| comparative gene mapping in the species muntiacus muntjac. | an extreme case of chromosomal evolution is presented by the two muntjac species muntiacus muntjac (indian muntjac, 2n = 6 [females], 7 [males]) and m. reevesi (chinese muntjac, 2n = 46). despite disparate karyotypes, these phenotypically similar species produce viable hybrid offspring, indicating a high degree of dna-level conservation and genetic relatedness. as a first step toward development of a comparative gene map, several indian muntjac homologs of known human type i anchor loci were map ... | 1992 | 1486805 |
| identification of novel single-stranded d(tc)n binding proteins in several mammalian species. | a group of single-stranded d(tc)n specific binding proteins has been detected in the nuclear extracts of several mammalian species that included mouse, human, african green monkey, chimpanzee, and chinese muntjac. southwestern analysis of 500 mm kci nuclear extracts has shown that these proteins cluster in a similar size range, 55.5 to 57 kd. an additional 54 kd band was present for the three primate species examined. the single-stranded d(tc)n binding activity was confirmed with bandshift assay ... | 1991 | 2017376 |
| chromosomal evolution in cervidae. | on the basis of chromosome data obtained on 30 species and 20 subspecies of cervidae, a report is submitted on the karyosystematics of this family. the primitive karyotype of cervidae may be inferred to be composed of 35 acrocentric pairs (2n = 70 fn = 70). during the phyletic evolution of this family different types of chromosome rearrangements were probably selected and the group may have differentiated karyologically into three branches: (1) the cervinae that fixed a centric fusion resulting ... | 1990 | 2249009 |
| localization of cloned, repetitive dna sequences in deer species and its implications for maintenance of gene territory. | the deer family shows the largest variation in chromosome number known in mammals (2n = 6 to 2n = 70). the drastic rearrangement of the chromosomes allows to test the prediction, based on the chromosome field theory, according to which dna sequences tend to occupy specific territories within the eukaryotic chromosome. nuclear dnas were isolated from eight deer and two bovidae species. these dnas were cleaved with the restriction enzymes eco ri and alu i. following eco ri digestion highly repetit ... | 1990 | 2361878 |
| localization of the repetitive telomeric sequence (ttaggg)n in two muntjac species and implications for their karyotypic evolution. | it has been suggested that the chromosome set of the indian muntjac, muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the chinese muntjac, m. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. the location of the highly conserved human telomeric sequence (ttaggg)n in the metaphase chromosomes of m.m. vaginalis and its close relative, m. reevesi, was investigated by non-radioact ... | 1990 | 2369836 |
| localization and characterization of recombinant dna clones derived from the highly repetitive dna sequences in the indian muntjac cells: their presence in the chinese muntjac. | a total of seven, highly repeated, dna recombinant m13 mp8 clones derived from a hpa ii digest of cultured cells of the indian muntjac (muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and dna sequencing. two of the clones, b1 and b8, contain satellite dna inserts which are 80% homologous in their dna sequences. b1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. this consensus sequence, tccctgacgcaactcgagaggaatcctg ... | 1986 | 3015505 |
| compound kinetochores of the indian muntjac. evolution by linear fusion of unit kinetochores. | the chromosomes of the indian muntjac (muntiacus muntjak vaginalis) are unique among mammals due to their low diploid number (2n = 6 female, 7 male) and large size. it has been proposed that the karyotype of this small asiatic deer evolved from a related deer the chinese muntjac (muntiacus reevesi) with a diploid chromosome number of 2n = 46 consisting of small telocentric chromosomes. in this study we utilized a kinetochore-specific antiserum derived from human patients with the autoimmune dise ... | 1984 | 6525895 |
| a tandemly repetitive, centromeric dna sequence from the canadian woodland caribou (rangifer tarandus caribou): its conservation and evolution in several deer species. | a highly repetitive dna clone, designated rt-pst3, was isolated from the psti digest of canadian woodland caribou (rangifer tarandus caribou; 2n = 70) genomic dna. it was found to be a 991 bp monomer of a tandemly repeated dna sequence comprising about 5.7% of the genome and localized to the centromeric regions of all caribou acrocentric autosomes. southern blot analyses revealed that this caribou satellite dna sequence was well conserved in the genomes of five other deer species studied. in sit ... | 1994 | 7921645 |
| comparative chromosome painting discloses homologous segments in distantly related mammals. | comparative chromosome painting, termed zoo-fish, using dna libraries from flow sorted human chromosomes 1, 16, 17 and x, and mouse chromosome 11 discloses the presence of syntenic groups in distantly related mammalian orders ranging from primates (homo sapiens), rodents (mus musculus), even-toed ungulates (muntiacus muntjak vaginalis and muntiacus reevesi) and whales (balaenoptera physalus). these mammalian orders have evolved separately for 55-80 million years (myr). we conclude that zoo-fish ... | 1994 | 8054973 |
| interstitial localization of telomeric dna sequences in the indian muntjac chromosomes: further evidence for tandem chromosome fusions in the karyotypic evolution of the asian muntjacs. | the indian muntjac is believed to have the lowest chromosome number in mammals (2n = 6 in females and 2n = 7 in males). it has been suggested that a series of tandem chromosome fusions from an ancestral chinese muntjac-like species (2n = 46) may have occurred during the karyotypic evolution of the indian muntjac. in an earlier study, hybridization signals generated by the chinese muntjac centromeric heterochromatin dna probe (c5) were found to be distributed interstitially in the chromosomes of ... | 1993 | 8485991 |
| centromeric locations in karyotypes: a rule derived from the theory of branched polymers. | it is believed that chromosomes occupy non-overlapping domains in the interphase nucleus, and that the nuclear volume can be divided into the interchromosomal space and the chromosome domains. concentrations of various components (e.g., small ions) are different in these compartments. since nuclear volume is twice as large in g2 as in g1 phase, v2/v1 (the g2/g1 ratio of total chromosomal volumes) must be two in order to keep the interchromosomal concentrations unchanged. the aim of this study is ... | 1996 | 8869128 |
| repetitive sequence families in alces alces americana. | high-resolution derivative melting was used to obtain detailed distributions of local (g + c) contents in a number of ruminant dnas. profiles over low (g + c) regions [20-36% (g + c)] are congruent for all ruminants. this region represents 45-50% of the nuclear dna content and primarily contains intergenic and intron sequences. the high (g + c) region, where most coding sequences are found [38-68% (g + c)], is marked by satellite bands denoting the presence of transcriptionally inert, tandemly r ... | 1997 | 9115175 |
| zoo-fluorescence in situ hybridization analysis of human and indian muntjac karyotypes (muntiacus muntjak vaginalis) reveals satellite dna clusters at the margins of conserved syntenic segments. | zoo-fluorescence in situ hybridization (fish) with human whole chromosome-specific paint probes revealed extensive homoeologies between indian muntjac (2n=6, 7 female, male) and human karyotypes (2n=46). forty-two conserved syntenic segments, corresponding to all human chromosomes except the y chromosome, produced a near-complete coverage of the muntjac complement and revealed margins of interspecific segmental homoeology. to test the hypothesis that interstitial satellite dna loci, illuminated ... | 1997 | 9244453 |
| segmental homology among cattle (bos taurus), indian muntjac (muntiacus muntjak vaginalis), and chinese muntjac (m. reevesi) karyotypes. | in an attempt to examine homologies between indian and chinese muntjac karyotypes at a subchromosomal level, five bovine cosmids were comparatively mapped by heterologous fluorescence in situ hybridization (fish). in the indian muntjac (2n = 6) all cosmids mapped to chromosome 1, whereas in the chinese muntjac (2n = 46) two cosmids mapped to chromosome 3 and one cosmid each mapped to chromosomes 1, 7, and 17. these markers have maintained their intrachromosomal position relative to a centromere/ ... | 1997 | 9284921 |
| new phylogenetic perspectives on the cervidae (artiodactyla) are provided by the mitochondrial cytochrome b gene. | the entire mitochondrial cytochrome b (cyt b) gene was compared for 11 species of the artiodactyl family cervidae, representing all living subfamilies, i.e., the antlered cervinae (cervus elaphus, c. nippon, dama dama), muntiacinae (muntiacus reevesi), and odocoileinae (odocoileus hemionus, mazama sp., capreolus capreolus, c. pygargus, rangifer tarandus, alces alces); and the antlerless hydropotinae (hydropotes inermis). phylogenetic analyses using tragulidae, antilocapridae, giraffidae and bovi ... | 1998 | 9628037 |
| cenp-g: a new centromeric protein that is associated with the alpha-1 satellite dna subfamily. | a new constitutive centromere-specific protein (cenp) has been identified as a result of its recognition as an autoantigen by serum from a patient with gastric antral vascular ectasia disease. conventional immunoblotting and two-dimensional double blotting with both this antiserum and a known anti-centromere antiserum showed that this antiserum predominantly recognized a mr 95,000 protein that is different from all known cenps. we have named this new protein cenp-g. this protein was detected at ... | 1998 | 9639657 |
| sheep-associated malignant catarrhal fever in a petting zoo. | in a privately owned petting zoo in arizona, 17 deer from five different species, white-tailed deer (odocoileus virginianus), reeve's muntjac (muntiacus reevesi), mule deer (odocoileus hemionus), reindeer (rangifer tarandus), and axis deer (axis axis), died of suspected malignant catarrhal fever (mcf) over a period from late 1992 to early 1995. a pcr assay specific for ovine herpesvirus 2, the putative causative agent of sheep-associated mcf, and a competitive-inhibition enzyme-linked immunosorb ... | 1999 | 10572865 |
| isolation and identification of a novel satellite dna family highly conserved in several cervidae species. | in an attempt to amplify cervid satellite ii dna from the genomes of indian muntjac and chinese muntjac, a pair of primers derived from the white tailed deer satellite ii dna clone (ovdii) yielded a prominent approximately 1 kb polymerase chain reaction (pcr) product (in addition to the expected 0.7 kb satellite ii dna fragments) in both species. the approximately 1 kb products were cloned, sequenced, and analyzed by southern blotting and fluorescence in situ hybridization (fish). this revealed ... | 2002 | 12355207 |
| ehrlichiae and ehrlichial diseases in china. | the various ticks collected from different areas of china were examined for the existence of ehrlichial agents by polymerase chain reaction (pcr) with genus- or species-specific primers designed on the basis of ehrlichial 16s rrna genes and sequence analyses. in southern china, e. chaffeensis was detected in amblyomma testudinarium ticks from infested cattle, haemaphysalis yeni ticks from hare, and ixodes ovatus ticks from muntiacus reevesi. e. canis was identified in rhipicephalus sanguineus ti ... | 2003 | 12860598 |
| new insights into the karyotypic relationships of chinese muntjac (muntiacus reevesi), forest musk deer (moschus berezovskii) and gayal (bos frontalis). | to investigate the karyotypic relationships between chinese muntjac (muntiacus reevesi), forest musk deer (moschus berezovskii) and gayal (bos frontalis), a complete set of chinese muntjac chromosome-specific painting probes has been assigned to g-banded chromosomes of these three species. sixteen autosomal probes (i.e. 6-10, 12-22) of the chinese muntjac each delineated one pair of conserved segments in the forest musk deer and gayal, respectively. the remaining six autosomal probes (1-5, and 1 ... | 2005 | 15627750 |
| [cloning and sequencing of sry gene of muntiacus]. | using the primers from sry gene--hmg box for pcr amplification in genomic dna of muntiacus reevesi cell strains, a 220bp fragment was obtained in the male but not in the female. the 220bp fragment was cloned into the pgem-t vector using t/a clone method. the identified positive clone was sequenced. the result shows that 82.6% nucleotides(152bp/184bp) are homologous between muntiacus sry and human sry gene. it suggests that sry is highly conserved during evolution. | 2003 | 15639874 |
| characterization of nuclear compartments identified by ectopic markers in mammalian cells with distinctly different karyotype. | the functional organization of chromatin in cell nuclei is a fundamental question in modern cell biology. individual chromosomes occupy distinct chromosome territories in interphase nuclei. nuclear bodies localize outside the territories and colocalize with ectopically expressed proteins in a nuclear subcompartment, the interchromosomal domain compartment. in order to investigate the structure of this compartment in mammalian cells with distinctly different karyotypes, we analyzed human hela cel ... | 2005 | 15776261 |
| characterization of the telomere complex, terf1 and terf2 genes in muntjac species with fusion karyotypes. | the telomere binding proteins trf1 and trf2 maintain and protect chromosome ends and confer karyotypic stability. chromosome evolution in the genus muntiacus is characterized by numerous tandem (end-to-end) fusions. to study trf1 and trf2 telomere binding proteins in muntiacus species, we isolated and characterized the terf1 and -2 genes from indian muntjac (muntiacus muntjak vaginalis; 2n = 6 female) and from chinese muntjac (muntiacus reveesi; 2n = 46). expression analysis revealed that both g ... | 2005 | 15878333 |
| [surveillance on severe acute respiratory syndrome associated coronavirus in animals at a live animal market of guangzhou in 2004]. | to study the prevalence of severe acute respiratory syndrome coronavirus (sars-cov) like virus in animals at a live animal market of guanzhou in 2004 before and after culling of wild animal action taken by the local authority, in order to predict the re-emerging of sars from animal originals in this region. | 2005 | 15921605 |
| phylogenomic study of the subfamily caprinae by cross-species chromosome painting with chinese muntjac paints. | chromosomal homologies have been established between the chinese muntjac (muntiacus reevesi, mre, 2n = 46) and five ovine species: wild goat (capra aegagrus, cae, 2n = 60), argali (ovis ammon, oam, 2n = 56), snow sheep (ovis nivicola, oni, 2n = 52), red goral (naemorhedus cranbrooki, ncr, 2n = 56) and sumatra serow (capricornis sumatraensis, csu, 2n = 48) by chromosome painting with a set of chromosome-specific probes of the chinese muntjac. in total, twenty-two chinese muntjac autosomal paintin ... | 2005 | 15973503 |
| phylogenomics of several deer species revealed by comparative chromosome painting with chinese muntjac paints. | a set of chinese muntjac (muntiacus reevesi) chromosome-specific paints has been hybridized onto the metaphases of sika deer (cervus nippon, cni, 2n = 66), red deer (cervus elaphus, cel, 2n = 62) and tufted deer (elaphodus cephalophus, ece, 2n = 47). thirty-three homologous autosomal segments were detected in genomes of sika deer and red deer, while 31 autosomal homologous segments were delineated in genome of tufted deer. the chinese muntjac chromosome x probe painted to the whole x chromosome, ... | 2006 | 16850210 |
| comparative morphological study on the lingual papillae and their connective tissue cores (ctc) in reeves' muntjac deer (muntiacus reevesi). | the lingual papillae and their connective tissue cores (ctc) from reeves' muntjac deers (herbivorous artiodactyla) were studied using light and scanning electron microscopy and then compared to those of other mammalian species. at the posterior portion of the tongue, the reeves' muntjac has a lingual prominence on which large conical papillae are distributed. on the dorsal surface of the anterior tongue, numerous filiform papillae were found. externally, each filiform papilla consists of a rod-s ... | 2006 | 17140149 |
| the dispersal of vascular plants in a forest mosaic by a guild of mammalian herbivores. | endozochorous seed dispersal by herbivores can affect plant spatial dynamics and macroecological patterns. we have investigated the number and species composition of viable seeds deposited in faeces of a full guild of macroherbivores (four deer and two lagomorph species) in a forest in eastern britain. one hundred and one plant species germinated from faecal pellet material, 85 of which were among the 247 vascular plant species recorded in the forest. however, three species - chenopodium album, ... | 2007 | 17661087 |
| one gland, two lobes: organogenesis of the "harderian" and "nictitans" glands of the chinese muntjac (muntiacus reevesi) and fallow deer (dama dama). | the nictitans and harderian glands are enigmatic glands situated in the anterior aspect of the orbit. traditionally, the nictitans and harderian glands of mammals have been considered to be two fundamentally distinct glands. however, a consistent, unambiguous distinction between these two glands has remained elusive due to conflicting anatomical and histochemical definitions. the harderian gland was originally described, and first distinguished from the nictitans gland, in adult deer. we examine ... | 2007 | 17910397 |
| comparative gene mapping in cattle, indian muntjac, and chinese muntjac by fluorescence in situ hybridization. | the indian muntjac (muntiacus muntjak vaginalis) has a karyotype of 2n = 6 in the female and 2n = 7 in the male. the karyotypic evolution of indian muntjac via extensive tandem fusions and several centric fusions are well documented by molecular cytogenetic studies mainly utilizing chromosome paints. to achieve higher resolution mapping, a set of 42 different genomic clones coding for 37 genes and the nucleolar organizer region were used to examine homologies between the cattle (2n = 60), human ... | 2008 | 18283540 |
| karyotype evolution of giraffes (giraffa camelopardalis) revealed by cross-species chromosome painting with chinese muntjac (muntiacus reevesi) and human (homo sapiens) paints. | considering the giraffe (giraffa camelopardalis, gca, 2n = 30) as a primitive species, its comparative genomic data are critical for our understanding of the karyotype evolution of pecorans. here, we have established genome-wide chromosomal homologies between giraffe, chinese muntjac (muntiacus reevesi, mre, 2n = 46) and human (homo sapiens, hsa, 2n = 46) with whole sets of chromosome-specific paints from chinese muntjac and human, in addition to providing a high-resolution g-banding karyotype o ... | 2008 | 19096208 |
| diagnosis and treatment of babesia odocoilei in captive reindeer (rangifer tarandus tarandus) and recognition of three novel host species. | two captive reindeer (rangifer tarandus tarandus) at a new york zoological institution were diagnosed with babesia odocoilei. clinical signs consistent with acute babesiosis included fever, hemoglobinuria, and hemolytic anemia. both episodes were precipitated by stressful events that may have compromised their immunocompetence. the diagnosis was confirmed by visualization of intraerythrocytic parasites on stained blood smears, polymerase chain reaction, and speciation of the babesia by sequencin ... | 2009 | 19368255 |
| estimating the risk of cattle exposure to tuberculosis posed by wild deer relative to badgers in england and wales. | wild deer populations in great britain are expanding in range and probably in numbers, and relatively high prevalence of bovine tuberculosis (btb, caused by infection with mycobacterium bovis) in deer occurs locally in parts of southwest england. to evaluate the m. bovis exposure risk posed to cattle by wild deer relative to badgers in england and wales, we constructed and parameterized a quantitative risk model with the use of information from the literature (on deer densities, activity pattern ... | 2009 | 19901384 |
| synapsis and meiotic recombination in male chinese muntjac (muntiacus reevesi). | the muntjacs (muntiacus, cervidae) have been extensively studied in terms of chromosomal and karyotypic evolution. however, little is known about their meiotic chromosomes particularly the recombination patterns of homologous chromosomes. we used immunostained surface spreads to visualise synaptonemal complexes (scs), recombination foci and kinetochores with antibodies against marker proteins. as in other mammals pachytene was the longest stage of meiotic prophase. 39.4% of xy bivalents lacked m ... | 2011 | 21559438 |
| distribution of wild mammal assemblages along an urban-rural-forest landscape gradient in warm-temperate east asia. | urbanization may alter mammal assemblages via habitat loss, food subsidies, and other factors related to human activities. the general distribution patterns of wild mammal assemblages along urban-rural-forest landscape gradients have not been studied, although many studies have focused on a single species or taxon, such as rodents. we quantitatively evaluated the effects of the urban-rural-forest gradient and spatial scale on the distributions of large and mid-sized mammals in the world's larges ... | 2013 | 23741495 |
| molecular evidence for anaplasma bovis infection in wild reeves' muntjac (muntiacus reevesi), southwest china. | anaplasma bovis is one of the most important tick-borne pathogens in china. in the first report of a. bovis in china, we describe infection in eight of 17 wild reeves' muntjac (muntiacus reevesi) from guangxi, southwest china. | 2014 | 25098301 |
| molecular detection of anaplasma phagocytophilum in wild cervids and hares in china. | anaplasma phagocytophilum is an emerging tick-borne pathogen of global veterinary and public health significance. wild ungulates are suggested to serve as reservoirs for this agent in both the us and europe. we investigated the occurrence of a. phagocytophilum in sika deer ( cervus nippon ), reeves' muntjac ( muntiacus reevesi ), tufted deer ( elaphodus cephalophus ), and chinese hare ( lepus sinensis ) in china. we detected a. phagocytophilum in nine (53%) free-ranging wild reeves' muntjac. no ... | 2017 | 28151084 |
| aspects of the husbandry and management of captive cervids. | in a continuing effort to better understand the transmission and persistence of chronic wasting disease in wild populations of cervids, colorado state university, fort collins houses two species of deer indoors to study the pathogenesis of chronic wasting disease. here we report key aspects regarding the husbandry and medication of reeves' muntjac and white-tailed deer in captivity for research purposes. | 2016 | 27003353 |
| mother to offspring transmission of chronic wasting disease in reeves' muntjac deer. | the horizontal transmission of prion diseases has been well characterized in bovine spongiform encephalopathy (bse), chronic wasting disease (cwd) of deer and elk and scrapie of sheep, and has been regarded as the primary mode of transmission. few studies have monitored the possibility of vertical transmission occurring within an infected mother during pregnancy. to study the potential for and pathway of vertical transmission of cwd in the native cervid species, we used a small cervid model-the ... | 2013 | 23977159 |
| genetic variation of gongylonema pulchrum from wild animals and cattle in japan based on ribosomal rna and mitochondrial cytochrome c oxidase subunit i genes. | the gullet worm (gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. to investigate this notion, the ribosomal rna gene (rdna), mainly regions of the internal transcribed spacers (its) 1 and 2, and a cytochrome c oxidase subunit i (coi) region of mitochondrial dna of g. pulchrum were characterized using parasites from t ... | 2013 | 22967753 |
| molecular evidence for piroplasms in wild reeves' muntjac (muntiacus reevesi) in china. | dna from liver samples of 17 free-ranging wild reeves' muntjac (muntiacus reevesi) was used for pcr amplification of piropalsm 18s rrna gene. of 17 samples, 14 (82.4%) showed a specific pcr product which were cloned and sequenced. blast analysis of the sequences obtained showed similarities to babesia sp., theileria capreoli, theileria uilenbergi and theileria sp. bo302-se. phylogenetic analysis showed that the babesia sp. detected in the present study was distantly separated from known babesia ... | 2014 | 24970769 |
| the arteries of brain base in species of the cervid family. | the aim of the article was to describe the pattern of main arteries at the encephalon base, their connections, and varieties. this study included 106 specimens of the head and cerebral arteries of the following eight species of the cervid family: reindeer, chital, eld's deer, wapiti, sika deer, fallow deer, pere david's deer or milu, and reeve's or chinese muntjac. the arteries of the animals under study were filled with acetone-dissolved stained vinyl superchloride or stained latex lbs3060. the ... | 2015 | 25399744 |
| evidence of higher levels of testosterone during the velvet period in muntjac than in other cervids. | previous studies have shown that despite having a clear seasonal fluctuation in fecal testosterone concentration, the significantly lower testosterone levels found in velvet stags of the nonseasonal breeder muntjac (muntiacus sp.) apparently did not stop their spermatogenesis as in other deer species. in the present study, in vitro cultivated leydig cells isolated from adult stags of three native deer species of taiwan were treated with androstenedione, with or without adding human chorionic gon ... | 2014 | 24220360 |
| chromosome homologies between tsessebe (damaliscus lunatus) and chinese muntjac (muntiacus reevesi) facilitate tracing the evolutionary history of damaliscus (bovidae, antilopinae, alcelaphini). | genome-wide homologies between the tsessebe (damaliscus lunatus, 2n = 36) and chinese muntjac (muntiacus reevesi, 2n = 46) have been established by cross-species painting with chinese muntjac chromosome paints. twenty-two autosomal painting probes detected 35 orthologous segments in the tsessebe. hybridization results confirmed that: (i) d. lunatus carries the (9;14) reciprocal translocation that has been proposed to be a derived chromosomal landmark shared by all species of the antilopinae; (ii ... | 2011 | 21178333 |
| detection of a novel gammaherpesvirus (genus rhadinovirus) in wild muntjac deer in northern ireland. | this study represents the initial part of an investigation into the potential for non-native, wild, free-living muntjac deer (muntiacus reevesi) to carry viruses that could be a threat to livestock. a degenerate pcr assay was used to screen a range of tissues from muntjac deer culled in northern ireland for the presence of herpesviral nucleic acids. this was followed by sequencing of pcr amplicons and phylogenetic analysis. we report the detection of a novel gammaherpesvirus most closely related ... | 2017 | 28204896 |
| infectious prions in the pregnancy microenvironment of chronic wasting disease-infected reeves' muntjac deer. | ample evidence exists for the presence of infectious agents at the maternal-fetal interface, often with grave outcomes to the developing fetus (i.e., zika virus, brucella, cytomegalovirus, and toxoplasma). while less studied, pregnancy-related transmissible spongiform encephalopathies (tses) have been implicated in several species, including humans. our previous work has shown that prions can be transferred from mother to offspring, resulting in the development of clinical tse disease in offspri ... | 2017 | 28539446 |
| gongylonema infection of wild mammals in japan and sardinia (italy). | the gullet worms, classical gongylonema pulchrum and newly differentiated gongylonema nepalensis, are prevalent in various mammals in japan and sardinia, italy, respectively. the former species is cosmopolitan in distribution, dwelling in the mucosa of the upper digestive tract of a variety of domestic and wild mammals, and also humans. at present, the geographical distribution of g. nepalensis is known in nepal and sardinia, with the nematode having been recorded from the oesophagus of water bu ... | 2018 | 30457072 |
| associations between japanese spotted fever (jsf) cases and wildlife distribution on the boso peninsula, central japan (2006-2017). | populations of large mammals have been dramatically increasing in japan, resulting in damage to agriculture, forestry, and ecosystems. however, their effects on tick-borne diseases have been poorly studied. here, we focused on the relationship between japanese spotted fever (jsf), a tick-borne disease caused by rickettsia japonica, and populations of large mammals. to explore factors that affected the area in which jsf cases occur, we used generalized linear mixed models (glmms). we demonstrated ... | 2020 | 33012734 |
| the scale-dependent effectiveness of wildlife management: a case study on british deer. | impacts of herbivory by wild ungulates represent a significant issue world-wide. to be effective, management of populations and impacts needs to be coordinated above the site scale, yet little research has investigated the appropriate spatial scale over which management should be integrated to be fully effective. in consideration of reduction of impacts in deciduous or mixed woodland habitats, we tested scale-specific management effectiveness in a lowland area of uk where moderate- to high-densi ... | 2020 | 32947117 |
| first detection and molecular identification of anaplasma phagocytophilum in an introduced population of reeve's muntjac (muntiacus reevesi) in united kingdom. | in the present study, we investigated blood samples of 196 invasive reeve's muntjac (muntiacus reevesi) and 91 native roe deer (capreolus capreolus) originating from the same area in thetford forest in eastern england for the occurrence of blood pathogens such as anaplasmatacae, rickettsiales and piroplasmida (babesia spp., theileria spp.) by using pcr. babesia spp., rickettsia spp. and theileria spp. were not detected. only two male (1%) reeve's muntjacs and six (6.6%) roe deer were positive fo ... | 2020 | 32334005 |
| comparative microbiome analysis reveals the ecological relationships between rumen methanogens, acetogens, and their hosts. | ruminant methane, which is generated by methanogens through the consumption of hydrogen and supports the normal function of the rumen ecosystem, is a major source of greenhouse gases. reductive acetogenesis by acetogens is a possible alternative sink that can dispose of hydrogen for acetate production. however, the distribution of rumen methanogens and acetogens along with the relationships among methanogens, acetogens, and their host are poorly understood. therefore, we investigated the rumen m ... | 2020 | 32714292 |
| interstitial colocalization of two cervid satellite dnas involved in the genesis of the indian muntjac karyotype. | a number of repetitive dna clones were generated from pcr amplifications of indian muntjac genomic dna using primer sequences derived from a white tailed deer satellite ii dna sequence. one clone (mmv-0.7) was characterized and shown to be a cervid satellite ii dna clone. multiple colored fish studies with cervid satellite i (c5) and this satellite ii clone (mmv-0.7) to chinese muntjac metaphase chromosomes localized both satellite dnas at the pericentromeric regions of all chromosomes except fo ... | 2000 | 10997777 |
| immunolocalization of cytoskeletal proteins in the testes of two asian cervids: water deer (hydropotes inermis) and reeves' muntjac (muntiacus reevesi). | in order to gather basic reproductive information of the water deer and reeves' muntjac, the immunolocalization of the cytoskeleton proteins in the testes and epididymides of these two species was investigated. the distribution pattern of cytoskeletal proteins in these two species was similar. the desmin was detected in the peritubular myoid cells of the testes and the sub-epithelial cells of the epididymal ducts. vimentin was observed in the myoid cells, leydig cells and perinuclear region of t ... | 2013 | 23503292 |
| karyotypic evolution of a novel cervid satellite dna family isolated by microdissection from the indian muntjac y-chromosome. | a minilibrary was constructed from dop-pcr products using microdissected y-chromosomes of indian muntjac as dna templates. two microclones designated as im-y4-52 and im-y5-7 were obtained from negative screening of all three cervid satellite dnas (satellites i, ii, and iv). these two microclones were 295 and 382 bp in size, respectively, and shared approximately 70% sequence homology. southern blot analysis showed that the im-y4-52 clone was repetitive in nature with an approximately 0.32-kb reg ... | 2005 | 15827746 |
| chromosomal evolution of the chinese muntjac (muntiacus reevesi). | the aim of this study was to test the validity of the hypothesis that the 2n=46 karyotype of the chinese muntjac (muntiacus reevesi) could have evolved through 12 tandem fusions from a 2n=70 hypothetical ancestral karyotype, which is still retained in chinese water deer (hydropotes inermis) and brown-brocket deer (mazama gouazoubira). combining fluorescence-activated chromosomal sorting and degenerate oligonucleotide-primed polymerase chain reaction, we generated chromosome-specific dna paint pr ... | 1997 | 9169585 |
| analysis of muntjac deer genome and chromatin architecture reveals rapid karyotype evolution. | closely related muntjac deer show striking karyotype differences. here we describe chromosome-scale genome assemblies for chinese and indian muntjacs, muntiacus reevesi (2n = 46) and muntiacus muntjak vaginalis (2n = 6/7), and analyze their evolution and architecture. the genomes show extensive collinearity with each other and with other deer and cattle. we identified numerous fusion events unique to and shared by muntjacs relative to the cervid ancestor, confirming many cytogenetic observations ... | 2020 | 32873878 |
| weissella muntiaci sp. nov., isolated from faeces of formosan barking deer (muntiacus reevesi). | a gram-stain-positive strain, 8 h-2t, was isolated from faeces of reeves' muntjac (muntiacus reevesi) barking deer in taiwan. cells of the strain were short rod-shaped, non-motile, non-haemolytic, asporogenous, facultatively anaerobic, heterofermentative and did not exhibit catalase and oxidase activities. comparative analyses of 16s rrna, phes and dnaa gene sequences demonstrated that the novel strain was a member of the genus weissella. on the basis of 16s rrna gene sequence similarities, the ... | 2020 | 32228749 |
| establishment and characterization of a fibroblast cell line from postmortem skin of an adult chinese muntjac (muntiacus reevesi). | isolation and culture of somatic cells from animals especially endangered species have raised great concerns as it is being an effective and convenient way to preserve genetic materials for future studies. as a species native to china, chinese muntjac (muntiacus reevesi) is listed as a beneficial species with economic and scientific research values. to our knowledge, however, there have been no published reports on somatic cell preservation of this species to date. to conserve biological resourc ... | 2020 | 31898011 |
| the effect of fructose supplementation on feed intake, nutrient digestibility and digesta retention time in reeves's muntjac (muntiacus reevesi). | the aim of the study was to determine the effect of fructose supplementation in the diet on feed intake, nutrient digestibility and digesta retention time in reeves's muntjac (muntiacus reevesi), a browsing cervid. in experiment 1, six adult males of reeves's muntjac were used in a replicated 3 × 3 latin square design and fed a diet consisting of dehydrated chopped lucerne (ad libitum), high-fibre pellet (120 g/day) and wheat bran (30 g/day) without (f0) or with addition of 12 and 24 g fructose/ ... | 2019 | 31441143 |
| chabaudstrongylus ninhae (trichostrongylidae: cooperiinae) and oesophagostomum muntiacum (chabertiidae: oesophagostominae) in feral alien reeves's muntjacs on izu-oshima island, tokyo, japan. | the naturalization of alien reeves's muntjacs (muntiacus reevesi) on izu-oshima island, tokyo, japan, has proceeded intensively over the last five decades. to clarify whether the gastrointestinal helminths of these animals were brought from their original endemic area or were newly acquired in japan, 32 reeves's muntjacs trapped on the island were parasitologically examined. in addition to gongylonema pulchrum in the oesophagus (34.4% prevalence), chabaudstrongylus ninhae (dróżdż, 1967) (trichos ... | 2019 | 30973116 |
| management of a reeve's muntjac ( muntiacus reevesi) with seizures using levetiracetam. | this report describes the diagnosis and management of idiopathic epilepsy in a 4-yr-old intact female reeve's muntjac ( muntiacus reevesi). the patient was initially witnessed to have isolated paroxysmal events consistent with epileptic seizures (altered consciousness, lateral recumbency, tonic/clonic movement of limbs) lasting less than 3 min with an immediate return to normal consciousness. the seizure frequency increased to >3 seizures within 24 hr and phenobarbital 3 mg/kg orally every 12 hr ... | 2017 | 29297840 |
| milk collection methods for mice and reeves' muntjac deer. | animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen's native host. milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. here we illustrate an inexpensive and facil ... | 2014 | 25079295 |
| isolation and characterization of polymorphic microsatellite loci of the chinese muntjac (muntiacus reevesi). | eight polymorphic microsatellite markers for muntiacus reevesi were identified and characterized in this study. the number of alleles per locus ranged from 3 to 10 across 24-48 samples. the loci showed expected and observed heterozygosities of 0.577-0.876 and 0.387-0.933, respectively, with an average polymorphic information content value of 0.682. these markers should be a useful tool for further population and conservation genetic studies of muntiacus reevesi. | 2014 | 24668678 |
| transabdominal ultrasound for pregnancy diagnosis in reeves' muntjac deer. | reeves' muntjac deer (muntiacus reevesi) are a small cervid species native to southeast asia, and are currently being investigated as a potential model of prion disease transmission and pathogenesis. vertical transmission is an area of interest among researchers studying infectious diseases, including prion disease, and these investigations require efficient methods for evaluating the effects of maternal infection on reproductive performance. ultrasonographic examination is a well-established to ... | 2014 | 24430673 |
| comparative sequence analyses reveal sites of ancestral chromosomal fusions in the indian muntjac genome. | indian muntjac (muntiacus muntjak vaginalis) has an extreme mammalian karyotype, with only six and seven chromosomes in the female and male, respectively. chinese muntjac (muntiacus reevesi) has a more typical mammalian karyotype, with 46 chromosomes in both sexes. despite this disparity, the two muntjac species are morphologically similar and can even interbreed to produce viable (albeit sterile) offspring. previous studies have suggested that a series of telocentric chromosome fusion events in ... | 2008 | 18957082 |
| tandem chromosome fusions in karyotypic evolution of muntiacus: evidence from m. feae and m. gongshanensis. | the muntjacs (muntiacus, cervidae) are famous for their rapid and radical karyotypic diversification via repeated tandem chromosome fusions, constituting a paradigm for the studies of karyotypic evolution. of the five muntjac species with defined karyotypes, three species (i.e. muntiacus reevesi, 2n = 46; m. m. vaginalis, 2n = 6/7; and m. crinifrons, 2n = 8/9) have so far been investigated by a combined approach of comparative chromosome banding, chromosome painting and bac mapping. the results ... | 2006 | 16964570 |
| high-density comparative bac mapping in the black muntjac (muntiacus crinifrons): molecular cytogenetic dissection of the origin of mcr 1p+4 in the x1x2y1y2y3 sex chromosome system. | the black muntjac (muntiacus crinifrons, 2n = 8[female symbol]/9[male symbol]) is a critically endangered mammalian species that is confined to a narrow region of southeastern china. male black muntjacs have an astonishing x1x2y1y2y3 sex chromosome system, unparalleled in eutherian mammals, involving approximately half of the entire genome. a high-resolution comparative map between the black muntjac (m. crinifrons) and the chinese muntjac (m. reevesi, 2n = 46) has been constructed based on the c ... | 2006 | 16443346 |
| assignment of the telomere-repeat binding factor genes terf1 and terf2 to chinese muntjac (2n = 46) chromosome bands 12q3 and 2q33 by in situ hybridization. | | 2005 | 16097085 |
| defining the orientation of the tandem fusions that occurred during the evolution of indian muntjac chromosomes by bac mapping. | the indian muntjac (muntiacus muntjak vaginalis) has a karyotype of 2n=6 in the female and 7 in the male, the karyotypic evolution of which through extensive tandem fusions and several centric fusions has been well-documented by recent molecular cytogenetic studies. in an attempt to define the fusion orientations of conserved chromosomal segments and the molecular mechanisms underlying the tandem fusions, we have constructed a highly redundant (more than six times of whole genome coverage) bacte ... | 2005 | 16010580 |
| [sequence and organization of muntiacus reevesi mitochondrial genome]. | a shot-gun dna sequence strategy was employed,in which the mitochondrial genome library of muntiacus reevesi has been constructed to obtain the complete mitochondrial genome sequence. the chinese muntjac's mitochondrial genome, consisting of 16354 base pairs which encode genes for 13 proteins, 2 rrnas, and 22 trnas, is similar to those mammals in both order and orientation. the sequence of rrna gene, some of the protein-coding regions and trnas are highly homologous in mammals. differences exist ... | 2004 | 15640115 |
| cloning, characterization and physical mapping of three cervid satellite dna families in the genome of the formosan muntjac (muntiacus reevesi micrurus). | due to their high sequence diversity even among closely related species, satellite dna sequences can be a useful molecular marker for phylogenetic and taxonomic analyses. to characterize the satellite dna in the genome of a native muntjac species of taiwan, the formosan muntjac, satellite dna clones representing three different cervid satellite dna families from this species were isolated and analyzed. genomic organization study of these satellite dnas was also undertaken. three formosan muntjac ... | 2004 | 15218264 |
| hydromyelia in a reeves' muntjac (muntiacus reevesi). | a 24-day-old, 2.2-kg, female reeves' muntjac (muntiacus reevesi) acutely developed left hind limb lameness that resolved with rest and anti-inflammatory drugs but recurred at 8 mo of age. magnetic resonance imaging (mri) of the lumbar, sacral, and coccygeal spine revealed a fluid-filled dilatation of the central canal of the spinal cord, which was interpreted as a hydromyelic cyst. surgical exploration and drainage of the cyst were attempted. despite initially improved mobility, severe plantar u ... | 2002 | 12462493 |
| rapid and parallel chromosomal number reductions in muntjac deer inferred from mitochondrial dna phylogeny. | muntjac deer (muntiacinae, cervidae) are of great interest in evolutionary studies because of their dramatic chromosome variations and recent discoveries of several new species. in this paper, we analyze the evolution of karyotypes of muntjac deer in the context of a phylogeny which is based on 1,844-bp mitochondrial dna sequences of seven generally recognized species in the muntjac subfamily. the phylogenetic results support the hypothesis that karyotypic evolution in muntjac deer has proceeded ... | 2000 | 10958849 |
| a reappraisal of the tandem fusion theory of karyotype evolution in indian muntjac using chromosome painting. | we have tested the tandem fusion hypothesis of the origin of the indian muntjac karyotype (2n = 6/7) by using reciprocal chromosome painting between the indian muntjac, chinese muntjac (n = 46) and brown brocket deer (2n = 70 + 3b) with chromosome-specific paint probes derived from flow-sorted chromosomes of these three deer species. our results have shown that the euchromatic blocks of all chromosome arms of the brown brocket deer have been conserved apparently unchanged in number and content i ... | 1997 | 9146914 |
| evolution of the black muntjac (muntiacus crinifrons) karyotype revealed by comparative chromosome painting. | the black muntjac (muntiacus crinifrons) has an unusual karyotype of 2n = 8 in females and 2n = 9 in males. we have studied the evolution of this karyotype by hybridising chromosome-specific paints derived from flow-sorted chromosomes of the chinese muntjac (m. reevesi, 2n = 46) to chromosomes of the black muntjac. the hybridisation pattern allowed us to infer chromosomal homologies between these two species. tandem and centromeric fusions, reciprocal translocations, and insertions are involved ... | 1997 | 9186510 |
| structure and dynamic organization of centromeres/prekinetochores in the nucleus of mammalian cells. | although considerable research has been focused on understanding the structure and molecular organization of the centromere-kinetochore complex of mitotic chromosomes, few reports have dealt with the centromere (prekinetochore) in the interphase nucleus. in the present study, we utilized anti-centromere antibodies from the serum of patients with the autoimmune disease, scleroderma crest (calcinosis, raynaud's phenomenon, esophageal dismotility, sclerodactyly, telangiectasia), as probes to invest ... | 1996 | 8937987 |
| phylogeny of muntiacus (cervidae) based on mitochondrial dna restriction maps. | mitochondrial dna restriction maps for 12 restriction enzymes of four species of muntjacs--indian muntjac (m. muntjak), gongshan muntjac (m. gongshanensis), black muntjac (m. crinifrons), and chinese muntjac (m. reevesi)--were compared to estimate the phylogenetic relationships among them. phylogenetic trees were constructed by both distance and parsimony methods. the two resulting trees share a similar topology, which indicates that the black muntjac and the gongshan muntjac are closely related ... | 1995 | 8825938 |
| a comparative study of karyotypes of muntjacs by chromosome painting. | we have used a combination of chromosome sorting, degenerate oligonucleotide-primed polymerase chain reaction (dop-pcr), chromosome painting and digital image capturing and processing techniques for comparative chromosome analysis of members of the genus muntiacus. chromosome-specific "paints" from a female indian muntjac were hybridised to the metaphase chromosomes of the gongshan, black, and chinese muntjac by both single and three colour chromosome painting. karyotypes and idiograms for the i ... | 1995 | 7587587 |
| new evidence for tandem chromosome fusions in the karyotypic evolution of asian muntjacs. | a clone of highly repetitive dna, designated c5, was isolated from dna of female chinese muntjac cells. the nucleotide sequence of this clone is 80%-85% homologous to that of the satellite ia clone and other highly repetitive dna clones previously obtained from the indian muntjac. using c5 as a probe for in situ hybridizations to chromosome preparations of cells of both the chinese and indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the ... | 1991 | 1769270 |
| evidence that the seasonal antler cycle of adult reeves' muntjac (muntiacus reevesi) is not associated with reproductive quiescence. | data were obtained from post-mortem investigations of 190 culled and road-killed muntjac bucks between 1967 and 1989. although adult bucks (i.e. those having undergone at least one antler cycle) have a synchronous annual antler cycle, unlike temperate-zone cervids there was little seasonal variation in testis size or activity, or in the size and activity of the epididymidis or accessory reproductive glands. spermatogenesis was not abated when the antlers were in velvet and year-round fertility w ... | 1991 | 1886095 |
| [comparative studies on synaptonemal complexes in spermatocytes of chinese muntjac muntiacus reevesi, black muntjac m. crinifrons and indian muntjac m. muntjak]. | | 1988 | 3273674 |
| techniques for the safe and humane capture of free-living muntjac deer (muntiacus reevesi). | | 2006 | 3828750 |
| a comparison of xylazine and methohexitone for the chemical immobilization of reeves' muntjac (muntiacus reevesi). | | 2019 | 3594167 |
| chromosome rearrangement between the indian muntjac and chinese muntjac is accompanied by a delection of middle repetitive dna. | the organizations of the genomes of two related species of asian deer, the indian (2n = 6 female, 7 male) and chinese muntjac (2n = 46), were compared at the cytogenetic and molecular levels. these dramatically different karyotypes preserve little apparent g-banding homology. the difference in chromosome number is coincident with a 22% reduction in haploid dna content from 2.7 to 2.1 pg in the chinese and indian muntjac, respectively. the kinetics of reassociation of the indian muntjac (equivale ... | 1982 | 7104826 |
| evolution of muntjac dna. | the extent of nuclear single-copy dna divergence between muntiacus reevesi and muntiacus muntjak vaginalis (cervidae), a species pair showing extreme karyotype differences but striking morphological similarity, is 2%, as judged from the thermal stability of interspecific dna-dna hybrids. a comparison of the total nuclear dna reassociation kinetics of the two species indicates a reduction of lowly repetitive sequences in m. m. vaginalis. | 1981 | 7327043 |
| gametogenesis in a male indian muntjac x chinese muntjac hybrid. | histological and cytogenetic examinations of testicular preparations from a male hybrid between an indian muntjac x chinese muntjac showed a certain degree of chromosomal homology, as evidenced by the synaptic behavior. the male hybrid is considered sterile because spermatogenetic stages were arrested at early prophase. silver staining demonstrated that the nucleolus organizer regions of both parents were expressed, but no synaptonemal complex and sex vesicle were observed. | 1981 | 7297121 |
| comparative cytogenetic studies on the red muntjac, chinese muntjac, and their f1 hybrids. | the chromosomes of the red (indian) muntjac (2n = 6 female, 7 male), the chinese (reeves) muntjac (2n = 46), and their f1 hybrids were studied with various banding techniques. g-banding showed that the two complements still have a high degree of homology despite the vast difference in diploid numbers between the two species. cd-banding suggested that the x chromosome and chromosome 1 of the red muntjac are dicentric. evidence indicates that both centric and repeated tandem translocations among t ... | 1980 | 7371430 |
| the social behaviour of captive muntjacs muntiacus reevesi (ogilby 1839). | the social behaviour of 8 captive muntjacs was studied from may to october 1970 and 1971. in 1970 close range observation and photography resulted in a descriptive account of the animal's social behaviour patterns. in 1971, 450 h of observation of undisturbed muntjacs living in a 2200 m2 enclosure were devoted to a quantitative study of social interactions. it was found that the social relationships of muntjacs are complex and subtale, maybe more than one might expect from a solitary and primiti ... | 1977 | 558696 |
| indian muntjac, muntiacus muntjak: a deer with a low diploid chromosome number. | the indian muntjac (muntiacus muntjak) has a diploid chromosome number of 7 in the male and 6 in the female, the lowest number yet described in a mammal. its near relative, reeve's muntjac (muntiacus reevesi) has a diploid number of 46, and the karyotypes of the two, species are very different. | 1970 | 5444269 |