Publications

TitleAbstractYear
Filter
PMID
Filter
chromosomal evolution in cervidae.on the basis of chromosome data obtained on 30 species and 20 subspecies of cervidae, a report is submitted on the karyosystematics of this family. the primitive karyotype of cervidae may be inferred to be composed of 35 acrocentric pairs (2n = 70 fn = 70). during the phyletic evolution of this family different types of chromosome rearrangements were probably selected and the group may have differentiated karyologically into three branches: (1) the cervinae that fixed a centric fusion resulting ...19902249009
localization of cloned, repetitive dna sequences in deer species and its implications for maintenance of gene territory.the deer family shows the largest variation in chromosome number known in mammals (2n = 6 to 2n = 70). the drastic rearrangement of the chromosomes allows to test the prediction, based on the chromosome field theory, according to which dna sequences tend to occupy specific territories within the eukaryotic chromosome. nuclear dnas were isolated from eight deer and two bovidae species. these dnas were cleaved with the restriction enzymes eco ri and alu i. following eco ri digestion highly repetit ...19902361878
interstitial localization of telomeric dna sequences in the indian muntjac chromosomes: further evidence for tandem chromosome fusions in the karyotypic evolution of the asian muntjacs.the indian muntjac is believed to have the lowest chromosome number in mammals (2n = 6 in females and 2n = 7 in males). it has been suggested that a series of tandem chromosome fusions from an ancestral chinese muntjac-like species (2n = 46) may have occurred during the karyotypic evolution of the indian muntjac. in an earlier study, hybridization signals generated by the chinese muntjac centromeric heterochromatin dna probe (c5) were found to be distributed interstitially in the chromosomes of ...19938485991
segmental homology among cattle (bos taurus), indian muntjac (muntiacus muntjak vaginalis), and chinese muntjac (m. reevesi) karyotypes.in an attempt to examine homologies between indian and chinese muntjac karyotypes at a subchromosomal level, five bovine cosmids were comparatively mapped by heterologous fluorescence in situ hybridization (fish). in the indian muntjac (2n = 6) all cosmids mapped to chromosome 1, whereas in the chinese muntjac (2n = 46) two cosmids mapped to chromosome 3 and one cosmid each mapped to chromosomes 1, 7, and 17. these markers have maintained their intrachromosomal position relative to a centromere/ ...19979284921
new phylogenetic perspectives on the cervidae (artiodactyla) are provided by the mitochondrial cytochrome b gene.the entire mitochondrial cytochrome b (cyt b) gene was compared for 11 species of the artiodactyl family cervidae, representing all living subfamilies, i.e., the antlered cervinae (cervus elaphus, c. nippon, dama dama), muntiacinae (muntiacus reevesi), and odocoileinae (odocoileus hemionus, mazama sp., capreolus capreolus, c. pygargus, rangifer tarandus, alces alces); and the antlerless hydropotinae (hydropotes inermis). phylogenetic analyses using tragulidae, antilocapridae, giraffidae and bovi ...19989628037
sheep-associated malignant catarrhal fever in a petting zoo.in a privately owned petting zoo in arizona, 17 deer from five different species, white-tailed deer (odocoileus virginianus), reeve's muntjac (muntiacus reevesi), mule deer (odocoileus hemionus), reindeer (rangifer tarandus), and axis deer (axis axis), died of suspected malignant catarrhal fever (mcf) over a period from late 1992 to early 1995. a pcr assay specific for ovine herpesvirus 2, the putative causative agent of sheep-associated mcf, and a competitive-inhibition enzyme-linked immunosorb ...199910572865
ehrlichiae and ehrlichial diseases in china.the various ticks collected from different areas of china were examined for the existence of ehrlichial agents by polymerase chain reaction (pcr) with genus- or species-specific primers designed on the basis of ehrlichial 16s rrna genes and sequence analyses. in southern china, e. chaffeensis was detected in amblyomma testudinarium ticks from infested cattle, haemaphysalis yeni ticks from hare, and ixodes ovatus ticks from muntiacus reevesi. e. canis was identified in rhipicephalus sanguineus ti ...200312860598
phylogenomic study of the subfamily caprinae by cross-species chromosome painting with chinese muntjac paints.chromosomal homologies have been established between the chinese muntjac (muntiacus reevesi, mre, 2n = 46) and five ovine species: wild goat (capra aegagrus, cae, 2n = 60), argali (ovis ammon, oam, 2n = 56), snow sheep (ovis nivicola, oni, 2n = 52), red goral (naemorhedus cranbrooki, ncr, 2n = 56) and sumatra serow (capricornis sumatraensis, csu, 2n = 48) by chromosome painting with a set of chromosome-specific probes of the chinese muntjac. in total, twenty-two chinese muntjac autosomal paintin ...200515973503
phylogenomics of several deer species revealed by comparative chromosome painting with chinese muntjac paints.a set of chinese muntjac (muntiacus reevesi) chromosome-specific paints has been hybridized onto the metaphases of sika deer (cervus nippon, cni, 2n = 66), red deer (cervus elaphus, cel, 2n = 62) and tufted deer (elaphodus cephalophus, ece, 2n = 47). thirty-three homologous autosomal segments were detected in genomes of sika deer and red deer, while 31 autosomal homologous segments were delineated in genome of tufted deer. the chinese muntjac chromosome x probe painted to the whole x chromosome, ...200616850210
the dispersal of vascular plants in a forest mosaic by a guild of mammalian herbivores.endozochorous seed dispersal by herbivores can affect plant spatial dynamics and macroecological patterns. we have investigated the number and species composition of viable seeds deposited in faeces of a full guild of macroherbivores (four deer and two lagomorph species) in a forest in eastern britain. one hundred and one plant species germinated from faecal pellet material, 85 of which were among the 247 vascular plant species recorded in the forest. however, three species - chenopodium album, ...200717661087
diagnosis and treatment of babesia odocoilei in captive reindeer (rangifer tarandus tarandus) and recognition of three novel host species.two captive reindeer (rangifer tarandus tarandus) at a new york zoological institution were diagnosed with babesia odocoilei. clinical signs consistent with acute babesiosis included fever, hemoglobinuria, and hemolytic anemia. both episodes were precipitated by stressful events that may have compromised their immunocompetence. the diagnosis was confirmed by visualization of intraerythrocytic parasites on stained blood smears, polymerase chain reaction, and speciation of the babesia by sequencin ...200919368255
estimating the risk of cattle exposure to tuberculosis posed by wild deer relative to badgers in england and wales.wild deer populations in great britain are expanding in range and probably in numbers, and relatively high prevalence of bovine tuberculosis (btb, caused by infection with mycobacterium bovis) in deer occurs locally in parts of southwest england. to evaluate the m. bovis exposure risk posed to cattle by wild deer relative to badgers in england and wales, we constructed and parameterized a quantitative risk model with the use of information from the literature (on deer densities, activity pattern ...200919901384
synapsis and meiotic recombination in male chinese muntjac (muntiacus reevesi).the muntjacs (muntiacus, cervidae) have been extensively studied in terms of chromosomal and karyotypic evolution. however, little is known about their meiotic chromosomes particularly the recombination patterns of homologous chromosomes. we used immunostained surface spreads to visualise synaptonemal complexes (scs), recombination foci and kinetochores with antibodies against marker proteins. as in other mammals pachytene was the longest stage of meiotic prophase. 39.4% of xy bivalents lacked m ...201121559438
molecular evidence for anaplasma bovis infection in wild reeves' muntjac (muntiacus reevesi), southwest china.anaplasma bovis is one of the most important tick-borne pathogens in china. in the first report of a. bovis in china, we describe infection in eight of 17 wild reeves' muntjac (muntiacus reevesi) from guangxi, southwest china.201425098301
molecular detection of anaplasma phagocytophilum in wild cervids and hares in china.anaplasma phagocytophilum is an emerging tick-borne pathogen of global veterinary and public health significance. wild ungulates are suggested to serve as reservoirs for this agent in both the us and europe. we investigated the occurrence of a. phagocytophilum in sika deer ( cervus nippon ), reeves' muntjac ( muntiacus reevesi ), tufted deer ( elaphodus cephalophus ), and chinese hare ( lepus sinensis ) in china. we detected a. phagocytophilum in nine (53%) free-ranging wild reeves' muntjac. no ...201728151084
aspects of the husbandry and management of captive cervids.in a continuing effort to better understand the transmission and persistence of chronic wasting disease in wild populations of cervids, colorado state university, fort collins houses two species of deer indoors to study the pathogenesis of chronic wasting disease. here we report key aspects regarding the husbandry and medication of reeves' muntjac and white-tailed deer in captivity for research purposes.201627003353
mother to offspring transmission of chronic wasting disease in reeves' muntjac deer.the horizontal transmission of prion diseases has been well characterized in bovine spongiform encephalopathy (bse), chronic wasting disease (cwd) of deer and elk and scrapie of sheep, and has been regarded as the primary mode of transmission. few studies have monitored the possibility of vertical transmission occurring within an infected mother during pregnancy. to study the potential for and pathway of vertical transmission of cwd in the native cervid species, we used a small cervid model-the ...201323977159
genetic variation of gongylonema pulchrum from wild animals and cattle in japan based on ribosomal rna and mitochondrial cytochrome c oxidase subunit i genes.the gullet worm (gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. to investigate this notion, the ribosomal rna gene (rdna), mainly regions of the internal transcribed spacers (its) 1 and 2, and a cytochrome c oxidase subunit i (coi) region of mitochondrial dna of g. pulchrum were characterized using parasites from t ...201322967753
the arteries of brain base in species of the cervid family.the aim of the article was to describe the pattern of main arteries at the encephalon base, their connections, and varieties. this study included 106 specimens of the head and cerebral arteries of the following eight species of the cervid family: reindeer, chital, eld's deer, wapiti, sika deer, fallow deer, pere david's deer or milu, and reeve's or chinese muntjac. the arteries of the animals under study were filled with acetone-dissolved stained vinyl superchloride or stained latex lbs3060. the ...201525399744
distribution of wild mammal assemblages along an urban-rural-forest landscape gradient in warm-temperate east asia.urbanization may alter mammal assemblages via habitat loss, food subsidies, and other factors related to human activities. the general distribution patterns of wild mammal assemblages along urban-rural-forest landscape gradients have not been studied, although many studies have focused on a single species or taxon, such as rodents. we quantitatively evaluated the effects of the urban-rural-forest gradient and spatial scale on the distributions of large and mid-sized mammals in the world's larges ...201323741495
detection of a novel gammaherpesvirus (genus rhadinovirus) in wild muntjac deer in northern ireland.this study represents the initial part of an investigation into the potential for non-native, wild, free-living muntjac deer (muntiacus reevesi) to carry viruses that could be a threat to livestock. a degenerate pcr assay was used to screen a range of tissues from muntjac deer culled in northern ireland for the presence of herpesviral nucleic acids. this was followed by sequencing of pcr amplicons and phylogenetic analysis. we report the detection of a novel gammaherpesvirus most closely related ...201728204896
characterization of the telomere complex, terf1 and terf2 genes in muntjac species with fusion karyotypes.the telomere binding proteins trf1 and trf2 maintain and protect chromosome ends and confer karyotypic stability. chromosome evolution in the genus muntiacus is characterized by numerous tandem (end-to-end) fusions. to study trf1 and trf2 telomere binding proteins in muntiacus species, we isolated and characterized the terf1 and -2 genes from indian muntjac (muntiacus muntjak vaginalis; 2n = 6 female) and from chinese muntjac (muntiacus reveesi; 2n = 46). expression analysis revealed that both g ...200515878333
characterization of nuclear compartments identified by ectopic markers in mammalian cells with distinctly different karyotype.the functional organization of chromatin in cell nuclei is a fundamental question in modern cell biology. individual chromosomes occupy distinct chromosome territories in interphase nuclei. nuclear bodies localize outside the territories and colocalize with ectopically expressed proteins in a nuclear subcompartment, the interchromosomal domain compartment. in order to investigate the structure of this compartment in mammalian cells with distinctly different karyotypes, we analyzed human hela cel ...200515776261
identification of novel single-stranded d(tc)n binding proteins in several mammalian species.a group of single-stranded d(tc)n specific binding proteins has been detected in the nuclear extracts of several mammalian species that included mouse, human, african green monkey, chimpanzee, and chinese muntjac. southwestern analysis of 500 mm kci nuclear extracts has shown that these proteins cluster in a similar size range, 55.5 to 57 kd. an additional 54 kd band was present for the three primate species examined. the single-stranded d(tc)n binding activity was confirmed with bandshift assay ...19912017376
repetitive sequence families in alces alces americana.high-resolution derivative melting was used to obtain detailed distributions of local (g + c) contents in a number of ruminant dnas. profiles over low (g + c) regions [20-36% (g + c)] are congruent for all ruminants. this region represents 45-50% of the nuclear dna content and primarily contains intergenic and intron sequences. the high (g + c) region, where most coding sequences are found [38-68% (g + c)], is marked by satellite bands denoting the presence of transcriptionally inert, tandemly r ...19979115175
comparative gene mapping in the species muntiacus muntjac.an extreme case of chromosomal evolution is presented by the two muntjac species muntiacus muntjac (indian muntjac, 2n = 6 [females], 7 [males]) and m. reevesi (chinese muntjac, 2n = 46). despite disparate karyotypes, these phenotypically similar species produce viable hybrid offspring, indicating a high degree of dna-level conservation and genetic relatedness. as a first step toward development of a comparative gene map, several indian muntjac homologs of known human type i anchor loci were map ...19921486805
karyotype evolution of giraffes (giraffa camelopardalis) revealed by cross-species chromosome painting with chinese muntjac (muntiacus reevesi) and human (homo sapiens) paints.considering the giraffe (giraffa camelopardalis, gca, 2n = 30) as a primitive species, its comparative genomic data are critical for our understanding of the karyotype evolution of pecorans. here, we have established genome-wide chromosomal homologies between giraffe, chinese muntjac (muntiacus reevesi, mre, 2n = 46) and human (homo sapiens, hsa, 2n = 46) with whole sets of chromosome-specific paints from chinese muntjac and human, in addition to providing a high-resolution g-banding karyotype o ...200819096208
molecular evidence for piroplasms in wild reeves' muntjac (muntiacus reevesi) in china.dna from liver samples of 17 free-ranging wild reeves' muntjac (muntiacus reevesi) was used for pcr amplification of piropalsm 18s rrna gene. of 17 samples, 14 (82.4%) showed a specific pcr product which were cloned and sequenced. blast analysis of the sequences obtained showed similarities to babesia sp., theileria capreoli, theileria uilenbergi and theileria sp. bo302-se. phylogenetic analysis showed that the babesia sp. detected in the present study was distantly separated from known babesia ...201424970769
one gland, two lobes: organogenesis of the "harderian" and "nictitans" glands of the chinese muntjac (muntiacus reevesi) and fallow deer (dama dama).the nictitans and harderian glands are enigmatic glands situated in the anterior aspect of the orbit. traditionally, the nictitans and harderian glands of mammals have been considered to be two fundamentally distinct glands. however, a consistent, unambiguous distinction between these two glands has remained elusive due to conflicting anatomical and histochemical definitions. the harderian gland was originally described, and first distinguished from the nictitans gland, in adult deer. we examine ...200717910397
isolation and identification of a novel satellite dna family highly conserved in several cervidae species.in an attempt to amplify cervid satellite ii dna from the genomes of indian muntjac and chinese muntjac, a pair of primers derived from the white tailed deer satellite ii dna clone (ovdii) yielded a prominent approximately 1 kb polymerase chain reaction (pcr) product (in addition to the expected 0.7 kb satellite ii dna fragments) in both species. the approximately 1 kb products were cloned, sequenced, and analyzed by southern blotting and fluorescence in situ hybridization (fish). this revealed ...200212355207
cenp-g: a new centromeric protein that is associated with the alpha-1 satellite dna subfamily.a new constitutive centromere-specific protein (cenp) has been identified as a result of its recognition as an autoantigen by serum from a patient with gastric antral vascular ectasia disease. conventional immunoblotting and two-dimensional double blotting with both this antiserum and a known anti-centromere antiserum showed that this antiserum predominantly recognized a mr 95,000 protein that is different from all known cenps. we have named this new protein cenp-g. this protein was detected at ...19989639657
comparative chromosome painting discloses homologous segments in distantly related mammals.comparative chromosome painting, termed zoo-fish, using dna libraries from flow sorted human chromosomes 1, 16, 17 and x, and mouse chromosome 11 discloses the presence of syntenic groups in distantly related mammalian orders ranging from primates (homo sapiens), rodents (mus musculus), even-toed ungulates (muntiacus muntjak vaginalis and muntiacus reevesi) and whales (balaenoptera physalus). these mammalian orders have evolved separately for 55-80 million years (myr). we conclude that zoo-fish ...19948054973
a tandemly repetitive, centromeric dna sequence from the canadian woodland caribou (rangifer tarandus caribou): its conservation and evolution in several deer species.a highly repetitive dna clone, designated rt-pst3, was isolated from the psti digest of canadian woodland caribou (rangifer tarandus caribou; 2n = 70) genomic dna. it was found to be a 991 bp monomer of a tandemly repeated dna sequence comprising about 5.7% of the genome and localized to the centromeric regions of all caribou acrocentric autosomes. southern blot analyses revealed that this caribou satellite dna sequence was well conserved in the genomes of five other deer species studied. in sit ...19947921645
localization of the repetitive telomeric sequence (ttaggg)n in two muntjac species and implications for their karyotypic evolution.it has been suggested that the chromosome set of the indian muntjac, muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the chinese muntjac, m. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. the location of the highly conserved human telomeric sequence (ttaggg)n in the metaphase chromosomes of m.m. vaginalis and its close relative, m. reevesi, was investigated by non-radioact ...19902369836
zoo-fluorescence in situ hybridization analysis of human and indian muntjac karyotypes (muntiacus muntjak vaginalis) reveals satellite dna clusters at the margins of conserved syntenic segments.zoo-fluorescence in situ hybridization (fish) with human whole chromosome-specific paint probes revealed extensive homoeologies between indian muntjac (2n=6, 7 female, male) and human karyotypes (2n=46). forty-two conserved syntenic segments, corresponding to all human chromosomes except the y chromosome, produced a near-complete coverage of the muntjac complement and revealed margins of interspecific segmental homoeology. to test the hypothesis that interstitial satellite dna loci, illuminated ...19979244453
localization and characterization of recombinant dna clones derived from the highly repetitive dna sequences in the indian muntjac cells: their presence in the chinese muntjac.a total of seven, highly repeated, dna recombinant m13 mp8 clones derived from a hpa ii digest of cultured cells of the indian muntjac (muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and dna sequencing. two of the clones, b1 and b8, contain satellite dna inserts which are 80% homologous in their dna sequences. b1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. this consensus sequence, tccctgacgcaactcgagaggaatcctg ...19863015505
evidence of higher levels of testosterone during the velvet period in muntjac than in other cervids.previous studies have shown that despite having a clear seasonal fluctuation in fecal testosterone concentration, the significantly lower testosterone levels found in velvet stags of the nonseasonal breeder muntjac (muntiacus sp.) apparently did not stop their spermatogenesis as in other deer species. in the present study, in vitro cultivated leydig cells isolated from adult stags of three native deer species of taiwan were treated with androstenedione, with or without adding human chorionic gon ...201424220360
infectious prions in the pregnancy microenvironment of chronic wasting disease-infected reeves' muntjac deer.ample evidence exists for the presence of infectious agents at the maternal-fetal interface, often with grave outcomes to the developing fetus (i.e., zika virus, brucella, cytomegalovirus, and toxoplasma). while less studied, pregnancy-related transmissible spongiform encephalopathies (tses) have been implicated in several species, including humans. our previous work has shown that prions can be transferred from mother to offspring, resulting in the development of clinical tse disease in offspri ...201728539446
comparative gene mapping in cattle, indian muntjac, and chinese muntjac by fluorescence in situ hybridization.the indian muntjac (muntiacus muntjak vaginalis) has a karyotype of 2n = 6 in the female and 2n = 7 in the male. the karyotypic evolution of indian muntjac via extensive tandem fusions and several centric fusions are well documented by molecular cytogenetic studies mainly utilizing chromosome paints. to achieve higher resolution mapping, a set of 42 different genomic clones coding for 37 genes and the nucleolar organizer region were used to examine homologies between the cattle (2n = 60), human ...200818283540
comparative morphological study on the lingual papillae and their connective tissue cores (ctc) in reeves' muntjac deer (muntiacus reevesi).the lingual papillae and their connective tissue cores (ctc) from reeves' muntjac deers (herbivorous artiodactyla) were studied using light and scanning electron microscopy and then compared to those of other mammalian species. at the posterior portion of the tongue, the reeves' muntjac has a lingual prominence on which large conical papillae are distributed. on the dorsal surface of the anterior tongue, numerous filiform papillae were found. externally, each filiform papilla consists of a rod-s ...200617140149
[surveillance on severe acute respiratory syndrome associated coronavirus in animals at a live animal market of guangzhou in 2004].to study the prevalence of severe acute respiratory syndrome coronavirus (sars-cov) like virus in animals at a live animal market of guanzhou in 2004 before and after culling of wild animal action taken by the local authority, in order to predict the re-emerging of sars from animal originals in this region.200515921605
[cloning and sequencing of sry gene of muntiacus].using the primers from sry gene--hmg box for pcr amplification in genomic dna of muntiacus reevesi cell strains, a 220bp fragment was obtained in the male but not in the female. the 220bp fragment was cloned into the pgem-t vector using t/a clone method. the identified positive clone was sequenced. the result shows that 82.6% nucleotides(152bp/184bp) are homologous between muntiacus sry and human sry gene. it suggests that sry is highly conserved during evolution.200315639874
new insights into the karyotypic relationships of chinese muntjac (muntiacus reevesi), forest musk deer (moschus berezovskii) and gayal (bos frontalis).to investigate the karyotypic relationships between chinese muntjac (muntiacus reevesi), forest musk deer (moschus berezovskii) and gayal (bos frontalis), a complete set of chinese muntjac chromosome-specific painting probes has been assigned to g-banded chromosomes of these three species. sixteen autosomal probes (i.e. 6-10, 12-22) of the chinese muntjac each delineated one pair of conserved segments in the forest musk deer and gayal, respectively. the remaining six autosomal probes (1-5, and 1 ...200515627750
centromeric locations in karyotypes: a rule derived from the theory of branched polymers.it is believed that chromosomes occupy non-overlapping domains in the interphase nucleus, and that the nuclear volume can be divided into the interchromosomal space and the chromosome domains. concentrations of various components (e.g., small ions) are different in these compartments. since nuclear volume is twice as large in g2 as in g1 phase, v2/v1 (the g2/g1 ratio of total chromosomal volumes) must be two in order to keep the interchromosomal concentrations unchanged. the aim of this study is ...19968869128
compound kinetochores of the indian muntjac. evolution by linear fusion of unit kinetochores.the chromosomes of the indian muntjac (muntiacus muntjak vaginalis) are unique among mammals due to their low diploid number (2n = 6 female, 7 male) and large size. it has been proposed that the karyotype of this small asiatic deer evolved from a related deer the chinese muntjac (muntiacus reevesi) with a diploid chromosome number of 2n = 46 consisting of small telocentric chromosomes. in this study we utilized a kinetochore-specific antiserum derived from human patients with the autoimmune dise ...19846525895
chromosome homologies between tsessebe (damaliscus lunatus) and chinese muntjac (muntiacus reevesi) facilitate tracing the evolutionary history of damaliscus (bovidae, antilopinae, alcelaphini).genome-wide homologies between the tsessebe (damaliscus lunatus, 2n = 36) and chinese muntjac (muntiacus reevesi, 2n = 46) have been established by cross-species painting with chinese muntjac chromosome paints. twenty-two autosomal painting probes detected 35 orthologous segments in the tsessebe. hybridization results confirmed that: (i) d. lunatus carries the (9;14) reciprocal translocation that has been proposed to be a derived chromosomal landmark shared by all species of the antilopinae; (ii ...201121178333
Displaying items 1 - 46 of 46