been suggested that a series of tandem chromosome fusions from an ancestral chinese muntjac-like species (2n = 46) may have occurred during the karyotypic evolution of the indian muntjac. in an earlier study, hybridization signals generated by the chinese muntjac centromeric heterochromatin dna probe (c5) were found to be distributed interstitially in the chromosomes of ... | 1993 | 8485991 |
dna content measurements and an improved idiogram for the indian muntjac. | the indian muntjac, an asiatic deer, has the lowest diploid chromosome number among mammals (female 2n = 6; male 2n = 7). using flow cytometric quantification of propidium iodide-stained cells, we determined the dna content of muntjac cells to be 94% that of human. this suggests that the muntjac may serve as a model for investigation of karyotypic evolution and rearrangement. in order to facilitate future comparative gene mapping studies, computer-aided analysis of digitized metaphase chromosome ... | 1993 | 8513693 |
topoisomerase ii alpha is associated with the mammalian centromere in a cell cycle- and species-specific manner and is required for proper centromere/kinetochore structure. | a study of the distribution of topoisomerase ii alpha (topo ii) in cells of six tissue culture cell lines, human (hela), mouse (l929), rat, indian muntjac, rat kangaroo (ptk-2), and wallaby revealed the following features: (1) there is a cell cycle association of a specific population of topo ii with the centromere. (2) the centromere is distinguished from the remainder of the chromosome by the intensity of its topo ii reactivity. (3) the first appearance of a detectable population of topo ii at ... | 1996 | 8794854 |
syntenic groups between human chromosome 9 and indian muntjac chromosomes revealed by zoo-fish. | the recent techniques of chromosome painting allow the molecular comparison of chromosomes from distantly related mammals. here we show a modified zoo-fish technique based on lower stringency which allows to identify syntenic regions between human and indian muntjac chromosomes. while when probing with human chromosome 2, no consistent cluster of hybridization were observed, with human chromosome 9, a number of discrete fluorescent regions along the indian muntjac chromosomes were found. | 1995 | 8835186 |
dominant genetic instability and sensitivity to dna damaging agents in a mammalian cell line. | an sv40 transformed indian muntjac cell line (svm) has been shown to be hypersensitive to cell killing by a wide range of dna damaging agents. evidence points to defects in dna replication and dna recombination resulting in chromosome instability both spontaneously and following exposure to dna damaging agents. we have generated proliferating hybrids between svm and a spontaneously transformed indian muntjac cell line (dm). study of these hybrids indicates that the svm phenotype acts in a geneti ... | 1996 | 8914603 |
[the genotoxic effect of ciprofloxacin on cultured cells from the kangaroo rat kidney and on skin fibroblasts from the indian muntjac]. | the genotoxicity of an antibiotic ciprofloxacin (cf) in doses of 10, 25, 50 and 100 mkg/ml under its short-term (6-48 h) and long-term (15-30 days) action on sublines of rat kangaroo kidney, nbl-3-11, and indian muntjak skin fibroblasts has been studied. the emergence of genotoxic effect depends on the dose and time of ciprofloxacin action on both the sublines, but the degree of this effect does not depend on these parameters directly. ciprofloxacin exerts no influence on cell distribution for c ... | 1996 | 9019897 |
repetitive sequence families in alces alces americana. | high-resolution derivative melting was used to obtain detailed distributions of local (g + c) contents in a number of ruminant dnas. profiles over low (g + c) regions [20-36% (g + c)] are congruent for all ruminants. this region represents 45-50% of the nuclear dna content and primarily contains intergenic and intron sequences. the high (g + c) region, where most coding sequences are found [38-68% (g + c)], is marked by satellite bands denoting the presence of transcriptionally inert, tandemly r ... | 1997 | 9115175 |
comparative chromosome painting in mammals: human and the indian muntjac (muntiacus muntjak vaginalis). | we have used human chromosome-specific painting probes for in situ hybridization on indian muntjac (muntiacus muntjak vaginalis, 2n = 6, 7) metaphase chromosomes to identify the homologous chromosome regions of the entire human chromosome set. chromosome rearrangements that have been involved in the karyotype evolution of these two species belonging to different mammalian orders were reconstructed based on hybridization patterns. although, compared to human chromosomes, the karyotype of the indi ... | 1997 | 9119378 |
zoo-fluorescence in situ hybridization analysis of human and indian muntjac karyotypes (muntiacus muntjak vaginalis) reveals satellite dna clusters at the margins of conserved syntenic segments. | zoo-fluorescence in situ hybridization (fish) with human whole chromosome-specific paint probes revealed extensive homoeologies between indian muntjac (2n=6, 7 female, male) and human karyotypes (2n=46). forty-two conserved syntenic segments, corresponding to all human chromosomes except the y chromosome, produced a near-complete coverage of the muntjac complement and revealed margins of interspecific segmental homoeology. to test the hypothesis that interstitial satellite dna loci, illuminated ... | 1997 | 9244453 |
segmental homology among cattle (bos taurus), indian muntjac (muntiacus muntjak vaginalis), and chinese muntjac (m. reevesi) karyotypes. | in an attempt to examine homologies between indian and chinese muntjac karyotypes at a subchromosomal level, five bovine cosmids were comparatively mapped by heterologous fluorescence in situ hybridization (fish). in the indian muntjac (2n = 6) all cosmids mapped to chromosome 1, whereas in the chinese muntjac (2n = 46) two cosmids mapped to chromosome 3 and one cosmid each mapped to chromosomes 1, 7, and 17. these markers have maintained their intrachromosomal position relative to a centromere/ ... | 1997 | 9284921 |
localization of cenp-e in the fibrous corona and outer plate of mammalian kinetochores from prometaphase through anaphase. | we have conducted a detailed ultrastructural analysis of the distribution of the kinesin-related centromere protein cenp-e during mitosis in cultured human, rat kangaroo and indian muntjac cells. using an affinity-purified polyclonal antibody and detection by 0.8 nm colloidal gold particles, cenp-e was localized primarily to the fibrous corona of the kinetochore in prometaphase and metaphase cells. some labeling of the kinetochore outer plate was also observed. the distribution of fibrous corona ... | 1997 | 9391217 |
use of the indian muntjac idiogram to align conserved chromosomal segments in sheep and human genomes by chromosome painting. | we have hybridized all 28 chromosome-specific painting probes from the domestic sheep (ovis aries, 2n = 54) onto metaphase chromosomes of the indian muntjac deer (muntiacus muntjak vaginalis, 2n = 6,7) and identified 35 conserved chromosomal segments. results from this study show that most of the sheep acrocentric chromosomes hybridized to single regions in the indian muntjac genome. this conserved hybridization pattern supports the concept that the large indian muntjac chromosomes were derived ... | 1997 | 9403070 |
cenp-g: a new centromeric protein that is associated with the alpha-1 satellite dna subfamily. | a new constitutive centromere-specific protein (cenp) has been identified as a result of its recognition as an autoantigen by serum from a patient with gastric antral vascular ectasia disease. conventional immunoblotting and two-dimensional double blotting with both this antiserum and a known anti-centromere antiserum showed that this antiserum predominantly recognized a mr 95,000 protein that is different from all known cenps. we have named this new protein cenp-g. this protein was detected at ... | 1998 | 9639657 |
emerging patterns of comparative genome organization in some mammalian species as revealed by zoo-fish. | although gene maps for a variety of evolutionarily diverged mammalian species have expanded rapidly during the past few years, until recently it has been difficult to precisely define chromosomal segments that are homologous between species. a solution to this problem has come from the development of zoo-fish, also known as cross-species chromosome painting. the use of zoo-fish to identify regions of chromosomal homology has allowed the transfer of information from map-rich species such as human ... | 1998 | 9647633 |
recognition of mammalian centromeres by anti-dynein and anti-dynactin components. | antibodies against one component of dynein, namely ic, and two components of dynactin, namely p50 and p150, were studied for their activity against the centromeres of three mammalian species, human, mouse and indian muntjac. ordinarily human and mouse chromosomes carry one dot-like centromere, whereas indian muntjac has two or three tandemly organized centromeres per chromosome. dynein and dynactin antigens can be detected on all active centromeres. however, inactive centromeres (which do not bi ... | 1998 | 9717177 |
organization of highly acetylated chromatin around sites of heterogeneous nuclear rna accumulation. | histones found within transcriptionally competent and active regions of the genome are highly acetylated. moreover, these highly acetylated histones have very short half-lives. thus, both histone acetyltransferases and histone deacetylases must enrich within or near these euchromatic regions of the interphase chromatids. using an antibody specific for highly acetylated histone h3, we have investigated the organization of transcriptionally active and competent chromatin as well as nuclear histone ... | 1998 | 9725908 |
naturally occurring gm2 gangliosidosis in two muntjak deer with pathological and biochemical features of human classical tay-sachs disease (type b gm2 gangliosidosis). | two juvenile sibling male muntjak deer (muntiacus muntjak) with histories of depression, ataxia, circling and visual deficits were studied. cerebrospinal fluid analyses revealed vacuolated macrophages that contained long parallel needle-like intracytoplasmic inclusions. light microscopically, nerve cell bodies throughout the brain, ganglion cells within the retina and neurons in the myenteric plexuses were variably swollen and had pale granular to finely vacuolated eosinophilic cytoplasm. neuron ... | 1999 | 9930895 |
effects of oleic acid, docosahexaenoic acid and eicosapentaenoic acid on background and genotoxin-induced frequencies of sces in indian muntjac fibroblasts. | muntjac cells were cultured at 5 x 10(5) cells/10 cm petri dish for 24 h prior to addition of fatty acids (50 microm) which were delivered to the cells complexed with 2% bovine serum albumin (fatty acid-free) and incubated for a further 24 h. parallel dishes were processed for lipid extraction and gc analysis. this analysis showed highly significant (p < 0.01) uptake by the cells of each fatty acid. genotoxins (75 microm hydrogen peroxide, 20 microm t-butylhydroperoxide and 2.4 microm mitomycin ... | 1999 | 10375002 |
complete homology maps of the rabbit (oryctolagus cuniculus) and human by reciprocal chromosome painting. | fluorescence in situ hybridization (fish) was used to construct a homology map to analyse the extent of evolutionary conservation of chromosome segments between human and rabbit (oryctolagus cuniculus, 2n = 44). chromosome-specific probes were established by bivariate fluorescence activated flow sorting followed by degenerate oligonucleotide-primed pcr (dop-pcr). painting of rabbit probes to human chromosomes and vice versa allowed a detailed analysis of the homology between these species. all r ... | 1999 | 10575232 |
[the study of quantitative karyotypic variability by induction of chromosomal instability in cultured cells of the indian muntjac skin fibroblasts]. | the influence of mycoplasmal contamination and somatic cell hybridization on the character of karyotypic variability in cell cultures of indian muntjac skin fibroblasts has been investigated. mycoplasma arginini and acholeplasma laidlawii, used as factors inducing chromosomal instability, do not break the main regulations peculiar to intact control. they regulations are: 1) nonrandom character of cell distribution according to the number of chromosomal deviations from msvk; 2) specific character ... | 1999 | 10591121 |
[characteristics of quantitative karyotypic variability in cell line of kidney from rat kangaroo (potorous tridactylis)]. | the numerical regulations of karyotypic variability in cell line of rat kangaroo kidney, nbl-3-11, has been investigated. these regulations are similar with ones found for cell lines of the indian muntjac skin fibroblasts (m, mt, m2). in particular the balanced karyotypic structure of cell population in vitro is determined by correlations of the structural variants of the karyotype (svk). these correlations depend on the following regulations 1) nonrandom character of cell distribution according ... | 1999 | 10591122 |
cenp-a associated complex satellite dna in the kinetochore of the indian muntjac. | the centromere/kinetochore complex is a chromosomal assembly that mediates chromosome motility and mitotic regulation by interacting with microtubules of the mitotic spindle apparatus. centromere protein a (cenp-a) is a histone h3 homolog that is concentrated in the chromatin of the inner kinetochore plate of human chromosomes. to identify dna sequences associated with the inner kinetochore plate, we used anticentromere autoantibodies to immunoprecipitate cenp-a associated chromatin selectively ... | 1999 | 10591996 |
5-azacytidine- and hoechst-induced aneuploidy in indian muntjac. | hoechst 33258 (bis-benzimidazole) and 5-azacytidine (5-ac) cause decondensation of the pericentric heterochromatin in mouse and aberrations in the sequence of centromere separation apparently by different mechanisms. we treated the male indian muntjac cells (2n=7), which do not undergo decondensation of the pericentric heterochromatin, to study if these chemicals would result in induction of aneuploidy limited to the y(2) chromosome. this paper reports that both agents result in aneuploidy prima ... | 2000 | 10751729 |
[cloning, sequencing and chromosome location of sry gene of muntjak munticus vaginalis by dop-pcr and microdissection]. | we isolated 1, y1, y2 chromosomes of the male m.m vaginalis by microdissection and amplified the dna copies by dop-pcr. using the dop-pcr products of 1, y1, y2 chromosomes of m.m vaginalis as template respectively and the primers designed within human sry hmg box, the sry gene of the male m.m vaginalis was amplified, and it was cloned and sequenced. it is proved that y2 is the real sex chromosome in the male m.m vaginalis at molecular level for the first time, and sry was localized on y2 chromos ... | 2001 | 11329874 |
histone h3 phosphorylation of mammalian chromosomes. | inferences about the role and location of phosphorylated histone h3 are derived primarily from biochemical studies. a few direct observations at chromosome level have shown that phosphorylation begins at the site of heterochromatin and spreads throughout the chromosome. however, a comparative study of chromosomes of mouse (l929 cells), chinese hamster (cho 9 cells) and the indian muntjac (male cells) reveals some distinguishable details among mammalian species. whereas the l929 cells exhibit the ... | 2001 | 11592483 |
molecular behavior in living mitotic cells of human centromere heterochromatin protein hplalpha ectopically expressed as a fusion to red fluorescent protein. | we constructed stable mammalian cell lines in which human heterochromatin protein hp1alpha and kinetochore protein cenp-a were differentially expressed as fusions to red (rfp-hp1) and green fluorescent proteins (gfp-cenp-a). heterochromatin localization of rfp-hp1 was clearly shown in mouse and indian muntjac cells. by preparing mitotic chromosome spreads, the inner centromere localization of rfp-hp1 was observed in human and indian muntjac cells. to characterize its molecular behavior in living ... | 2001 | 11942629 |
isolation and identification of a novel satellite dna family highly conserved in several cervidae species. | in an attempt to amplify cervid satellite ii dna from the genomes of indian muntjac and chinese muntjac, a pair of primers derived from the white tailed deer satellite ii dna clone (ovdii) yielded a prominent approximately 1 kb polymerase chain reaction (pcr) product (in addition to the expected 0.7 kb satellite ii dna fragments) in both species. the approximately 1 kb products were cloned, sequenced, and analyzed by southern blotting and fluorescence in situ hybridization (fish). this revealed ... | 2002 | 12355207 |
human telomerase can immortalize indian muntjac cells. | the mechanisms of replicative senescence by telomere shortening are not fully understood. the indian muntjac has the fewest chromosomes of all mammals, greatly simplifying the analysis of each telomere over time. in this study, telomere shortening was observed throughout the life span of cultured normal muntjac cells by quantitative fluorescence in situ hybridization and terminal restriction fragment analysis. ectopic expression of the human telomerase catalytic subunit in these cells reconstitu ... | 2002 | 12441130 |
[effect of laminin on structural karyotype variability of kangaroo rat kidney cell lines]. | the structural karyotypic variability has been investigated in the "markerless" epithelial-like rat kangaroo kidney cell lines nbl-3-17 and nbl-3-11 on cultivation on a laminin-2/4 coated surface. in cell line nbl-3-17, cultivated on the laminin-coated surface for 2, 4 and 12 days, and in cell line nbl-3-11, cultivated on the laminin-coated surface for 2 and 4 days, there is a significant increase in the frequency of chromosomal aberrations, both chromosomal breaks and dicentrics (telomeric asso ... | 2003 | 14989178 |
cytogenetic dose-response and adaptive response in cells of ungulate species exposed to ionizing radiation. | in the studies reported here, the micronucleus assay, a common cytogenetic technique, was used to examine the dose-responses in fibroblasts from three ungulate species (white-tailed deer, woodland caribou, and indian muntjac) exposed to high doses of ionizing radiation (1-4 gy of (60)co gamma radiation). this assay was also used to examine the effects of exposure to low doses (1-100 mgy) typical of what these species experience in a year from natural and anthropogenic environmental sources. an a ... | 2004 | 15063537 |
topoisomerase ii and histone deacetylase inhibitors delay the g2/m transition by triggering the p38 mapk checkpoint pathway. | when early prophase ptk(1) or indian muntjac cells are exposed to topoisomerase ii (topo ii) inhibitors that induce little if any dna damage, they are delayed from entering mitosis. we show that this delay is overridden by inhibiting the p38, but not the atm, kinase. treating early prophase cells with hyperosmotic medium or a histone deacetylase inhibitor similarly delays entry into mitosis, and this delay can also be prevented by inhibiting p38. together, these results reveal that agents or str ... | 2004 | 15302851 |
asynchronous replication timing of telomeres at opposite arms of mammalian chromosomes. | telomeres are defining structural elements of all linear chromosomes, yet information concerning the timing of their replication in higher eukaryotes is surprisingly limited. we developed an approach that allowed a study of telomere replication patterns of specific mammalian chromosomes. in the indian muntjac (muntiacus muntjac), replication timing between respective telomeres of homologous chromosomes was highly coordinated, but no such synchrony was evident for p- and q-arm telomeres of the sa ... | 2004 | 15322275 |
characterization of nuclear compartments identified by ectopic markers in mammalian cells with distinctly different karyotype. | the functional organization of chromatin in cell nuclei is a fundamental question in modern cell biology. individual chromosomes occupy distinct chromosome territories in interphase nuclei. nuclear bodies localize outside the territories and colocalize with ectopically expressed proteins in a nuclear subcompartment, the interchromosomal domain compartment. in order to investigate the structure of this compartment in mammalian cells with distinctly different karyotypes, we analyzed human hela cel ... | 2005 | 15776261 |
characterization of the telomere complex, terf1 and terf2 genes in muntjac species with fusion karyotypes. | the telomere binding proteins trf1 and trf2 maintain and protect chromosome ends and confer karyotypic stability. chromosome evolution in the genus muntiacus is characterized by numerous tandem (end-to-end) fusions. to study trf1 and trf2 telomere binding proteins in muntiacus species, we isolated and characterized the terf1 and -2 genes from indian muntjac (muntiacus muntjak vaginalis; 2n = 6 female) and from chinese muntjac (muntiacus reveesi; 2n = 46). expression analysis revealed that both g ... | 2005 | 15878333 |
induction of centrosome and chromosome aberrations by imatinib in vitro. | imatinib (sti571, gleevec/glivec) is a potent selective tyrosine kinase inhibitor and is used successfully in the treatment of chronic myeloid leukemia (cml). while karyotype alterations, in addition to the philadelphia chromosome, are a common phenomenon of progressing cml, the observation of bcr-abl-negative leukemic clones with distinct aberrant karyotypes under an imatinib regimen is not yet understood. here we test the hypothesis that such tumor clones may be induced de novo from normal cel ... | 2005 | 15990860 |
the epidemiology of animal trichinellosis in china. | the epidemiology of animal trichinellosis in china based mainly upon original chinese literature published between 1937 and 2004 is reviewed. the seroprevalence of trichinella infection in herbivores was 0.7% (2/300) in cattle and 0.8% (4/500) in sheep. the prevalence of trichinellosis in naturally infected cattle was 1.2% (2/163). trichinella larvae were detected in 1.4% (3/215) of sheep and in 2.1% (1/47) of beef cattle sold at markets. canine trichinellosis was recorded in 13 provinces, auton ... | 2007 | 16162414 |
increased missegregation and chromosome loss with decreasing chromosome size in vertebrate cells. | chromosome engineering has allowed the generation of an extensive and well-defined series of linear human x centromere-based minichromosomes, which has been used to investigate the influence of size and structure on chromosome segregation in vertebrate cells. a clear relationship between overall chromosome size and mitotic stability was detected, with decreasing size associated with increasing loss rates. in chicken dt40, the lower size limit for prolonged mitotic stability is approximately 550 ... | 2006 | 16267674 |
common pathway of chromosome condensation in mammalian cells. | chromatin folding in the interphase nucleus is not known. we compared the pattern of chromatin condensation in indian muntjac, chinese hamster ovary, murine pre b, and k562 human erythroleukemia cells during the cell cycle. fluorescent microscopy showed that chromosome condensation follows a general pathway. synchronized cells were reversibly permeabilized and used to isolate interphase chromatin structures. based on their structures two major categories of intermediates were distinguished: (1) ... | 2006 | 16716119 |
comparative genomic analysis links karyotypic evolution with genomic evolution in the indian muntjac (muntiacus muntjak vaginalis). | the karyotype of indian muntjacs (muntiacus muntjak vaginalis) has been greatly shaped by chromosomal fusion, which leads to its lowest diploid number among the extant known mammals. we present, here, comparative results based on draft sequences of 37 bacterial artificial clones (bac) clones selected by chromosome painting for this special muntjac species. sequence comparison on these bac clones uncovered sequence syntenic relationships between the muntjac genome and those of other mammals. we f ... | 2006 | 16791631 |
haematology and serum biochemistry of chital (axis axis) and barking deer (muntiacus muntjak) reared in semi-captivity. | haematological and serum biochemical values of clinical significance that could serve as reference data for deer kept in captivity were measured for chital (axis axis) and barking deer (muntiacus muntjak). the venous blood from four each of chital and barking deer (n = 8) reared in semi-captivity was collected after proper restraint of the animals. the mean blood haemoglobin, packed cell volume, total erythrocyte count and total leukocyte count of all the eight deer of the two species were 15.90 ... | 2007 | 17294264 |
serum gamma-glutamyltransferase as a prognostic indicator of neonatal viability in nondomestic ruminants. | rapid assessment of immune status in neonatal ruminants of endangered species facilitates early intervention in cases of inadequate passive transfer of maternal immunoglobulins. serum gamma-glutamyltransferase (ggt) was used to evaluate suspected passive transfer status in 25 north indian muntjac (muntiacus muntjak vaginalis), 45 cretan goats (capra algagrus cretica), 20 white-lipped deer (cervus albirostris), 25 mhorr gazelles (gazella dama mhorr), and 31 soemmerring's gazelles (gazella soemmer ... | 2005 | 17323564 |
molecular identification and localization of cellular titin, a novel titin isoform in the fibroblast stress fiber. | we previously discovered a large titin-like protein-c-titin-in chicken epithelial brush border and human blood platelet extracts that binds alpha-actinin and organizes arrays of myosin ii bipolar filaments in vitro. rt-pcr analysis of total rna from human megakaryoblastic (chrf-288-11) and mouse fibroblast (3t3) nonmuscle cells reveal sequences identical to known titin gene exon sequences that encode parts of the z-line, i-band, pevk domain, a-band, and m-line regions of striated muscle titins. ... | 2007 | 17366640 |