Publications

TitleAbstractYear
Filter
PMID
Filter
characteristics of the non-occluded form of a nuclear polyhedrosis virus.non-occluded virions of a nuclear polyhedrosis virus of the alfalfa looper, autographa californica, found in the medium of cell cultures of infected fall armyworm, spodopter frugiperda, and in the hemolymph of infected s. frugiperda larvae were partially characterized by biological, chemical and physical methods. also, the rate of appearance of the virions was studied in cell culture and the host insect to determine maximum virion production. virions obtained from both sources were heat-sensitiv ...1975343
rna-protein interactions in alfalfa mosaic virus.particles of the bottom component of alfalfa mosaic virus have a compact bacilliform structure at neutral ph. when the ph is raised to 8.3 the structure unfolds. since the particle weight does not change it is concluded that the protein subunits remain attached to the rna. the particle weight of the spheroidal top component a of the virus is halved when the particles unfold at ph 8.3. this can be explained by the fact that these particles contain two rna molecules of identical size. free rna mol ...19765938
alfalfa mosaic virus protein polymerization. 197718611
transmission of alfalfa mosaic virus through nicandra physaloides seeds and its localization in embryo cotyledons.alfalfa mosaic virus (amv) was found to be transmitted through seeds of nicandra physaloids l. the average seed transmission rate of the amv isolates t6, lmbg-4 and st amounted to 23, 4 and 0 per cent, repectively. in the cytoplasm of parenchyma cells of embryo cotyledons of seeds from plants infected with the t6 isolate, electron microscopy revealed amv aggregates of type 2a and aggregations of irregularly viral particles with a tendency to subparallel alignment, representing early stages of ty ...197720770
properties of solubilized rna-dependent rna polymerase from alfalfa mosaic virus-infected and healthy tobacco plants. 197833485
letter: alfalfa and blood-cholesterol. 197551159
translation products of the alfalfa mosaic virus ribonuclei acids in wheat-germ cell-free system and in oocytes from xenopus laevis. 197664215
effect of alfalfa meal on shrinkage (regression) of atherosclerotic plaques during cholesterol feeding in monkeys.a semipurified diet containing 1.2 mg of cholesterol/cal was fed to cynomolgus monkeys (macaca fascicularis). at the end of 6 months, a group of 18 animals was killed for evaluation of atherosclerosis in the aorta and the coronary arteries. the remaining monkeys were assigned to three groups of 18 animals each and fed, during the following 18 months, semipurified diets containing 0.34 mg of cholesterol/cal with or without alfalfa meal, or a diet consisting entirely of monkey chow. a decrease in ...197898169
ultrastructure and cytochemical localization of laccase in two strains of leptosphaerulina briosiana (pollaci) graham and luttrell.substrate specificity tests were used to identify the presence of laccase in two strains of leptosphaerulina briosiana (poll.) graham and luttrell, an ascomycete which causes leaf spot in alfalfa. cytochemical localization of monophenol monooxygenase (laccase) as well as the ultrastructures of the two strains were investigated. laccase was observed in the outer layers of the cell walls of both strains. the ultrastructures of vegetative hyphae of both strains were typical of those found in most a ...1979104971
3'-terminal nucleotide sequence of alfalfa mosaic virus rna 4.the sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus rna 4, the messenger for the viral coat protein, has been elucidated. a fragment containing the 3' terminus of the rna was obtained by mild digestion with rnase t1. the primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of rna sequencing techniques. the sequence is completely extracistronic and is believed to contain the binding sites for the viral coat protein and replica ...1979108677
formation of ribosome-rna initiation complexes with alfalfa mosaic virus rna 4 and rna 3.rna 4 of alfalfa mosaic virus (amv) is a monocistronic messenger for the coat protein. we have determined the sequence of the 40 +/- 2 nucleotides in rna 4 that were protected in the initiation complex formed with wheat germ 80 s ribosomes from digestion by t1 or pancreatic ribonucleases. the aug coat protein initiation codon was near the middle of this protected region. we have found two ribosome-binding sites in rna 3. the principal one, near the 5' end, is the initiation site for the major tr ...1979114984
complete sequences of the ribosome recognition sites in vesicular stomatitis virus mrnas: recognition by the 40s and 80s complexes.nucleotide sequences of the ribosome-protected translation initiation sites from the vesicular stomatitis virus (vsv) m and l protein mrnas have been determined, completing the sequences of the sites from all the vsv mrnas. a low level of protection at two internal aug-containing sites in the n mrna is also described. small homologies are evident among some of the sites, but there are no obvious features common to all the sites other than a single aug codon. in contrast, a large homology between ...1978208778
[inoculation of vicia sativa l. and medicago sativa l. with rhizobium in the soil of the colorado river in the bonarense valley]. 1977284548
performance of animals fed crop residues.ruminants can utilize crop residues as sources of energy, but productivity is low because of the high level of cell walls and lignin. chemicals, especially sodium hydroxide, have been used to increase the digestibility of crop residues. hemicellulose is solubilized and the extent and rate of cellulose and hemicellulose digestion are increased. two systems have been developed for chemical treatment. the first involves pelleting finely ground residue in combination with sodium hydroxide treatment. ...1979428577
an unrecognized dietary factor for guinea pigs associated with the fibrous fractions of plant products.the growth rate of guinea pigs was used to assess the nutritional value of plant materials and to characterize the active component(s). weanlings were fed for 28 days a purified diet based on soybean protein. addition of 10 to 20% of wood pulp improved the growth rate beyond that supported by 0 to 5%. subsequently, the basal diet contained 15% of wood cellulose. raw cabbage, ad libitum, 5% of wheat straw and 5% of mature alfalfa, collected and dried in the laboratory, increased growth rate signi ...1979430242
[changes in dna methylation in alfalfa plants infected with cuscuta and tissue differences in dna methylation of the parasite plants].the tissue-specific differences in the 5-methylcytosine (m5c) content in total dna of the parasite plant cuscuta reflexa have been found: dna from apical parts of the plant is less methylated (m5c = 4,2 mol %) as compared to the dna from haustoria and posthaustorial regions (m5c = 5,4 mol %). the base compositions of total dna preparations from c. reflexa grown on various hosts are similar. the m5c amount in stem dna of the alfalfa plant infected with c. reflexa is by approximately 25% higher th ...1979454715
effect of dietary lactic acid on rumen lactate metabolism and blood acid-base status of lambs switched from low to high concentrate diets.two experiments were conducted with ruminally fistulated wether lambs to determine the effect of lactic acid addition to a hay diet on rumen lactate metabolism, blood acid-base status and subsequent adaptation to a high concentrate diet. in exp. 1, lambs were fed mature brome hay (h), h plus 5% (w/w) d,l lactic acid (h5l) or h plus 10% lactic acid (h10l) (three lambs per treatment) for 14 days (phase i) then switched to a 90% concentrate diet for 2 days (phase ii). in exp. 2, lambs were fed alfa ...197943326
influence of soil ph and calcium nutrition on resistance of alfalfa to bacterial and verticillium wilt.alfalfa plants of a resistant, a susceptible and a highly susceptible strains were grown in unlimed soil at ph 5.8 and in limed one at ph 6.9 and inoculated by the pathogens of vascular wilt, corynebacterium insidiosum and verticillium albo-atrum. two types of liming were performed: 1) before inoculation and 2) after inoculation. liming of the soil led to an increase in number of resistant plants. in susceptible plants the external symptoms of disease on the plant tops were delayed or alleviated ...197832703
a study of the states of aggregation of alfalfa mosaic virus protein.the states of aggregation of alfalfa mosaic virus (amv) protein have been characterized by sedimentation velocity experiments and electron microscopy. the main association product is a spherical particle with an s value of about 30s. it is highly likely that the assembly of this particle starts with dimers of the 25000 molecular mass unit resulting in an icosahedral particle made of 30 dimers. no intermediate aggregation products have been detected. the clustering pattern of the protein in the c ...197613424
nucleotide sequence of 5' terminus of alfalfa mosaic virus rna 4 leading into coat protein cistron.the sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus rna 4, the mrna for the viral coat protein, has been deduced by using various new techniques for labeling the rna at the 5' end with 32p and for sequencing the 5'-32p-labeled rna. the sequence is npppguuuuuauuuuuaauuuucuuucaaauacuuccaucaugaguucuucacaaaagaaagcuggugggaaagcugg. the aug initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat p ...1977271973
sequence homology at the 3'-ends of alfalfa mosaic virus rnas. 1979499559
physiological effects of 1,3-butanediol fed to cattle.in four trials with growing cattle we observed effects of 1,3-butanediol on rumen fermentation end products, blood components, growth rates, feed efficiency, and body composition. diets a and c contained 80% grain: 20% alfalfa pellets and 40% grain: 60% alfalfa pellets; in diets b and d, 1,3-butanediol replaced 4% of diets a and c. feeding 4% 1,3-butanediol caused no significant differences in rumen ph, volatile fatty acid ratios, blood glucose, or blood ketones. cattle fed 4% 1,3-butanediol had ...1975234485
translation of alfalfa-mosaic-virus rna 1 in the mrna-dependent translation system from rabbit reticulocyte lysates.translation of alfalfa mosaic virus (amv) rnas in the mrna-dependent rabbit reticulocyte cell-free system was examined using different rna concentrations. the pattern of products synthesized under the direction of amv rna 2, 3 and 4 was not or almost not influenced by their concentration. however, depending on the rna 1 concentration either a very large protein of mr 115,000 or a mixture of two smaller proteins, mr 58,000 and 62,000 respectively, was formed. these three proteins represent overla ...1979217681
plasma adrenocorticoid response to corticotropin in dairy cattle fed high silage diets.responses of plasma corticoids to adrenocorticotropic hormone (.32 u/kg body weight) administered during early lactation were measured in dairy cattle consuming large amounts of concentrate feeds and one of the following forage diets: alfalfa-timothy hay plus corn silage, alfalfa-timothy hay crop silage plus corn silage, or corn silage. concentrations of plasma corticoids increased to maximum in all groups within 60 to 90 min. concentrations remained at near maximum for 4 to 5 h and then decline ...1975172536
controlled test of anthelmintic activity of levamisole administered to calves via drinking water, subcutaneous injection, or alfalfa pellet premix.a controlled test of the activity of 3 formulations of levamisole, at the dose level of approximately 8 mg/kg, against naturally occurring infections of gastrointestinal parasites and lungworms was made in 24 calves allotted to 4 groups of 6 calves each. levamisole was administered to group i calves in the drinking water, to group ii calves by subcutaneous injection, and to group iii calves by feeding alfalfa pellets mixed in corn silage; group iv calves were nontreated controls. group i calves ...1975125055
fiber, lipids, and atherosclerosis.the influence of dietary fiber on lipid metabolism and atherosclerosis in animals and on lipid metabolism in man is reviewed. pectin, guar gum, and lignin lower serum and liver cholesterol in cholesterol-fed rats. agar increases liver cholesterol in rats. bran has no effect on serum lipid levels in rats or monkeys. vegetarians have long been known to exhibit cholesterol levels lower than those of comparable populations who subsist on a mixed diet. pectin and guar gum lower cholesterol levels in ...1978101075
coat protein binds to the 3'-terminal part of rna 4 of alfalfa mosaic virus.all four rnas of alfalfa mosaic virus contain a limited number of sites with a high affinity for coat protein [van boxsel, j. a. m. (1976), ph.d. thesis, university of leiden]. in order to localize these sites in the viral rnas, rna 4 tthe subgenomic messenger for coat protein) was subjected to a very mild digestion with ribonucleast t1. the ten major fragments, apparently resulting from five preferential hits, were separated and tested for messenger activity in a wheat germ cell-free system, as ...197899164
microbial transaminase activities and their relationship with bovine rumen metabolites.two each adult male crossbred cattle and murrah buffalo were fed a diet of alfalfa hay, chopped wheat straw, and concentrate mixture. total rumen transaminase activity of cattle was higher than that of buffalo. rumen protozoal fractions showed higher total transaminase activity than bacterial fractions in both ruminant species. besides generally studied glutamate oxalacetate transaminase and glutamate pyruvate transaminase, a large number of other microbial transaminases also have been detected ...1979447894
salmonellae in health foods.various health food products of different brands were purchased from stores in the metropolitan atlanta area. these foods were examined for the presence of salmonellae by fluorescent-antibody and cultural methods. included in the study were tablets of alfalfa, parsley, kelp, wheat bran, enzyme, bone meal, and vitamins. beef liver powder and tablets and granola cereal were also studied. salmonella minnesota, salmonella anatum, and salmonella derby were isolated from two of three lots of beef live ...1977563217
processing and use of crop residues including alfalfa press cake.better utilization of roughage can improve the production of red meat and dairy products. feed value of low grade roughages can be greatly increased by chemical and/or physical treatments. both alkali and ammonia treatments are already being used commercially in europe, although there is still opportunity for process improvement. in the united states, the low cost of grain and oilseeds makes the economics of processing cellulosic byproducts less desirable, but their eventual use seems inevitable ...1979428576
influence of a few coat protein subunits on the base-paired structure of 3'-terminal fragments of rna 4 of alfalfa mosaic virus.in contrast to expectation (srinivasan, s. and jaspars, e.m.j. (1978) biochim. biophys. acta 520, 237-241) differentiated thermal melting profiles and fluorescence measurements show that the coat protein of alfalfa mosaic virus has a negligible effect on the base-paired structure of isolated 3'-terminal fragments (length about 90 nucleotides) of the coat protein messenger rna (rna 4) of this virus.1979427173
secondary fermentation in the runen of a sheep given a diet based on molasses.1. the extent of conversion of acetate-carbon to carbon dioxide in the rumen of a 40 kg wether consuming 1 kg molasses/d was estimated using isotope-tracer-dilution techniques. 2. there was a high rate of conversion of acetate to co2 (6.0 g c/d) in the rumen. there were high concentrations in the rumen of methanosarcina approximately 6 x 10(9)/ml which represents a significant proportion of the rumen bacterial biomass. these organisms are usually found in mud and sludge and are capable of oxidiz ...1979427091
the utilization of chopped and pelleted lucerne (medicago sativa) by growing lambs.1. the efficiency of utilization of the dietary energy and nitrogen contained in a dried lucerne (medicago sativa cv. chartainvilliers) given either chopped (cl) or ground (1.96 mm screen) and pelleted (pl), was measured in a comparative slaughter experiment. growing lambs were given equal amounts of digestible energy in the chopped or pelleted form at each of the three planes of nutrition for a period of 100 d. 2. the initial energy, fat and protein content of both the carcass and the total bod ...1979427083
translation by escherichia coli ribosomes of alfalfa mosaic virus rna 4 can be initiated at two sites on the monocistronic message.substantial evidence is provided to corroborate our previous finding that escherichia coli ribosomes recognize two binding sites on the 5' end of alfalfa mosaic virus (amv) rna 4 [for a preliminary report see castel, a., kraal, b., kerklaan, p. r. m., klok, j., and bosch, l. (1977) proc. natl acad. sci. u.s.a. 74, 5509--5513]. translation can start at either site using acphe-trna or fmet-rna as initiator and takes place in the same reading frame along the monocistronic mrna. the size and composi ...1979389629
forage plant estrogens.forage plant estrogens occur at high levels in certain forage species. such levels are responsible for reproductive and other effects in animals. current progress regarding the chemical, metabolic, and biological effects, as well as occurrence of the several naturally occurring forage estrogens, is described. forage estrogens occur as natural plant responses to foliar and other plant diseases. their potency in animals is approximately 1/1000 to 1/10,000 that of the principal animal hormones such ...1978351201
fiber, intestinal sterols, and colon cancer.it has been postulated that dietary fiber's protective effect against the development of colon cancer, diverticular disease, and atherosclerosis may be due to the adsorption and/or dilution of intestinal sterols such as bile acids and neural sterols and their bacterial metabolites by component(s) of fiber. dietary fiber is made up of four major components-cellulose, hemicellulose, lignin, and pectin. there is evidence that hemicellulose and pectin may induce an increase in fecal bile acid excret ...1978343568
sedimentation of multicomponent viruses: evaluation of sedimentation coefficient ratios.ratios of the sedimentation coefficients for alfalfa mosaic virus components are shown to be independent of the virus concentration and the density of the solvent. different numbers of components are observed in solvents of different density. this implies that in sedimentation velocity experiments an estimate of the number of components of a multicomponent virus should involve centrifugation in solvents of different density. for some viruses, estimates of the sedimentation coefficients of indivi ...1978621136
initiation of polypeptide synthesis with various nh2-blocked aminoacyl-trnas under the direction of alfalfa mosaic virus rna 4.initiation of polypeptide synthesis in a cell-free system of escherichia coli directed by alfalfa mosaic virus rna 4 was studied by using either fmet-trna or ac-phe-trna as initiator trna. initiation with fmet-trna yielded a product that was identical to the authentic viral coat protein except that the nh2-terminal serine was preceded by fmet instead of being acetylated. when ac-phe-trna was used as initiator, the biosynthetic product was 10-12 amino acid residues longer, the extra amino acids b ...1977341161
distension of the reticulum decreased food but not water intake by sheep.the intakes of pelleted alfalfa by hungry sheep were depressed in a rectilinear manner in relation to the amount of water (0-800 ml) added to a balloon in the reticulum (p less than 0.005). since the consumption of water by thirsty sheep was not altered by these treatments, the reduction in food intake produced by distending the reticulum was a specific response. the intakes of food were not significantly affected by distending the rumen with 800 ml water in a balloon so it is possible that the ...1978624351
methane production in the rumen and lower gut of sheep given lucerne chaff: effect of level of intake.1. methane production rates were estimated simultaneously in the rumen and caecum of sheep given 200, 400, 600, 800 and 1000 g lucerne (medicago sativa) chaff/d using isotope dilution techniques. estimates were also made of volatile fatty acid (vfa) production in the rumen at each level of feeding. in all studies three to four animals were used at each level of intake. 2. production of vfa and of methane were both related to digestible energy (de) intake. regression lines for both vfa production ...1978629922
effect of dietary alfalfa, pectin, and wheat bran on azoxymethane-or methylnitrosourea-induced colon carcinogenesis in f344 rats.the effect of dietary alfalfa, pectin, and wheat bran on colon carcinogenesis was studied in female inbred f344 rats. weanling rats were fed semipurified diets containing 0 or 15% alfalfa, pectin, or wheat bran. at 7 weeks of age, all animals except controls were given azoxymethane (aom) sc at a dose rate of 8 mg/kg body weight/week for 10 weeks or methylnitrosourea (mnu) intrarectally at a dose rate of 2 mg/rat twice a week for 3 weeks. the aom-treated group was autopsied 40 weeks and the mnu-t ...1979286824
effect of dietary fiber on azoxymethane-induced intestinal carcinogenesis in rats.the effect of alfalfa, bran, and cellulose on intestinal tumor formation and fecal billary steroid levels was studied in male sprague-dawley rats given injections of azoxymethane (aom). animals received weekly injections of 8 mg aom/kg and were fed diets containing 10% fiber (wt/wt) and 35% beef fat or 20 or 30% fiber and about 6% beef fat. control animals in each instance were fed fiber-free diets. the addition of 10% fiber to the high-fat diet did not significantly reduce the intestinal tumor ...1979285283
effect of alfalfa and dietary fiber on the growth performance of weanling rabbits.the addition of 10%, 20%, 30%, and 40% sun-cured alfalfa meal to a high-energy, low-fiber, basal diet for weanling rabbits gave increased average daily gains as compared to gain on the basal diet. deaths from enteritis complex occurred only at the 0% and 10% alfalfa levels. when 2.5%, 5%, 7.5%, and 10% alfalfa meal were used, the average daily gains were numerically higher for all alfalfa-fed groups than for the basal diet. maximum gains were achieved at the 20% alfalfa level. alfalfa extracted ...1978642436
isolation of viral double-stranded rnas using a licl fractionation procedure.a general procedure for the isolation of virus-specific double-stranded rna (ds-rna) is discribed. the procedure is based on the differential solubility of different types of nucleic acids in licl. principal advantages over conventional methods are simplicity, avoidance of enzymatic treatment, and relatively good yields of undegraded ds-rna while permitting separation of several main groups of cellular and viral nucleic acids from the same batch of tissue. the method has been successfully applie ...1978643823
ammonia assimilation by rhizobium cultures and bacteroids.the enzymes involved in the assimilation of ammonia by free-living cultures of rhizobium spp. are glutamine synthetase (ec. 6.o.i.2), glutamate synthase (l-glutamine:2-oxoglutarate amino transferase) and glutamate dehydrogenase (ed i.4.i.4). under conditions of ammonia or nitrate limitation in a chemostat the assimilation of ammonia by cultures of r. leguminosarum, r. trifolii and r. japonicum proceeded via glutamine synthetase and glutamate synthase. under glucose limitation and with an excess ...1975234505
effects of interactions between different culture fractions of 'phosphobacteria' and rhizobium on mycorrhizal infection, growth, and nodulation of medicago sativa.interactions between cell-free culture supernatants, cells, and the whole cultures of rhizobium and phosphobacteria with endomycorrhizal fungi and their effects on growth and nutrition of medicago sativa grown in a low-phosphate soil were studied. a satisfactory nodulation was greatly dependent on the mycorrhizal symbiosis. cell-free supernatants of rhizobium and phosphobacteria improved plant growth, nodulation and mycorrhiza formation. the activity of phosphobacterial culture seemed to be due ...1978657005
[actinomycetes antagonistic to fungi and not affecting rhizobium meliloti].the effects of 481 actinomycetes isolated from agricultural soils supporting good growth of alfalfa or clover on two efficient strains of rhizobium meliloti a2 and s14 were studied. strain a2 was inhibited by 28% of the isolates and strain s14 was inhibited by 31% of them. no significant difference was found between the resistance of both actinomycete strains. the effects of the 288 isolates not affecting r. meliloti on six fungi were also studied. the most sensitive fungus was stemphylium sarci ...1978657008
[changes in the digestibility of constituents of the diet in the rabbit].fiber digestibility of two diets (the first based on alfalfa dried, the second based on beet-pulp dried) with the same level of crude fiber and crude protein was measured on rabbits of 6, 7, 11, 13 and 17 weeks old. the age has no significative effect on digestibility (dry matter, organic matter, crude fiber) of the two experimental diets. the quantity of cellulose and hemicellulose digested was greater in rabbits on the pulp diet. independantly of the diet hemicellulose is more digestible than ...1978153189
response of lactating cows to 300 mg of supplemental vitamin e daily.ten holstein cows in mid-lactation which had been fed only stored feeds for several years were paired on milk production. one cow from each pair was assigned to either the control or group treated with supplemental vitamin e for a 12-wk experiment. all cows were fed 3 kg alfalfa-brome hay, corn silage ad libitum, and concentrate at 1 kg/3 kg milk produced daily. this ration provided about 500 mg of vitamin e (total tocopherols) daily. five cows were fed an additional 300 mg vitamin e daily as d- ...1979457983
energetics of the thermal transitions of rna 1 and rna 4 of alfalfa-mosaic virus in the presence and absence of coat protein. 1979456342
anthelmintic efficacy of oxfendazole in calves.oxfendazole, methyl [5-(phenylsulfinyl)-1h-benzimidazol-2-yl]carbamate given to calves at dose level of 2.5 mg/kg as a paste, as a bolus, or as a drench resulted in excellent (97 to 100%) anthelmintic efficacy against mature ostertagia ostertagi, trichostrongylus axei, cooperia oncophora, c mcmasteri, c pectinata, c punctata, nematodirus helvetianus, trichostrongylus longispicularis, chabertia ovina, and oesophagostomum radiatum. against the early 4th stage larvage of o ostertagia and n helvetia ...1978567947
factors affecting the voluntary intake of food by sheep. 1. the role of distension, flow-rate of digesta and propulsive motility in the intestines.1. twelve sheep fitted with abomasal cannulas were given ad lib. access to a diet of chopped lucerne (medicago sativa) hay to a ascertain if the amount of digesta being transported by the intestines was limiting intake. if this was the situation, pumping a solution of the bulk-laxative methylcellulose (100 g/kg; mc) into the abomasum should have reduced intake in proportion to the mass of digesta attributable to the mc and associated water. in preliminary experiments faecal water and wet matter ...1978698171
bacteriological survey of sixty health foods.a bacteriological survey was performed on 1,960 food samples encompassing 60 types of health foods available in the baltimore-washington, d.c., metropolitan area. no consistent bacteriological distinction (aerobic plate counts, total coliform and fecal coliform most probable numbers) was observed between foods labeled as organic (raised on soil with compost or nonchemical fertilizer and without application of pesticides, fungicides, and herbicides) and their counterpart food types bearing no suc ...1979572198
factors affecting the voluntary intake of food by sheep. 2. the role of distention and tactile input from compartments of the stomach.1. sheep equipped with rumen and abomasal cannulas were given ad lib. access to ground and pelleted lucerne (medicago sativa) hay except for periods of up to 6 h immediately before experimental sessions in which food intake was measured while various stomach compartments were either distended or subjected to tactile stimulation from a probe. 2. inserting a probe, consisting of two collapsed balloons tied onto the end of a polyethylene tube, into the reticulum depressed intake by 24% after 30 min ...1979508706
high pressure liquid chromatographic determination of cantharidin, using a derivatization method in specimens from animals acutely poisoned by ingestion of blister beetles, epicauta lemniscata.experimental animals (rabbit, rat, goat, sheep, and pony) were given cantharidin or dried preparations of blister beetles (epicauta lemniscata) to stimulate naturally occurring toxicosis in which beetles were ingested with alfalfa hay. a sensitive high-pressure liquid chromatographic method, involving derivatization of cantharidin with p-nitrobenzyloxyamine, was developed to detect the toxin extracts of ingesta, fluids, and tissues from these severely poisoned animals. urine and ingesta from the ...1979517823
the primary structure of the coat protein of alfalfa mosaic virus strain vru. a hypothesis on the occurrence of two conformations in the assembly of the protein shell.the complete primary structure of the coat protein of strain vru of alfalfa mosaic virus (amv) is reported. the strain is morphologically different from all other amv strains as it contains large amounts of unusually long virus particles. this is caused by structural differences in the coat protein chain. the amino acid sequence has mainly been established by the characterization of peptides obtained after cleavage with cyanogen bromide and digestion with trypsin, chymotrypsin, thermolysin or st ...1979520317
coat protein polymerization of alfalfa mosaic virus strain vru. 1978712854
passage of feed through the adult rooster.five experiments were made to measure the time required for feed residues to clear the alimentary canal. the cumulative production of excreta dry matter was the primary criterion of measurement although attempts were made to adopt a stained particle technique. the latter was confounded by the production of metabolic and endogenous wastes. when full-fed adult roosters were taken off feed the residues within their alimentary canals were voided within 24 hr. subsequent experiments involved placing ...1979530908
nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus rna 4 and its homology with the genomic rnas.a 226-nucleotide fragment was derived from alfalfa mosaic virus rna 4 (almv rna 4), the subgenomic messenger for viral coat protein, and its sequence was deduced by in vitro labeling with polynucleotide kinase and application of rna sequencing techniques. the fragment contains the 3'-terminal 45 nucleotides of the coat protein cistron and the complete 3'-noncoding region of 182 nucleotides. the total length of rna 4 was calculated to be 881 nucleotides. almv rnas 1, 2 and 3 were elongated with a ...1979537914
experimental atherosclerosis in rabbits fed cholesterol-free diets. part 7. interaction of animal or vegetable protein with fiber.rabbits were maintained for 10 months on a semipurified, cholesterol-free atherogenic regimen. all diets contained sucrose (40%) and hydrogenated coconut oil (14%). the protein (25%) was either casein or soya protein and the fiber (15%) was either wheat straw, alfalfa, or cellulose. within either protein group the order for induction of cholesteremia was cellulose=wheat straw greater than alfalfa. for atherogenesis, the effect was cellulose greater than wheat straw greater than alfalfa soya-whea ...1977558766
effect of alfalfa saponins on intestinal cholesterol absorption in rats.five to 20 mg of saponins obtained from alfalfa tops or roots were introduced intragastrically in rats also receiving oral and intravenous ring-labeled cholesterol. the saponins were tested before and after partial acid hydrolysis. absorption of cholesterol was determined by estimation of fecal sterols and by a dual isotope technique involving assay of plasma radioactivity. alfalfa top saponins (nonhydrolyzed) reduced absorption of cholesterol. acid hydrolysis of alfalfa top or root saponins enh ...1977563169
calcium-containing crystals in alfalfa: their fate in cattle.the fate of crystals in the parenchymatous sheaths around vascular bundles in alfalfa leaves was followed through the bovine digestive tract by scanning electron microscopy. the bundle and sheath pass from the rumen largely intact. most crystals are released from the bundle sheath postruminally. in feces, some crystals appear partially eroded and others are intact. by energy-dispersive x-ray analysis calcium is the primary crystal cation. intact cyrstals isolated from alfalfa leaves by low-tempe ...1979457993
integrated pest management in the u.s.: progress and promise.in the u.s., where heavy use of insecticides has been commonplace for years, the development of proper integrated insect pest control cannot get underway unless there is a changed use pattern for such chemicals. a changed use pattern, however, cannot be accomplished without much study to establish the requirements for integrated control for each major crop situation. in this paper recent developments in a number of crop areas in the u.s. in which the necessary study has been begun are reviewed. ...1976789064
microbial fermentation of rice straw: nutritive composition and in vitro digestibility of the fermentation products.rice straw was fermented with cellulomonas sp. and alcaligenes faecalis. microbial cells and undigested residue, as well as chemically treated (naoh or nh4oh) and untreated straws, were analyzed for nutrient composition and in vitro digestibility. in a typical fermentation, 75% of the rice straw substrate was digested, and 18.6% of the total substrate weight that disappeared was recovered as microbial protein. the microbial cell fraction was 37% protein and 5% crude fiber; the residue was 12% pr ...1975804853
comparative effects of alfalfa saponins and alfalfa fiber on cholesterol absorption in rats.intestinal absorption of cholesterol was measured in control rats fed semipurified diets and in rats fed alfalfa meal, in which saponins had been previously extracted, or this extracted material plus alfalfa saponins. a dose of 2 mg radioactive cholesterol was administered intragastrically, and fecal excretion of labeled neutral steroids measured. absorption of cholesterol was about 76% in control animals, and about 47% in alfalfa-red rats. extraction of saponins from alfalfa eliminated the chol ...1979474470
effects of feeding cull domestic onions (allium cepa) to sheep.twenty crossbred panama yearling ewes were used to determine the effects of feeding cull onions (allium cepa) to sheep. ten test ewes were fed onions free choice with supplemntal alfalfa hay and grain, whereas ten control ewes were fed only alfalfa hay and grain. anemia developed within 3 weeks in the test ewes, but was not seen in the controls. all ewes remained clinically normal during the study. onions were fed for about 130 days. recovery of the erythrocyte system began before the end of the ...1979475092
influence of diet composition on hepatic lipid accumulation and hemorrhages in caged layers.four experiments were conducted with commercial strains of white leghorns. experimental corn-soy diets with (csw) and without (cs) minor feed ingredients significantly elevated liver and plasma lipids when compared to a standard layer diet (uga) used at the university of georgia. the response was not due to difference in vitamin and mineral premix or level of energy and protein in the diets. inclusion of 5% alfalfa in a low protein (13.5%) diet with energy and amino acid profile similar to diet ...1978674074
comparison of nucleic acid content in populations of free-living and symbiotic rhizobium meliloti by flow microfluorometry.populations of symbiotic rhizobium meliloti extracted from alfalfa nodules were shown by flow microfluorometry to contain a significant number of bacteroids with higher nucleic acid content than the free-living rhizobia. bacteroids with lower nucleic acid content than the free-living bacteria were not detected in significant quantities in these populations. these results indicate that the incapability of bacteroids to reestablish growth in nutrient media may not be caused by a decrease in nuclei ...1977838682
adsorption of bile salts from aqueous solution by plant fibre and cholestyramine.1. adsorption of bile salts by dietary fibre is believed to promote their excretion and hence to reduce the serum cholesterol level in man and experimental animals. 2. we have tested a number of plant fibre fractions and other related materials for their ability to adsorb bile salts from aqueous solution. the "insoluble" plant fractions were from "dry grain" (a residue from brewing), apple, wheat bran, lucerne (medicago sativa), soya beans, mung beans (phaseolus mungo), chick peas (cicer arieti ...1978698168
influence of a few coat protein subunits on the base-paired structure of the rna species of alfalfa mosaic virus.differentiated thermal melting profiles were made of all the three rna species (rnas 1, 2 and 3), constituting the genome of alfalfa mosaic virus and of the subgenomic coat protein messenger rna (rna 4) of this virus. whereas all profiles showed multiphasicity the profile of rna 4 was most clearly subdivided showing three clear transitions with tm values of 25.5, 35.5 and 53 degrees c. the first transition disappeared upon addition of 6 coat protein molecules per molecule of rna 4. the effect of ...1978698231
influence of dietary protein concentration on milk production by dairy cattle during early lactation.in a 3 x 2 factorial experiment 75 holstein cows in first, second, or third lactation were fed rations containing either 12.2% or 16.2% crude protein in total ration dry matter. on the average, 26% of dry matter intake was from corn silage, 22% from alfalfa-grass hay, and 52% from a grain mix. protein was controlled by feeding a 13.7% crude protein grain mix with 1.4% urea for the 12% ration and a 19.8% crude protein grain mix with natural protein for the 16% ration. average daily milk productio ...1978568636
dietary fiber and lymphatic absorption of cholesterol in the rat.the indirect effects of short-term (3-day) feeding of several types of dietary fiber and nonnutritive materials on the subsequent absorption of cholesterol has been investigated in thoracic duct cannulated rats. absorption was studied at timed intervals over 24 hr after duodenal introduction of a tracer dose of cholesterol at least 20 hr after the last feeding. in animals fed for 3 days with diets containing cholestryamine, bran, or cellulose, cholesterol absorption was significantly less than i ...1978707375
evaluation of myrothecium verrucaria as a nutrient source for ruminants.the soil saprophytic fungus myrothecium verrucaria was cultivated from glucose, starch, or xylan as the carbon source, and the biomass was compared with three selected feedstuffs. fungal biomass was analyzed for nitrogen, protein, lipid, water soluble fraction, hemicellulose, cellulose, lignin, and residual ash, and the in vitro dry matter disappearance was determined. the chemical composition of m. verrucaria varied with substrate. in nitrogen content, the fungal biomass was more similar to alf ...1979574520
evaluation of high protein oat forage for dairy cattle.spear, a high protein oat variety, was evaluated during 2 consecutive yr for yields of forage dry matter and for feeding value as a silage to heifers, steers, and lactating cows. in yr 1 and 2, spear yielded 7% and 13% less forage dry matter per hectare than burnett, a comparative oat variety. crude protein contents in silages were similar for varieties both years. in yr 1, holstein heifers fed high protein and medium protein oat silages gained the same amount of weight but less weight than heif ...1979575540
[studies of the tolerance and toxicity of luzern-green-meal pellets after selenium fertilization].in a feeding trial, rabbits allotted in 3 experimental groups were fed rations containing 2.09, 9.83 and 19.5 mg selenium/kg feed in the form of selenium-enriched alfalfa green meal pellets. the selenium enrichment was done by foliar application (spraying) of the 20--25 cm high plant stand with 2.5 kg seo2 per hectare in watery solution. the control animals were given normal alfalfa green meal pellets of 0.16 ppm selenium content. toxicity and lethality, tolerance limit and nutritive effect of t ...1977603402
cellulolytic cocci isolated from the cecum of guinea pigs (cavia porcellus).five strains of anaerobic, gram-variable cellulolytic cocci, belonging to the genus ruminococcus, were isolated from the cecum of a guinea pig. they differed from most previously described strains of cellulolytic ruminococci as follows. (i) lactate was the major fermentation product; lesser amounts of formate and ethanol and a trace of succinate were also produced, along with an uptake of acetate. (ii) no growth occurred at 30 degrees c; however, good growth was observed at 38 and 45 degrees c, ...1977879784
quantitative aspects of the transformations of sulphur in sheep.1. [35s]sulphate was used to obtain quantitative estimates of the transfer of sulphur between the blood, rumen and postruminal tract of four sheep given brome grass (bromus inermis) pellets or lucerne (medicago sativa) pellets at the rate of 33 or 66 g/h. sodium sulphate (0-4 g s/d) was infused into the rumen or abomasum of sheep given brome grass during four periods of 19 d and was not infused into the sheep during a subsequent period in which lucerne was given. the flow of sulphide, sulphate, ...1978619981
characterization of alfalfa-mosaic-virus protein polymerization in the presence of nucleic acid.the polymerization of alfalfa mosaic virus (amv) protein in the presence of homologous nucleic acids and a number of other natural and synthetic nucleic acids was studied. the conditions for optimal assembly were found to be ph 6.0 and low ionic strength (i = 0.1 m) at room temperature, irrespective of the type of nucleic acid. the resulting nucleoprotein particles exhibited the same structural characteristics as the virus. this information emerged from optical diffraction and computer filtering ...1978624280
calorimetric studies on the interaction of rna and coat protein of alfalfa mosaic virus. 1977891980
microbiological assay for saponin in alfalfa products.a bioassay is described for determining medicagenin-type saponin in dried alfalfa, leaf protein concentrates, and alfalfa sprouts. samples are extracted by refluxing 2 1/2 hr with 50% ethanol, ethanol is evaporated, and aliquots of an aqueous solution are added to potato dextrose agar (pda) and assayed for saponin by using the fungus trichoderma viride. the growth of the fungus on pda is compared with a standard saponin, and saponin levels are calculated by means of a slope ratio analysis.1977893316
rna-dependent rna polymerases in uninfected and in alfalfa mosaic virus-infected tobacco plants. 1977898679
molecular weights of particles and rnas of alfalfa mosaic virus. number of subunits in protein capsids. 1977911783
trifolin: a rhizobium recognition protein from white clover.a protein agglutinin, trifoliin, was purified from white clover seeds and seedling roots. trifoliin specifically agglutinates the symbiont of clover, rhizobium trifolii, at concentrations as low as 0.2 microgram protein/ml, and binds to the surface of encapsulated r. trifolii 0403. this clover protein has a subunit with mr approximately 50 000, an isoelectric point of 7.3, and contains carbohydrate. antibody to purified trifoliin binds to the root hair region of 24-h-old clover seedlings, but do ...1978630002
effect of technical grade pentachlorophenol on rumen microorganisms.the toxicity of technical grade pentachlorophenol to rumen microorganisms was tested by an in vitro fermentation procedure. rumen fluid was collected from a fistulated mature steer fed a diet of all alfalfa hay. the compound was dissolved in absolute ethanol and added in vitro at concentrations ranging from 0 to 100 ppm. digestion of cellulose and production of volatile fatty acids over 24 and 48 h of incubation was used to assess toxicity. both cellulose digestion and propionic acid production ...1978641242
analysis of alfalfa mosaic virus 17 s rna translational products. 1976945638
rumen propionate and blood glucose kinetics in growing cattle fed isoenergetic diets.the relationship between rumen propionate production and blood glucose kinetics was examined in four rumen-fistulated holstein steers fed isoenergetic amounts of 80/20 (g) and 30/70 (r) grain/chopped alfalfa hay diets at 2-hour intervals. single-injection rumen propionate and blood glucose kinetics were determined in consecutive 4-hour periods by using [6-3h]glucose intravenously then [1-14c]propionate intraruminally. rumen propionate specific activity was determined after isolation and quantita ...1978650302
effect of succulent and nonsucculent diets on rumen motility and pressure before, during, and after eating.rumen motility was measured in cattle by recording changes in rumen pressure through a rumen cannula. irrespective of diet, eating increased rumen motility and amplitude of primary rumen contractions. succulent, readily fermentable, and nonscabrous alfalfa tops fed alone or with oat hay produced a greater frequency of primary and secondary rumen contractions than oat hay fed alone. the intrarumen pressure was also greater when alfalfa tops were fed. oat hay in the diet caused primary rumen contr ...1978711961
effect of volatile inhibitors from natural and amended soils on germination of sclerotia of macrophomina phaseolina.studies on volatile soil fungistasis showed that sclerotia of macrophomina phaseolina are not sensitive to volatiles liberated by natural soils with varying ph values. soil amended with alfalfa hay (1%, w/w) liberated volatiles fungistatic to sclerotia only when the assay was performed 2 weeks or less after amendment. chitin-amended soils liberated fungistatic volatiles from 1 to 3 weeks after amendment. indirect evidence indicated that ammonia may be the active volatile in amended soil. it was ...1976963611
adsorption of bacteria to roots as related to host specificity in the rhizobium-clover symbiosis.quantitative microscope techniques were utilized to examine the adsorption of rhizobial cells to clover root hairs. adsorption of cells of noninfective strains of rhizobium trifolii or infective r. meliloti strains to clover root hairs was four to five times less than that of the infective r. trifolii strains. attachment of the rod-shaped bacteria to clover root cells occurred in a polar, end-on fashion. viable or heat-killed r. trifolii cells precoated with a clover lectin having 2-deoxyglucose ...1976970936
transfer of urea from the blood to the rumen of sheep.1. the rate of transfer of plasma urea-nitrogen to rumen ammonia was measured by infusion of 15nh4cl and [15n]urea into sheep given brome grass (bromus inermis) or lucerne (medicago sativa) pellets. urea was infused into the rumen or abomasum of two sheep given brome grass in order to increase the concentration of rumen ammonia. 2. from 6.2 to 9.8 g/d of plasma urea-n were transferred to the rumen of sheep given brome grass pellets and a measurement of 1.3 g nitrogen/d was obtained for a sheep g ...1978666998
fiber, hypercholesteremia, and atherosclerosis.epidemiological data suggest that populations subsisting on high fiber diets are free of a number of the diseases of western civilization, among them coronary heart disease. studies in animals and man show that each type of fiber exerts its own specific influence. thus, in man bran has no effect on serum lipids, but pectin lowers cholesterol levels. in animals fed atherogenic diets, alfalfa and pectin exert some measure of protection, but cellulose does not. to fully understand the mode of actio ...1978672473
modification by fiber of toxic dietary effects.there is evidence that type of diet may affect the course of chemical carcinogenesis. in experiments with acetylaminofluorene, rats maintained on stock diet exhibit fewer tumors than do rats fed semi-purified diets. rats fed stock diet augmented with high levels of sodium cyclamate (2.5-10%), amaranth (5%) or tween (15%) showed normal weight gain, whereas addition of these toxicants to a fiber-free basal diet caused severely restricted weight gain and decreased survival. the latter effect can be ...1977844613
scp production by chaetomium cellulolyticum, a new thermotolerant cellulolytic fungus.chaetomium cellulolyticum, a newly isolated cellulolytic fungus, showed 50-100% faster growth rates and over 80% more final biomass-protein formation than trichoderma viride, a well-known high cellulase-producing cellulolytic organism, when cultivated on solka-floc (a purified, predominantly amorphorous form of cellulose) or partially delignified sawdust (consisting of a mixture of hardwoods) as the sole-carbon source in the fermentation media. however, in both cases, t, viride produced much hig ...1977856325
effects of diet on growth and survival of rats fed toxic levels of tartrazine (fd & c yellow no. 5) and sunset yellow fcf (fd & c yellow no. 6).tests were conducted on the effects of diet on the response of immature male rats to massive doses of tartrazine (fd&c yellow no.5) and sunset yellow fcf (fd&c yellow no. 6). when incorporated at a 5% level in a stock diet, tartrazine and sunset yellow fcf had no grossly observable toxic effects. when fed with a purified diet, however, both tartrazine and sunset yellow fcf at 5% level in the diet resulted in a marked retardation in growth, an unthrifty appearance of the fur and death of 50% or ...1977859044
some properties of soluble proteins from alfalfa (medicago sativa) herbage and their possible relationship to ruminant bloat. 19761002920
effects of selenium and vitamin e deficiencies in lambs on hepatic microsomal hemoproteins and mitochondrial respiration.microsomal hemoprotein levels and delta-amino levulinic acid dehydrase activity were determined in livers and rate of oxygen uptake, adp:o ratios, and respiration control index were determined on mitochondria from muscle, liver, and heart of normal and white muscle diseased (wmd) lambs. wmd lambs were produced by feeding their dams either low selenium purified or alfalfa hay diets. vitamin e and/or selenium was injected in a 2 x 2 factorial treatment in the ewes fed purified diets. hepatic micro ...1977864528
monocistronic translation of alfalfa mosaic virus rnas.the four alfalfa mosaic virus rnas (respectively 24 s, 20 s, 17 s and 12 s) have been used separately as messengers in two in vitro protein synthesizing systems: wheat germ and rabbit reticulocyte lysate. in both systems a polypeptide corresponding to the translation of the entire length of the rna can be found for rnas 24 s, 20 s and 12 s, but not for 17 s rna, the translation product of which is only 35,000 daltons. the number of initiation sites has been determined for each rna by analyzing t ...1977866193
[spontaneous hosts of broad bean wilt virus. communication].of 110 plant species, grown from seeds in the vicinity of sources of broad bean wilt virus (bbwv) in 1974, exactly 50% proved to be infected by the mentioned virus within one vegetation period. obviously 54 of the species are previously unknown hosts of bbwv. they belong to the following 21 families: amaranthaceae, boraginaceae, campanulaceae, caryophyllaceae, chenopodiaceae, commelinaceae, compositae, cruciferae, euphorbiaceae, hydrophyllaceae, labiatae, leguminosae, loasaceae, papaveraceae, po ...1977878706
parasitism (trichostrongylus colubriformis and eimeria ninakohlyakimovae) in sheep: relationship between wool fiber diameter changes and feed conversion efficiency.twenty-five lambs, 5 months of age, were used to compare the infection pressure of trichostrongylus colubriformis with that of eimeria ninakohlyakimovae. effects of the parasitic infection pressure were assayed by determining body weight gains, feed conversion efficiencies, and wool fiber diameter changes (reflecting changes in protein metabolism) in lambs fed a good ration and those given a marginal diet (dehydrated alfalfa pellets). significant differences in weight grains or feed conversion e ...1977879585
[determination of the primary structure of alfalfa mosaic virus (strain s) coat protein. i. determination of the molecular weight of the protein, its amino acid composition and studies on its n- and c-terminals (author's transl)]. 1977884128
Displaying items 1 - 100 of 5189