| mycobacterium scrofulaceum infection in erythrocebus patas monkeys. | mycobacterium scrofulaceum was cultured from two of seven tuberculin reactors in a group of 12 erythrocebus patas monkeys. one monkey reacted atypically to 0.1 ml of 2.5 mg veterinary tuberculin after having shown no reaction to four previous tests administered at 2-week intervals. the reaction consisted of edema with no induration or erythema at 24 hours and was completely dissipated at 36 hours. responses to additional tests using veterinary tuberculin (2.5 mg) and mycobacterium bovis purified ... | 1979 | 108474 |
| mycobacteria isolated from exotic animals. | mycobacteria were isolated from 263 of 474 specimens submitted from captive exotic (nondomesticated) animals over a 5-year period. mycobacterium avium was isolated from 128 animals originating in 13 states and the district of columbia; serotype 1 accounted for 65 of the isolations. mycobacterium bovi was isolated from 74 animals in 7 zoos, 7 game parks, and 4 primate colonies in 1, states: mycobacterium tuberculosis was isolated from 29 animals originating 9 stats; and mycobacterium fortuitum, m ... | 1977 | 406254 |
| structural studies on the type-specific antigens and lipids of the mycobacterium avium. mycobacterium intracellulare. mycobacterium scrofulaceum serocomplex. mycobacterium intracellulare serotype 9. | | 1979 | 438184 |
| postulated sources of mycobacterium intracellulare and mycobacterium scrofulaceum infection: isolation of mycobacteria from estuaries and ocean waters. | mycobacteria biochemically and serologically similar to those isolated from humans have been found in estuaries and ocean waters in the south-eastern united states. this is consistent with the hypothesis that aerosols from these waters are one potential source of infection with these mycobacteria. | 1979 | 517862 |
| pulmonary cystic disease in ankylosing spondylitis: two cases with unusual superinfection. | two ankylosing spondylitis patients with upper lobe fibrocystic disease are reported. the occurrence of pulmonary parenchymal disease as part of the primary pathologic process in ankylosing spondylitis is now accepted as an integral part of the disease. the frequency of superinfection of cavitary lung disease with aspergillus is noted. another unusual superinfection, mycobacterium scrofulaceum, is reported. | 1978 | 721887 |
| oxidation of formate by mycobacteria of the scrofulaceum group. | intact cells obtained from mycobacterium scrofulaceum as well as from mycobacterial strains m.a6 and m.r56 isolated respectively from leprous tissues of armadillo and rat leproma and grown with glycerol as the oxidizable substrate catalyzed complete oxidation of formate. the stoichiometry of formate oxidase system yielded a value of 2 mol of co2 produced per mole of o2 or per 2 moles of formate consumed. cell-free preparations from these three strains of mycobacteria contained formate dehydrogen ... | 1978 | 747815 |
| in vitro grown mycobacterium leprae probably a member of the mycobacterium scrofulaceum species. | | 1976 | 789265 |
| [peripheral lymphadenitis caused by mycobacterium scrofulaceum in a 2-year-old child]. | | 1977 | 882342 |
| scotochromogenic mycobacteria which appear intermediate between mycobacterium avium-intracellulare and mycobacterium scrofulaceum. | | 1977 | 921070 |
| isolation and identification of mycobacteria from porcine tissues: a three-year summary. | mycobacteria were isolated from 1,591 (78%) of 2,036 porcine tissues submitted to veterinary services laboratories over a 3-year period (july 1, 1971, to june 30, 1974). the isolates were identified by biochemical and serologic tests. of the 1,547 mycobacterium avium isolates, 452 were serotype 1, 728 were serotype 2, 60 were serotyped 4, 110 were serotype 8, and 51 were serotyped 10; 36 isolates represented 11 other serotypes; 65 isolates shared antigens with more than one serotype; and 45 isol ... | 1975 | 1099946 |
| occurrence of l-forms in a case of generalized mycobacteriosis due to mycobacterium scrofulaceum. | | 1975 | 1232787 |
| does antibody to mycobacterial antigens, including lipoarabinomannan, limit dissemination in childhood tuberculosis? | serum immunoglobulin (ig) g responses to a variety of mycobacterial antigens were measured in children from the uk, in children with tuberculosis from hyderabad, india and dhaka, bangladesh, classified according to whether the disease was disseminated or localized, and in non-tuberculous controls. anti-lipoarabinomannan (lam) igg responses in uk children showed a marked trough between 6 months and 3 years coincident with the reported peak incidence of disseminated tuberculosis. geometric mean ig ... | 1992 | 1287946 |
| mycobacterial lymphadenitis in western australia. | the records of 172 patients with culture-positive mycobacterial lymphadenitis in western australia between january 1972 and december 1989 inclusive have been reviewed. of the 118 children under 7 years of age, the disease was caused by m. tuberculosis in 4%, the m. avium complex in 74% and m. scrofulaceum in 20%, whereas in the 54 adults aged 15 years and over, the same organisms were responsible for 89%, 2% and 4% respectively of their diseases. tuberculous (tbc) lymphadenitis affected mainly a ... | 1992 | 1292717 |
| identification of mycobacterium avium complex strains and some similar species by high-performance liquid chromatography. | strains of mycobacterium avium, mycobacterium intracellulare, mycobacterium scrofulaceum, mycobacterium xenopi, and mycobacterium gordonae were identified by high-performance liquid chromatography (hplc) analysis of mycolic acids as bromophenacyl esters. hplc criteria were used to develop a flow chart identification scheme, which was evaluated in our laboratory with a set of 234 strains representing five species and a hitherto undescribed species. correct identifications of m. gordonae and m. xe ... | 1992 | 1400970 |
| a simple and rapid method for the detection and identification of mycobacteria using mycobactin. | a system was developed for the identification of mycobacteria such as mycobacterium tuberculosis and m. avium, by thin layer chromatography of 55fe-labelled mycobactin. approximately 2 x 10(3) mycobacteria were detected within 24 h and little operator time or skill was required. m. avium, m. intracellulare and m. scrofulaceum were found to have lower requirements for iron than other mycobacteria and this may influence their growth in host organisms. | 1992 | 1404329 |
| activities of clarithromycin against eight slowly growing species of nontuberculous mycobacteria, determined by using a broth microdilution mic system. | mics of clarithromycin against 324 clinical isolates belonging to eight species of slowly growing nontuberculous mycobacteria were determined by using a broth microdilution system. isolates were inoculated into twofold drug dilutions in middlebrook 7h9 broth (ph corrected to 7.4) and then incubated at 30 degrees c for 7 days for mycobacterium marinum and for 14 days for all other species. the mic for 90% of the strains (mic90) was less than or equal to 0.5 micrograms/ml for isolates of mycobacte ... | 1992 | 1416891 |
| skin test reactivity to atypical mycobacteria among healthy finnish preschool children vaccinated with bcg vaccine at birth. | skin test reactivity to three mycobacterial sensitins (m. avium, m. fortuitum and m. scrofulaceum) was studied in 353 healthy children vaccinated with the bcg vaccine at birth. a significant waning of reactivity to all of the three sensitins was found to occur with increasing age. revaccination against measles, parotitis and rubella had been given to 31 (9%) of the children, all aged > 5.5 years. they had significantly larger reactions sizes, which was contrary to what was expected. children wit ... | 1992 | 1467612 |
| naturally occurring mycobacterium scrofulaceum infection in a laboratory mouse colony. | a contamination with mycobacterium scrofulaceum was experienced in a colony of balb/c-nu/nu mice. the contamination was noticed after introduction of c57bl/6 and c57bl/6. lyt l. 1 strains into facilities that kept the colony. m. scrofulaceum seemed to be spread by oral infestation and cross-contamination of fecal excretions during handling of the mice. the organisms were shed continually or intermittently into feces of weaned nu/+ and nu/nu mice of balb/c background, and were isolated from the m ... | 1992 | 1505625 |
| usefulness of skin testing with mycobacterial antigens in children with cervical lymphadenopathy. | one hundred twenty-three children with chronic cervical lymphadenopathy were skin-tested with purified protein derivative (ppd)-b (mycobacterium intracellulare), ppd-y (mycobacterium kansasii), ppd-g (mycobacterium scrofulaceum) (nontuberculous mycobacterial antigens (ntmags)) and ppd-t (mycobacterium tuberculosis). children with culture-confirmed mycobacterial disease had significantly larger reactions to ntmags and were 6 times more likely to have ppd-b responses of greater than or equal to 10 ... | 1992 | 1608681 |
| sensitivity to sensitins and tuberculin in swedish children. iv. the influence of bcg-vaccination. | bcg-vaccinated schoolchildren, 8-9 yrs of age, were simultaneously tested on separate arms with tuberculin and a sensitin. using the 6 mm cut-off they reacted in 49% to two tuberculin units purified protein derivative (ppd rt23), in 67% to 0.1 micrograms mycobacterium avium sensitin rs10, and in 58% to 0.1 micrograms m. scrofulaceum sensitin rs95. the corresponding figures for non-bcg-vaccinated schoolchildren of the same age tested at the same time were 3, 25 and 32%, respectively. the results ... | 1992 | 1612158 |
| mycobacterial diseases other than tuberculosis. | the incidence of tuberculosis in the united states declined steadily until 1985, while at the same time, for at least the past 15 years, the frequency of disease attributable to other mycobacteria increased both in actual numbers and in the proportion of the total burden of mycobacterioses. chronic pulmonary disease, lymphadenitis in children, skin and soft-tissue involvement, and infections of the skeletal system were predominant, and the principal etiologic agents were mycobacterium avium/myco ... | 1992 | 1617048 |
| mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids. | between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ... | 1992 | 1617056 |
| sensitivity to ppd tuberculin and m. scrofulaceum sensitin in schoolchildren bcg vaccinated at birth. | objective: to determine the degree of and variation in sensitivity to ppd rt 23 tuberculin and m. scrofulaceum sensitin rs 95 at school age in children bcg vaccinated at birth. design: double-testing by applying standard who mantoux tests and inspecting bcg scars. setting and participants: urban and rural schools in southwest finland, 1091 children aged 11-13 years. main outcome measures: size of tuberculin and sensitin indurations and bcg scar (mm). results: the mean size of tuberculin indurati ... | 1992 | 1643303 |
| epidemiology of infection by nontuberculous mycobacteria. mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum in acid, brown-water swamps of the southeastern united states and their association with environmental variables. | mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum (mais) organisms were isolated and identified from waters, soils, aerosols, and droplets ejected from water collected from four geographically separate aquatic environments (okefenokee swamp, ga; dismal swamp, va; claytor lake, va; and cranberry glades, wv) during several seasons. recovery of mais was significantly higher from waters, soils, and aerosols collected from the two acid, brown-water swamps located in th ... | 1992 | 1736730 |
| sensitivity to sensitins and tuberculin in swedish children. iii. sequential versus simultaneous skin testing. | the aim of this study was to determine whether simultaneous and sequential skin testing with tuberculin and sensitins give consistent results. a total of 475 8- or 9-year-old schoolchildren were skin tested sequentially, at an interval of 3 days, with ppd tuberculin and with either mycobacterium scrofulaceum or m. avium sensitin. the results were compared with those of 470 simultaneously tested children chosen from the same living area. there were no statistically significant differences between ... | 1991 | 1771677 |
| oxazolidinones, a new class of synthetic antituberculosis agent. in vitro and in vivo activities of dup-721 against mycobacterium tuberculosis. | dl-s-n-(3-(4-acetyl)-2-oxo-5-oxazolidynyl methyl) acetamide (dup-721) is an orally active representative of the oxazolidinone series of antimicrobials. at concentrations ranging from 1.5 to 4 micrograms/ml, dup-721 inhibited equally the strains of mycobacterium tuberculosis susceptible and resistant to conventional antituberculosis drugs. dup-721 inhibited m. gordonae and m. fortuitum at 3.9 micrograms/ml, m. kansasii at 1.95, and m. scrofulaceum at 15.6 micrograms/ml. it was not active against ... | 1991 | 1802533 |
| mycobacterial flora of the skin in leprosy. | the presence of mycobacteria on the skin of healthy people and in leprosy lesions has been documented previously. the present study observed the mycobacterial flora on the hands (by the hand-washing method) and fingers (by the inoculated culture medium using scraped material obtained during the preparation of slit-skin smears) in 89 untreated leprosy patients. we also evaluated the slit-skin smears from fingers for the diagnosis of leprosy. in 16 patients (17.9%) mycobacteria were cultured from ... | 1991 | 1802939 |
| [mycobacteriosis caused by mycobacterium scrofulaceum. report of 1 case]. | the case of a 71-year-old patient who had respiratory disorders for more than 11 years is reported. direct microscopy was negative in 4 sputum samples and finally, on five occasions, the culture gave rise to a strain biochemically labeled as mycobacterium scrofulaceum. the case corresponded to a mycobacteriosis. | 1991 | 1812530 |
| immunophenotypic analysis of histiocytes involved in aids-associated mycobacterium scrofulaceum infection: similarities with lepromatous lepra. | the present study reports a rare case of systemic m. scrofulaceum infection in an aids patient and analyses the inflammatory infiltrate in a lymph node by immunohistochemistry. special emphasis is put on the histiocytes. the diffuse infiltrate consists mainly of large histiocytes that contain numerous bacilli. these cells display the phenotype of mature histiocytes and in addition coexpress the antigens recognized by rfd7 and rfd9, both markers of different subsets of histiocytes which have been ... | 1991 | 1864000 |
| sensitivity to sensitins and tuberculin in swedish children. i. a study of schoolchildren in an urban area. | non-bcg-vaccinated schoolchildren (8 or 9 years of age) were simultaneously tested on separate arms with 2 iu ppd rt23 and 0.1 microgram mycobacterium avium sensitin rs10 or 0.1 microgram mycobacterium scrofulaceum sensitin rs95. none of the 2819 analysed children had any known exposure to tuberculosis. a total of 3.4% reacted with an induration greater than or equal to 6 mm to ppd rt23. half the number of children were tested with m. avium sensitin and 25.4% reacted while the remaining were tes ... | 1991 | 1882443 |
| sensitivity to sensitins and tuberculin in swedish children. ii. a study of preschool children. | non-bcg-vaccinated preschool children (4 or 5 years of age) were simultaneously tested on separate arms with a 2 iu ppd rt23 and 0.1 microgram mycobacterium avium sensitin rs10 or 0.1 microgram mycobacterium scrofulaceum sensitin rs95. none of the 762 children had any known exposure to tuberculosis. a total of 8.8% reacted with an induration (greater than or equal to 3 mm to ppd rt23 while 2% reacted with greater than or equal to 6 mm. half the children were tested with m. avium sensitin: 18.9 a ... | 1991 | 1882444 |
| [phagocytic activity of leukocytes in animals infected with m. avium and m. scrofulaceum]. | the condition of phagocytic activity of peripheric blood neutrophils in the development of tuberculosis and experimental mycobacterioses caused by such "atypical" mycobacteria, as m. avium and m. scrofulaceum was studied. in all the infection processes analysed, undulating nature of the changes in a functional activity of phagocytosing neutrophils (including their absorbing and digestive capacity) was discovered. the pathology of phagocytosis found is equally characteristic of the groups of anim ... | 1991 | 2034626 |
| [what is your diagnosis? mycobacteria infection. wound smear for mycobacteria]. | | 1991 | 2047623 |
| analysis of cellular fatty acids and proteins by capillary gas chromatography and sodium dodecyl sulphate polyacrylamide gel electrophoresis to differentiate mycobacterium avium, mycobacterium intracellulare and mycobacterium scrofulaceum (mais) complex species. | infections due to atypical mycobacteria have increased during the past 30 years. species of mycobacterium avium, mycobacterium intracellulare and mycobacterium scrofulaceum are among the most common non-tuberculous mycobacteria isolated from patients with aids or immunosuppressed. these three organisms are taxonomically closely related and identification, according to cultural characteristics and biochemical tests, is not always evident, so some of these related strains are grouped in a "mais" c ... | 1990 | 2084120 |
| polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
| [production and characteristics of monoclonal antibodies reacting with human-type m. tuberculosis]. | monoclonal antibodies to m. tuberculosis were produced by hybrid technology. they were described via enzyme immunoassay and immunoblotting. it was shown that these antibodies should be included into igg class. besides, they are oriented towards and antigen with a molecular weight of 20 kda, react with h37rv at a concentration of 12 ng/ml and with bcg at a concentration of 50 micrograms/ml and fail to react with m. intracellulare, m. scrofulaceum and e. coli. | 1990 | 2111913 |
| [tuberculosis and atypical mycobacterioses in hiv infection. results from the bonn center 1985 to 1989]. | 485 hiv-positive patients have been treated at our institution in bonn during 1985 to 1989. mycobacterial infections occurred in twelve (2.5%) hiv-positive patients. of 166 aids-manifestations according to cdc, eleven (6.6%) were mycobacterial infections. there occurred one case of miliary tuberculosis, six cases of extrapulmonary, one of disseminated tuberculosis and four cases of atypical mycobacteriosis. mycobacteriosis other than tuberculosis (mott) were caused three times by mycobacterium k ... | 1990 | 2115968 |
| acid-fast bacilli detected in umbilical codes and skins of human at cases of surgical operation. | acid-fast bacilli were detected in 13 (27%) of 49 skin samples in surgical operation under the procedures of collection of bacilli by centrifuging the filtrate of tissue homogenate through adsorbent cotton. ten specimens (20%) contained cultivable organisms, including m. simiae (9 specimens) and m. gordonae (one specimen). the other 3 specimens did not contain any cultivable organism, although microscopic observation revealed the presence of acid-fast bacilli. eight (17%) of 48 raw umbilical cod ... | 1990 | 2133037 |
| identification of various serovar strains of mycobacterium avium complex by using dna probes specific for mycobacterium avium and mycobacterium intracellulare. | reference strains of the mycobacterium avium complex (mac) belonging to serovars 1 to 28 were examined with dna probes (gen probe rapid diagnostic system for the mac; gen probe inc., san diego, calif.) specific for either m. avium or mycobacterium intracellulare. this study revealed that the earlier designations of the mac serovars, in which serovars 1 to 3 and 4 to 28 were regarded as m. avium and m. intracellular, respectively, should be revised as follows. first m. avium includes serovars, 1 ... | 1990 | 2203807 |
| epidemiology of infection by nontuberculous mycobacteria ix. evidence for two dna homology groups among small plasmids in mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum. | a 12.9 kb plasmid, pvt2, from a clinical mycobacterium avium isolate, md1, was cloned and radiolabeled for use as a dna probe to examine the relatedness of plasmids in m. avium complex. that probe hybridized with plasmids isolated from m. avium complex strains from the environment (7 of 16) and from non-acquired immunodeficiency syndrome (aids) (10 of 17) and aids (5 of 6) clinical isolates. the similarity of plasmids from the environment with those from patients supports the hypothesis that the ... | 1990 | 2221593 |
| arylsulfatase activity of mycobacterium avium, m. intracellulare, and m. scrofulaceum. | a rapid (3-h) arylsulfatase assay for cell suspensions of mycobacteria, in which p-nitrophenyl sulfate is used as the substrate, was developed. arylsulfatase activity was found in cell suspensions of representative strains of mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum grown without the substrate in either middlebrook 7h9 medium containing 0.2% (wt/vol) glucose and 0.05% (vol/vol) tween 80 or dubos broth medium, but was absent in cells grown in a low-ph, min ... | 1990 | 2223599 |
| [serotyping of strains of non-tuberculous mycobacteria]. | forty strains of mycobacteria, belonging to mycobacterium-avium-intracellulare-scrofulaceum complex, isolated from symptomatic respiratory patients, were studied. for such study, agglutination-adsorption technique was applied, using specific antisera elaborated at the "pedro kouri" institute of tropical medicine, national reference institute, with titers ranging close to 1:320. the results obtained demonstrated that the prevailing types were those of the species mycobacterium intracellulare (31 ... | 1990 | 2259778 |
| specificity and distribution of alpha antigens of mycobacterium avium-intracellulare, mycobacterium scrofulaceum, and related species of mycobacteria. | specificity of antigenic determinants in alpha antigens of mycobacterium avium, m. intracellulare, m. scrofulaceum, m. gordonae, and m. szulgai was investigated by the agar gel diffusion technique using the respective absorbed antialpha serum on a total of 225 strains classified into 13 species of slowly growing mycobacteria. the specific antigenic determinants in alpha antigen of m. scrofulaceum, m. gordonae, and m. szulgai were species specific, whereas those of m. avium and m. intracellulare ... | 1985 | 2409853 |
| production and characterization of monoclonal antibodies against specific serotypes of mycobacterium avium and the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex. | serotype-specific and mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex (mais complex)-specific monoclonal antibodies (mabs) were prepared. a series of mabs were obtained, five specific for serotype 2, three specific for serotype 4, eight against a strain of serotype 19, two specific for the mais complex, and two against a common glycolipid shared by all the mycobacteria tested so far. the serotype-specific and the mais complex-specific mabs reacted in immunoflu ... | 1989 | 2473038 |
| [cellular immunity in experimental infections caused by mycobacterium avium and mycobacterium scrofulaceum]. | the cell-mediated immunity was assessed in guinea pigs with experimental infection induced by mycobacterium avium and m. scrofulaceum. it is established that the cell immunity indices in vitro correlate with the spread and gravity of the pathological process as well as with the tension of the immunological reactivity of the organism. | 1989 | 2608008 |
| lymphadenitis due to atypical mycobacteria. | mycobacterium scrofulaceum is a group ii atypical mycobacterium commonly associated with lymphadenitis in children. an adult is described with a rapidly enlarging preauricular mass. culture of biopsied material isolated m. scrofulaceum, a rare cause of disease in nonimmunocompromised adults. m. scrofulaceum is usually resistant to multiple chemotherapeutic agents used for the treatment of tuberculosis. treatment is by surgical excision of the nodes and overlying skin. | 1989 | 2618916 |
| brain tumours in childhood in bombay: i: histopathology showing changing patterns; ii: tissue culture with light and electronmicroscopy, stressing ingestion & degradation of bacteria by glial cells in vitro. | the pathological pattern of 86 brain 'tumours' in childhood during the years 1981-85 (out of a total of 586 for all ages), showed a higher proportion of neoplasms and a much lower of tuberculomas compared to the preceding three decades. a large number of histologically unusual cases was revealed. through tissue culture of brain tumours we carried out morphological, histochemical and fine structural study of the tumour cells in vitro. the abundant presence of lysosomal acid phosphatase, in outgro ... | 1989 | 2674339 |
| [a case of mycobacterium scrofulaceum lung infection occurring in old lung tuberculosis lesion]. | a 68-year-old man was admitted because of a persistent productive cough of 6 weeks' duration and detection of acid-fast bacilli from sputum. based on chest roentgenograms and isolation of mycobacterium scrofulaceum from sputum, on admission, a diagnosis of mycobacterium scrofulaceum lung infection was made. although the organisms were resistant to 0.1 microgram/ml of inh, 2.5 micrograms/ml of eb and 10 micrograms/ml of rfp, sputum converted to negative by the use of inh (0.4 g/day), eb (0.5 g/da ... | 1989 | 2709655 |
| epidemiology of infection by nontuberculous mycobacteria. viii. absence of mycobacteria in chicken litter. | overlap in the geographic distributions of (1) higher frequencies of persons reacting to antigens prepared from the mycobacterium avium, m. intracellulare, and m. scrofulaceum (mais) group; (2) higher frequencies of isolation from natural waters and soils; (3) higher densities of farms producing broilers (chicken) in the southeastern united states raises the question of whether mais organisms occur abundantly in chicken litter (pine bark shavings containing avian fecal material) and whether litt ... | 1989 | 2729747 |
| accumulation and transport of cadmium by tolerant and susceptible strains of mycobacterium scrofulaceum. | cadmium accumulation and transport were studied in two strains of mycobacterium scrofulaceum differing in their susceptibility to cd2+ toxicity. a 10-fold excess of either zn2+ or mn2+ partially antagonized inhibition of growth by cd2+. 109cd2+ uptake by both the tolerant and susceptible strains was temperature dependent and inhibited by a 10-fold excess of either zn2+ or mn2+. there were no significant differences in either the kinetics of 109cd2+ uptake or the retention of accumulated 109cd2+ ... | 1989 | 2729929 |
| identification of cytoplasmic membrane protein antigens of mycobacterium avium, m. intracellulare, and m. scrofulaceum. | the cytoplasmic membrane isolated from representative strains of the mycobacterium avium, m. intracellulare, and m. scrofulaceum (mais) group contained approximately 20 proteins, as identified by sds - polyacrylamide gel electrophoresis. one membrane protein predominated, comprising up to 50% of the total membrane protein. this major cytoplasmic membrane protein (mcmp) had a molecular weight of 31,000 and was surface accessible based on its susceptibility to proteinase digestion. the composition ... | 1989 | 2743223 |
| mycobacterium scrofulaceum, serovar cole. | cole strains of mycobacterium, originally introduced as m. scrofulaceum serovar no. 44 and later rejected as belonging to m. avium were re-investigated and compared with well-documented strains of m. scrofulaceum. our data show that the cole serovar belongs to m. scrofulaceum and should be re-introduced as serovar no. 44 of m. scrofulaceum. | 1989 | 2765088 |
| non-tuberculous mycobacterial lymphadenitis in children. | eighty-six children (44 males, 42 females) were identified as having non-tuberculous mycobacterial lymphadenitis. the diagnostic criteria were either culture of the organism from the affected lymph node (n = 68), or, when culture was negative, a positive skin test with non-tuberculous mycobacterial antigens and negative skin test responses to tuberculin purified protein derivative (ppd) in association with typical histological features (n = 18). all children had histopathological findings of gra ... | 1989 | 2792127 |
| speciation of organisms within the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum (mais) complex based on restriction fragment length polymorphisms. | a dna probe which hybridizes to all pathogenic species of slow-growing mycobacteria has been used to identify restriction-fragment-length-polymorphisms (rflps) in bam hl digests of chromosomal dna from members of the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex. the rflp patterns so produced were found to fall into distinct categories which were representative of each of the three species. except for two doubtful isolates, strains of m. avium were found to ... | 1988 | 2907775 |
| [mycobacterium scrofulaceum pulmonary infection following aspiration of a denture bridge into the bronchus]. | | 1988 | 3073257 |
| new antibacterial drugs for the treatment of mycobacterial disease in man. | | 1988 | 3076819 |
| in vitro activity of four fluoroquinolones against eighty-six isolates of mycobacteria. | the in vitro activity of pefloxacin, norfloxacin, ofloxacin and ciprofloxacin against 86 strains of mycobacteria was evaluated by broth dilution. while mycobacterium avium, mycobacterium scrofulaceum and mycobacterium chelonae were resistant to all four antibacterials, the susceptibility of the other species, mycobacterium tuberculosis, mycobacterium kansasii, mycobacterium xenopi and mycobacterium fortuitum, depended on the antibiotic. ofloxacin and ciprofloxacin (mic90: 0.5 - 2 mg/l) were more ... | 1987 | 3125050 |
| serum antibody responses to mycobacteria in leprosy patients and their contacts. | | 1988 | 3149706 |
| ankylosing spondylitis lung disease and mycobacterium scrofulaceum. | the development of apical pulmonary fibrosis and bullous disease is a rare but well recognized extra-articular manifestation of ankylosing spondylitis (as). the fibrobullous disease is usually asymptomatic and diagnosed at an incidental radiological examination. when symptoms do develop, they are usually due to superimposed colonization or infection by bacteria, fungi or mycobacteria. only six cases of non-tuberculous mycobacterial superinfection in as have been reported. we report a patient wit ... | 1988 | 3166923 |
| [a case of mycobacterium scrofulaceum lung infection associated with giant bullae, leading to development of herpes zoster]. | | 1988 | 3373936 |
| differentiation of mycobacterium gordonae from mycobacterium scrofulaceum and mycobacterium szulgai by susceptibility to enoxacin (antimycobacterial activity of enoxacin). | | 1986 | 3467156 |
| a pseudoepidemic due to atypical mycobacteria in a hospital water supply. | we describe a pseudoepidemic due to atypical mycobacteria contaminating the water used by a pathology laboratory and bronchoscopy suite on two floors of the same hospital building. inspection of laboratory procedures revealed that contamination occurred during specimen processing in pathology and while obtaining the bronchoscopic specimens. mycobacterium gordonae, mycobacterium avium complex, and mycobacterium scrofulaceum were identified. during an eight-month period, a total of 22 (31%) of 70 ... | 1987 | 3613009 |
| [a resected case with massive hemoptysis due to mycobacterium scrofulaceum lung infection]. | | 1987 | 3656861 |
| plasmid-encoded copper resistance and precipitation by mycobacterium scrofulaceum. | a copper-tolerant mycobacterium scrofulaceum strain was able to remove copper from culture medium by sulfate-dependent precipitation as copper sulfide. such precipitation of copper sulfide was not observed in a derivative that lacks a 173-kilobase plasmid. in addition, the plasmid-carrying strain has a sulfate-independent copper resistance mechanism. | 1987 | 3662522 |
| the cell surface of mycobacterium avium-intracellulare and m. scrofulaceum: effect of specific chemical modifications on cell surface charge. | cells of representative strains of the mycobacterium avium-intracellulare and mycobacterium scrofulaceum (mais) group had mixed cationic/anionic surfaces, unlike the surfaces of other mycobacteria. the ph electrophoretic mobility curves demonstrated that all mais strains examined had a net negative mobility above ph 3.5-4.5 and a positive mobility below that ph range. based upon the ph electrophoretic mobility of cells following chemical or enzymatic treatment, it appears that the surface molecu ... | 1986 | 3736439 |
| haptenic oligosaccharides in antigenic variants of mycobacterial c-mycosides antagonize lipid receptor activity for mycobacteriophage d4 by masking a methylated rhamnose. | the simple apolar c-mycosides, i.e., structurally well-defined hydrophobic glycopeptidolipids of several mycobacterium species (see diagram below), were earlier shown to behave as receptors for adsorption of mycobacteriophage d4. this phage is usually virulent for mycobacterium smegmatis. more complex, polar c-mycosides with additional carbohydrate substituents attached solely to the deoxytalose have recently been described. they are the highly specific serotyping antigens discovered by w. b. sc ... | 1986 | 3759906 |
| skin lesions caused by mycobacterium scrofulaceum. | a 32-year-old man with systemic lupus erythematosus controlled by steroid therapy developed multifocal cutaneous abscesses caused by mycobacterium scrofulaceum. the distribution and evolution of the lesions suggested hematogenous dissemination, but he exhibited no pulmonary or other visceral manifestations of systemic mycobacterial disease. the patient completed nine months of therapy with isoniazid and rifampin, and the lesions resolved within five months of presentation. | 1987 | 3813603 |
| production and characterization of serovar-specific monoclonal antibodies to serovars 4, 8, and 9 of mycobacterium intracellulare. | serovar-specific monoclonal antibodies against mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex serovars 4, 8, and 9 were prepared. nine, four, and one monoclonal antibodies, respectively, to the serovars were prepared by the usual cell fusion technique. all nine monoclonal antibodies to serovar 4 were monospecific for their homologous serovar and reacted with several native glycopeptidolipids (gpls) and one major deacylated gpl from the homologous serovar. one ... | 1987 | 3818094 |
| utilization of nitrate or nitrite as single nitrogen source by mycobacterium avium. | twenty l-amino acids and several inorganic compounds were tested individually, as a sole nitrogen source, for ability to support the growth of mycobacterium avium lm1 serovar 1. of the amino acids tested, only l-glutamine provided nutritional support comparable to that of ammonium chloride at 1 mm. with either 1 mm potassium nitrate or nitrite substituted for ammonium chloride, similar numbers of cfu were produced. m. avium cells were grown in potassium nitrate or nitrite concentrations of 0.25, ... | 1987 | 3818923 |
| enzyme-linked immunosorbent assay of glycolipid antigens for identification of mycobacteria. | enzyme-linked immunosorbent assays which are based on species- or type-specific glycolipids antigens and in which rabbit antisera are prepared with homologous strains are capable of distinguishing among serological variants of the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex, mycobacterium chelonei subspecies chelonei and abscessus, mycobacterium simiae i and ii, mycobacterium kansasii, mycobacterium szulgai, mycobacterium xenopi, and mycobacterium fortuitu ... | 1985 | 3886692 |
| plasmid dna profiles as epidemiological markers for clinical and environmental isolates of mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum. | plasmid dna was isolated, and profiles of a variety of clinical and environmental isolates of mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum (mais) were compared to determine whether plasmid dna content would be useful as an epidemiological marker for these environmental pathogens. since plasmids are common in clinical isolates and are stable during culture and exposure to naoh, plasmid dna analysis appears to be a suitable epidemiological tool. based on the hi ... | 1986 | 3944484 |
| identification of mycobacteria by specific precipitation of catalase with absorbed sera. | cross-absorbed antisera have been prepared against catalase from reference strains of mycobacterium asiaticum, mycobacterium gordonae, mycobacterium scrofulaceum, mycobacterium simiae, and mycobacterium szulgai. a total of 61 strains of mycobacteria were grown in small volumes of liquid medium and disrupted in sealed tubes in a cup horn sonicator, and the extracts were tested by a seroprecipitation technique against each of the reference antibody preparations. all 35 strains that belonged to one ... | 1985 | 3998101 |
| isolation, identification, and structural analysis of the mycobactins of mycobacterium avium, mycobacterium intracellulare, mycobacterium scrofulaceum, and mycobacterium paratuberculosis. | methods were devised to purify the cell-associated, iron-binding compounds known as mycobactins from the closely related species mycobacterium avium, mycobacterium intracellulare, and mycobacterium scrofulaceum (i.e., the mais complex of organisms). the mycobactins from these three species showed a structure that is common to the mycobactins from all the mycobacteria examined to date. however, these mycobactins were unique in that they had more than one alkyl chain. the m. scrofulaceum mycobacti ... | 1985 | 4055700 |
| a study on mycolic acids from a scotochromogenic strain of mycobacterium scrofulaceum, p-6. | | 1974 | 4467315 |
| differentiation between mycobacterium scrofulaceum and mycobacterium gordonae by susceptibility to pyronine. | | 1972 | 4602512 |
| [pathogenic ability of mycobacterium scrofulaceum]. | | 1974 | 4618794 |
| knee arthropathy secondary to mycobacterium scrofulaceum. | | 1973 | 4685882 |
| [infection by mycobacterium scrofulaceum]. | | 1973 | 4804020 |
| swimming pool granuloma due to mycobacterium scrofulaceum. | | 1972 | 5026686 |
| thin-layer chromatography of mycobacterial lipids as an aid to classification: the scotochromogenic mycobacteria, including mycobacterium scrofulaceum, m. xenopi, m. aquae, m. gordonae, m. flavescens. | | 1972 | 5040575 |
| pulmonary mycobacterium scrofulaceum infection in a child. | | 1972 | 5059291 |
| [pathogenicity of mycobacterium scrofulaceum (author's transl)]. | | 1971 | 5163923 |
| wax d fraction of an unclassified mycobacterium strain. | wax d prepared from the p-6 strain of the scotochromogenic species of mycobacterium scrofulaceum constituted 0.3% of the dry bacilli. in the acid hydrolysates, alanine, glutamic acid, glycine, and mesodiaminopimelic acid were found as amino acid constituents. mannose, galactose, and glucosamine were detected by paper chromatography. however, arabinose could not be detected. the quantity of hexosamine was 0.2 to 0.3%. wax d of p-6 was found to be adjuvant-active, as revealed by a positive corneal ... | 1969 | 5344106 |
| on mycobacterium scrofulaceum. | | 1967 | 6063553 |
| [bacteriological studies on atypical mycobacteria isolated in japan. vii. identification of the pathogenic scotochromogens isolated in japan with mycobacterium scrofulaceum prissick et masson]. | | 1967 | 6081066 |
| structures of the typing antigens of atypical mycobacteria: a brief review of present knowledge. | the overall structures of the typing antigens from serovars in the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex have been elucidated. they are polar versions of the well-known c mycosides and have the general structure: [formula: see text]. the lipopeptidyl-o-(3, 4-di-o-me-rha) "core" is common to all serovars; however, the oligosaccharide moiety is different. detailed analyses of the oligosaccharides from selected serovars show that they contain four sugar ... | 1981 | 6176001 |
| [infections due to mycobacterium scrofulaceum--a review]. | | 1984 | 6394863 |
| mycobacterial cervical lymphadenopathy. relation of etiologic agents to age. | age-related differences in etiology were examined in 214 instances of mycobacterial cervical lymphadenopathy. in adults, mycobacterium tuberculosis was isolated from 147 lymph nodes and "atypical" mycobacteria was isolated from seven nodes. in contrast, m tuberculosis was isolated from only five nodes from children while other mycobacteria were isolated from 55 nodes. mycobacterium tuberculosis clearly preponderates as the cause of mycobacterial cervical adenitis in adults while other mycobacter ... | 1984 | 6422062 |
| comparative testing of skin reactions to ppd mycobacterins from mycobacterium tuberculosis and mycobacterium scrofulaceum in school-age children. | comparative skin tests with 2 tu ppd-rt 23 with tween 80 (prepared from m. tuberculosis) and 5 tu ppd-rs 95 with tween 80 (prepared from m. scrofulaceum) were intradermally given to a total of 1,140 7-year-old children in two towns of karviná district (340 and 255 children) and in teplice (267 children) and prague (278 children). in the two groups of karviná district children the percentages of small-sized reactions (6-9 mm) to ppd-rt 23 were 13.6 and 22.3% compared to 7.1% in teplice and 5.7% i ... | 1984 | 6443361 |
| induction of bacteriophage from members of the mycobacterium avium, mycobacterium intracellulare, mycobacterium scrofulaceum serocomplex. | bacteriophages have been induced from strains in the mycobacterium avium, mycobacterium intracellulare, mycobacterium scrofulaceum serocomplex by exposure of cultures to uv light or treatment with mitomycin c. one-sixth of the strains examined, representing all but one of the 31 authenticated serotypes, were found to possess phages lytic for a mycobacterium smegmatis indicator strain. four single-plaque isolated phages, tm4, tm9, tm10 and tm20, were purified and shown to have a similar morpholog ... | 1984 | 6470677 |
| differentiation of mycobacterial species by investigation of petroleum ether-soluble sulfolipids using thin-layer chromatography after incubation with [35s]sulfate. | the method of detecting petroleum ether-soluble sulfolipids by thin-layer chromatography after incubation with [35s]sulfate is useful for differentiation between mycobacterial species. rapidly growing mycobacteria, including two subspecies of mycobacterium chelonei, were differentiated by this method. most species of slowly growing mycobacteria were characterized by the pattern of distribution of radioactive sulfolipids in the thin-layer chromatograms. mycobacterium nonchromogenicum was clearly ... | 1984 | 6513815 |
| mycolic acid patterns of some species of mycobacterium. | representative strains of some species of mycobacterium were degraded by both acid and alkaline methanolysis. two-dimensional thin-layer chromatography was used to determine the patterns of mycolic acids and other long-chain components in these methanolysates. patterns composed of alpha-, methoxy- and ketomycolates were found in mycobacterium asiaticum, mycobacterium bovis, mycobacterium gastri, mycobacterium gordonae, mycobacterium kansasii, mycobacterium marinum and mycobacterium tuberculosis; ... | 1984 | 6517656 |
| [cervical adenitis caused by mycobacterium scrofulaceum]. | | 1984 | 6521533 |
| an improved reagent for mycobacterial nitrate reductase tests. | a new crystalline reagent for nitrate reductase tests was compared with standard liquid reagents on 437 strains of mycobacteria. the results for isolates of mycobacterium avium complex, mycobacterium kansasii, mycobacterium gordonae, mycobacterium scrofulaceum, mycobacterium fortuitum, and mycobacterium chelonei agreed 100% with the expected results. of the 177 mycobacterium tuberculosis isolates, 4 were negative by the conventional method. two of these four isolates were positive with the new r ... | 1983 | 6685134 |
| plasmid-encoded mercuric reductase in mycobacterium scrofulaceum. | a chesapeake bay water isolate of mycobacterium scrofulaceum containing a 115-megadalton plasmid (pvt1) grew in the presence of 100 microm hgcl2 and converted soluble 203hg2+ to volatile mercury at a rate of 50 pmol/10(8) cells per min. cell extracts contained a soluble mercuric reductase whose activity was not dependent on exogenously supplied thiol compounds. the enzyme displayed nearly identical activity when either nadh or nadph served as the electron donor. a spontaneously cured derivative ... | 1984 | 6693354 |
| determination of fatty acids and carbohydrate monomers in micro-organisms by means of glass capillary gas chromatography: analysis of mycobacterium gordonae and mycobacterium scrofulaceum. | trifluoroacetylated whole-cell methanolysates of four strains each of mycobacterium gordonae and mycobacterium scrofulaceum were analysed by gas chromatography, using a glass capillary column. the major chromatographic peaks were identified by mass spectrometry as derivatives of fatty acids and carbohydrates. in addition, two predominant peaks, present in chromatograms representing m. scrofulaceum, were identified as 2-octadecanol and 2-eicosanol. these secondary alcohols were not found in any o ... | 1983 | 6842180 |
| uric acid utilization by mycobacterium intracellulare and mycobacterium scrofulaceum isolates. | forty-nine human and environmental isolates of mycobacterium intracellulare and mycobacterium scrofulaceum were tested for their ability to grow on uric acid and a number of its degradation products. nearly all (88 to 90%) strains used uric acid or allantoin as a sole nitrogen source; fewer (47 to 69%) used allantoate, urea, or possibly ureidoglycollate. enzymatic activities of one representative isolate demonstrated the existence of a uric acid degradation pathway resembling that in other aerob ... | 1983 | 6863220 |
| deoxyribonucleic acid relationships between different serovars of mycobacterium avium, mycobacterium intracellulare and mycobacterium scrofulaceum. | m. avium and m. intracellulare are difficult to distinguish by means of biochemical tests and by means of numerical taxonomy. dna-dna hybridization confirms that these species are different but indicates that some serovars of m. intracellulare actually belong to the species m.avium, viz.: serovars 4, 5, 6 and 8. this corresponds to results obtained with sensitin tests on guinea-pigs. the status of strains belonging to serovar 9 is uncertain. the two strains investigated in this study were closel ... | 1983 | 6880745 |
| isolation in high frequency of rough variants of mycobacterium intracellulare lacking c-mycoside glycopeptidolipid antigens. | rough variants of serovars from the mycobacterium avium-mycobacterium intracellulare-mycobacterium scrofulaceum complex were isolated in high frequency from pellicle growth of the wild-type strains. rough morphology could be correlated with the lack of an outer cell wall sheath and its constituent c-mycoside glycopeptidolipids of both the serologically active and inactive types. | 1982 | 7061400 |
| mycobacteria of mycobacterium scrofulaceum type isolated from rat or mice lepromata are not the aetiologic agents of murine leprosy. | mycobacterial strains m.m4 and m.ey3 were isolated from a mouse leproma, respectively, on kl-1 and ogawa egg-yolk medium. strain m.m4 was scotochromogenic and produced a yellow pigment. young cultures were non-acid-fast and became acid-fast during the exponential growth phase. primary cultures of strain m.m4 did not grow on conventional culture media. however, the subcultures grown in kl-1 medium were easily subcultured in the homologous media as well as on lowenstein, sauton and dubos media. cu ... | 1982 | 7109969 |