Publications

TitleAbstractYear
Filter
PMID
Filter
mycobacteria as a possible cause of inflammatory bowel disease.mesenteric lymph-nodes from 27 patients with crohn's disease, 13 with ulcerative colitis, and 11 without inflammatory bowel disease were cultured for mycobacteria. a node from a patient with crohn's disease yielded a strain of mycobacterium kansasii. cultures from 22 other patients with crohn's disease, 7 with ulcerative colitis, and 1 control subject yielded pleomorphic organisms with the electron-microscopic appearances of cell-wall-deficient organisms. further culture and characterisation of ...197880630
search by immunofluorescence for antigens of rotavirus, pseudomonas maltophilia, and mycobacterium kansasii in crohn's disease.crohn's-disease tissue was tested by indirect immunofluorescence for antigens of rotavirus, pseudomonas maltophilia, and mycobacterium kansasii. no reactions were obtained with anti-serum to p. maltophilia and m. kansasii, and a granular fluorescence seen with rotavirus antibody was probably non-specific.197880631
cellular immunity in patients with tuberculosis caused by mycobacterium kansasii and mycobacterium tuberculosis. 197994081
radiographic manifestations of pulmonary mycobacterium kansasii infections.the radiographic characteristics of 187 pristine cases of pulmonary mycobacterium kansasii infection are reviewed. the cases were selected from a total of 309 patients with two positive sputum cultures. all but three of the 187 patients had pulmonary disease. the progenitive focus of disease almost always involved the upper lobes, the right side (72%) more often than the left (50%). upper lobe disease began posterior to the trachea in every case. only one patient had disease that originated in a ...1978104602
lymph node activation by a factor released from lymphocytes of normal mice in reaction with mycobacterium kansasii.substances which have the same properties as the previously described lymph node activating factor are released from the 4-h culture of 10 x 10(6) lymph node cells from normal non-sensitized mice and 2.5--5 x 10(6) mycobacterium kansasii cells. they increase the number of lymphocytes with nucleoli synthesizing ribonucleic acid in the popliteal lymph nodes of intact mice and give the precipitation lines with the beta- to alpha-globulin electrophoretic mobility, which are specific for the lymph no ...1979156656
[a comparison of some lipid components of the mycobacterium kansasii strains isolated from patients and sources of supply water (author's transl)]. 1979161516
[effect of cultivation conditions on some lipid components of mycobacterium kansasii (author's transl)]. 1979161868
immunotherapy of cancer with nonliving mycobacteria and cord factor (trehalose-6,6'-dimycolate) in aqueous medium.heat-killed bcg, cord factor (trehalose-6,6'-dimycolate), or killed bcg plus cord factor in aqueous medium, admixed with tumor cells and injected into the skin of guinea pigs, inhibited the growth of a hepatocellular carcinoma. intralesional administration of killed bcg or mycobacterium kansasii coated with cord factor, in the same medium, caused regression of established tumors in 48 and 45% of the treated animals, respectively.1976187785
liver disease in renal transplant recipients.significant liver disease developed in 14 patients after renal transplantation. nine patients had morphologic and functional evidence of chronic active hepatitis. in general, these patients had few symptoms of liver disease, even though the course of chronic active hepatitis was progressive. despite large doses of prednisone, cirrhosis ultimately developed in five patients. the cause of chronic active hepatitis could not be related to azathioprine or methyldopa therapy because there was no perce ...1977188393
tuberculosis due to mycobacterium kansasii.eighteen cases of tuberculosis due to mycobacterium kansasii have been described. eleven were from western australia and seven from queensland. the symptoms, x-rays and histology of the disease were indistinguishable from those due to mycobacterium tuberculosis, but the organisms were resistant to streptomycin, para-amino-salicylic (pas) and isoniazid, but sensitive to ethionamide and cycloserine, and in most cases sensitive to rifampicin and ethambutol. all 18 cases were treated with some form ...1977266899
abnormal chemotaxis in patients with cutaneous anergy.chemotaxis of polymorphonuclear leukocytes and mononuclear leukocytes was studied in six patients who had persistent cutaneous anergy. four had previous infections (three fungal and one caused by mycobacterium kansasii), one had sarcoidosis, and one had late-onset immunoglobulin deficiency. our data indicate that some patients with persistent cutaneous anergy have a combined defect of leukocyte function. lymphocytes incubated in vitro with mitogen failed to elaborate active lymphocyte-derived ch ...1977300135
the action of dapsone on a susceptible strain of mycobacterium kansasii. 1978307103
[rapid microanalysis of phtiocerol dimycocerosate, mycosides and glycerides in the petroleum ether extracts of mycobacterium kansasii and bcg tye pasteur]. 1977329895
the tween opacity test as an aid in classification of mycobacteria.the tween opacity test can be used to differentiate (1) mycobacterium flavescens from mycobacterium gordonae and mycobacterium szulgai, and (2) nonphotochromogenic strains of mycobacterium kansaii from strains of the mycobacterium terrae complex.1977335938
[effect of ozone on the phospholipid composition of escherichia coli and mycobacterium kansasii]. 1977339965
lysogeny associated with mucoid variation in mycobacterium kansasii.ten of 200 strains of mycobacterium kansasii were found to produce very mucoid growth on löwenstein-jensen medium. by electronmicroscopy these 10 strains were found to be lysogenic, whereas no phage was observed in cultures of 30 non-mucoid strains. the cultural and biochemical properties of the lysogenic strains are compared with those of non-lysogenic strains, and the morphology of the phages is described.1978401434
subclinical infection with mycobacteria in southern iran.in 50 non-tuberculous adult patients hospitalized in the pahlavi university medical center skin testing with 5 tuberculin units of purified protein derivative of mammalian mycobacterium tuberculosis (ppd-m) and equivalent amounts of antigen from mycobacterium kansasii (ppd-y) and mycobacterium gause (ppd-g), as well as 0.1 ml mumps antigen was carried out. thirty four per cent, 26 per cent and 12 per cent of the patients had induration greater than 10 mm in diameter to ppd-m, ppd-y and ppd-g res ...1977412163
a demographic study of disease due to mycobacterium kansasii or m intracellulare-avium in texas.the number of patients reported th have disease due to mycobacterium kansasii or m intracellulare-avium has increased in texas from january 1967 to december 1976, in contrast to a decrease in tuberculosis. presented is an analysis of 1,409 patients infected with m kansasii and 706 patients infected with m intracellulare-avium. the former group clustered in urban areas with more than twice the incidence compared to nonurban areas (p less than 0.001). the latter group was more diffusely distribute ...1979421546
[sensivity of mycobacterium kansaii and mycobacterium marinum to different antituberculous drugs (author's transl)].mycobacteriosis includes clinical manifestations caused by especies of the genus mycobacterium other than m. tuberculosis and m. bovis. therapy for these conditions has not been clearly sistematized as it has for tuberculosis, particularly because of the natural resistance that the etiologic agents present to a large number of antituberculous drugs. the sensitivity of m. kansasii and m. marinum to eleven tuberculostatic agents was studied in order to determine which one were best suited for trea ...1979431178
skin sensitivity of adults on the isthmus of panama to mycobacterium xenopi sensitin.a group of 106 adult panamanian men were skin tested with a standard human tuberculin (rt 23) and three sensitins prepared from atypical mycobacteria. two of the sensitins (prepared from mycobacterium kansasii and battey organism) are commonly used to detect atypical mycobacterial infections. the third (prepared from m. xenopi) had not been used in panama previously. skin sensitivity proved to be significantly higher to the m. xenopi sensitin than to the others. the known epidemiology of m. xeno ...1979434302
[endemic occurrence of diseases caused by mycobacterium kansasii in the karviná industrial agglomeration]. 1979445536
water: the natural habitat of mycobacterium kansasii?it has been demonstrated that, after inoculation, mycobacterium kansasii will survive in water up to 12 months without any change in cultural or lipid characteristics. the organism failed to survive in soil. it is suggested that the natural habitat of m. kansasii is water.1979473380
a sporotrichoid-like mycobacterium kansasii infection of the skin treated with minocycline hydrochloride.a sporotrichoid-like mycobacterium kansasii infection of the skin is reported. this is the fifth reported case in the english literature of dermatological manifestations of a m. kansasii infection and the first reported case of a response to minocycline hydrochloride therapy.1979475991
granulomatous synovitis: the role of atypical mycobacteria.clinical data on 25 patients with granulomatous synovitis and bursitis observed from 1970 through 1977 are reviewed. the lesions occurred about the extremities, the wrists and hands being involved most often. with three exceptions, the patients had no significant underlying disease. the lesions were chronic and often followed minor trauma. many patients had had prior surgery, steriod injections, or both. at the time of surgery for the synovitis, the gross appearance proved to be relatively chara ...1979542760
photochromogenic and scotochromogenic mycobacteria: their clinical significance.in the period 1973--1977, mycobacterium tuberculosis was isolated by cultivation in 4408 cases from the clinical specimens of patients with positive x-ray findings. on the basis of atypical colony morphology or pigment formation, 263 other mycobacterial strains were identified: of these 23 were photochromogenic and belonged to mycobacterium kansasii. the strains were cultured on several occasions from the specimens of 4 patients with broncho-pulmonary mycobacteriosis. the strains were resistant ...1979543456
granulomatous prostatitis. association with isolation of mycobacterium kansasii and mycobacterium fortuitum. 1977576944
the disease due to mycobacterium kansasii in japan (author's transl)]. 1977599778
[the stratified tuberculoma caused by mycobacterium kansasii with cavitation (author's transl)].report on a 39 years old female textile worker with an acute cavity. m. kansasii was repeatedly isolated by cultivation from the sputum. the patient became negative by treatment with inh, sm, pas, ethionamide, but the cavity persisted. therefore seven months after the onset of the disease the left upper lobe was resected. a colliquative stratified tuberculoma and some lesions of caseated bronchitis and peribronchitis were found in the neigh bourhood. clusters and microcolonies of m. kansasii cou ...1977613551
[stefansky's serodiagnosis and ulcerative and mutilating acropathy (author's transl)].systematic stefansky's serodiagnostic test in the course of ulcero-mutilating acropathia reveals a frequent positivity (25/30 patients). superinfection by atypical mycobacterium of telluric extraction is considered. a delayed hypersensibility to several mycobacterium antigens is proved to mycobacterium kansasii, johnei, balnei. perhaps, the same type of infection might exist in the course of chronic leg ulcers.1978686616
combined vs. single-drug studies of susceptibilities of mycobacterium kansasii to isoniazid, streptomycin, and ethambutol.the effects of combined drugs were compared uith the effects of single drugs in vitro against mycobacterium kansasii. the single drugs isoniazid 1.0 microgram/ml, streptomycin 2.0 microgram/ml, and ethambutol 5.0 microgram/ml and the combinations of 1.0 microgram/ml isoniazid and 2.0 microgram/ml streptomycin, 1.0 microgram/ml isoniazid and 5.0 ethambutal and 1.0 microgram/ml isoniazid, 2.0 microgram/ml streptomycin and 5.0 microgram/ml ethambutol were evaluated as to their effects on m. kansasi ...1978717288
musculoskeletal infections due to mycobacterium kansasii.mycobacterium kansasii musculoskeletal infections are unusual. the infection presents as either a tenosynovitis, monoarticular arthritis or generalized systemic spread. in 2 patients, vigorous surgical and antimycobacterial medical regimens controlled the infection and produced full return of function.1978729292
lymphatic tissues of nude mice during early stages of mycobacterium kansasii infection. 1978729872
a co-operative numerical analysis of mycobacterium gastri, mycobacterium kansasii and mycobacterium marinum.a co-operative taxonomic study has been performed on slowly growing photochromogenic mycobacteria (runyon group i) and closely related organisms. phenetic data on 54 strains, studied in seven laboratories, were collected and analysed by numerical taxonomic methods. immunological properties and phage susceptibility patterns were analysed independently to establish correlation with numerical classification. mycobacterium gastri, m. kansasii and m. marinum appeared as distinct well-defined clusters ...1978745004
[studies on atypical mycobacteriosis with special emphasis on the disease due to mycobacterium kansasii (author's transl)]. 1978748666
a new heat-stable acid phosphatase test for mycobacteria.the heat-stable (70degrees c) acid phosphatase test performed by the method of kind and king is a simple method for differentiating mycobacterium kansasii, m. marinum, m. gastri, m. nonchromogenicum, and m. triviale from other slowly growing mycobacteria, and m. fortuitum from other rapidly growing acid-fast bacilli.1976788568
mycobacterium kansasii arthritis of the knee joint.mycobacterium kansasii infection of the knee joint was diagnosed in an 11-year-old boy on the basis of skin testing to atypical mycobacteria, and a positive culture from a synovial tissur biopsy. appropriate antituberculose drugs shoud be institute as sole treatment if no bony destruction is present. ifthere is no response to chemtherapy, synovectomy should be performed.1977855843
pulmonary disease associated with mycobacteria other than tubercle bacilli in miners.five patients with lung disease caused by mycobacteria other than tubercle (mott) bacilli are described. mycobacterium kansasii was the causative organism in 4 patients and m. scrofulaceum in 1 patient. the species were repeatedly isolated from sputum specimens cultured on löwenstein-jensen medium. the clinical features, mycobacterial isolations, bacteriological properties of the pathogens and the therapeutic problems encountered are discussed.1977877805
temperature relationships in mycobacterium kansasii: correlation between heat inactivation of protein synthesis and thermal death.the temperature relationships of mycobacterium kansasii were investigated. the optimal temperature of growth of these bacteria was between 37 and 38 degrees c, and their thermal death point was about 70 degrees. the temperature characteristic of growth of m. kansasii was about 23,400 cal.mole-1. experiments on the effect of temperature on protein synthesis showed that the temperature and time relationships required to complete and irreversibly inactivate protein synthesis correlated with thermal ...1976952439
spleno-hepatic tuberculosis due to mycobacterium kansasii.a case of tuberculosis of the spleen and liver is described. the organism involved was mycobacterium kansasii, one of the atypical mycobacteria. the lack of evidence in the literature of primary splenic or hepatic involvement by this organism suggests that it is rare. in this instance it complicated a case of myeloproliferative disease, megakaryocytic myelosis with extra-medullary haemopoiesis, and was not diagnosed until autopsy.1976979821
disseminated mycobacterium kansasii infection complicating hairy cell leukemia.mycobacterium kansasii was isolated from the spleen of a patient with ""hairy cell leukemia'' (hcl) who had caseating necrosis in the spleen and in the liver. the disseminated infection in this patient suggests a cellular immunity deficit. despite intensive investigations, the nature of the cell of origin in hcl remains unknown.1976989541
pulmonary tuberculosis following successful treatment of pulmonary infection with mycobacterium kansasii.a case of pulmonary tuberculosis following successful treatment of pulmonary infection with mycobacterium kansasii is presented. the immunizing effect of an infection with m kansasii and and other nonspecific immune factors are discussed.19761001062
acquired resistance to rifampicin by mycobacterium kansasii.two patients with mycobacterium kansasii infection of the lung had organisms sensitive to rifampicin. following treatment, essentially with rifampicin alone, the patients began to excrete organisms completely resistant to rifampicin. the ability of m. kansasii to acquire resistance to rifampicin during treatment has been clearly demonstrated. this reinforces the need to treat this infection with an adequate multiple drug regimen.19761014109
disseminated mycobacterium kansasii infection presenting as cellulitis in a recipient of a renal homograft.a recipient of a renal homograft developed disseminated infection caused by mycobacterium kansaii. he initially presented with cellulitis and abscesses in one foot, and was thought to have a pyogenic bacterial infection. the daily administration of prednisone and azathioprine appears to have prevented the typical cell-mediated granulomatous reaction to mycobacterial infection and to have contributed to the patient's atypical inflammatory response. a switch to alternate-day prednisone combined wi ...19751096693
growth and immunogenicity of photochromogenic strains of mycobacteria in the footpads of normal mice.specific pathogen-free cd-1 mice were infected subcutaneously in the footpad with mycobacterium kansasii, three strains of m. marinum, and two strains of m. simiae-habana, and the growth of the organisms in the footpad, the draining popliteal lymph node, and the lung and spleen was followed quantitatively for up to 60 days. the ability of a footpad inoculum of m. marinum to spread to the lungs and spleen correlated with the ability of the organism to survive and multiple at 37 c in vitro culture ...19751123253
the course of untreated mycobacterium kansasii disease.four patients with mycobacterium kansaii pulmonary infection were followed without treatment for 10 to 14 years after diagnosis. although spontaneous resolution of active disease occurred 5 years after diagnosis in one patient, slowly progressive disease in the absence of significant symptoms was documented in 3 patients during a 12-to-14-year follow-up period. administration of antituberculous drugs resulted in rapid resolution of signs of active disease in these patients. these observations ad ...19751124888
mycobacterium kansasii tendinitis and fasciitis. report of a case treated successfully with drug therapy alone. 19751141273
response to chemotherapy of pulmonary infection due to mycobacterium kansasii.chemotherapy of pulmonary disease due to mycobacterium kansaii has not always been successful, and resectional surgery has been used frequently in the treatment of this infection. to ascertain the impact of new antimicrobial agents on the treatment of m. kansaii infection, we reviewed the clinical courses of 59 patients treated between 1971 and 1974. over-all, 92 per cent of patients converted their sputum cultures while receiving drugs, with only one patient undergoing surgical resection. regim ...19751147382
disseminated myycobacterium kansasii infection with pancytopenia and interstitial nephritis.disseminated mycobacterium kansasii infection associated with pancytopenia was diagnosed in a 40-year-old man found to have granulomata in kidney and liver biopsy specimens. the m. kansasii was isolated from the urine and tissue obtained by renal biopsy. serial renal biopsies and renal tissue obtained at autopsy showed severe interstitial fibrosis which was thought to represent a tissue response to the m. kansasii infection. the periportal and parenchymal fibrosis found in the liver at autopsy w ...19751147441
medical grand rounds from touro infirmary. mycobacterium kansasii, aortic stenosis and antimicrobial related hepatitis. 19751151130
phage typing of "mycobacterium kansasii", an important aid in studying its epidemiology. 19751230054
mycobacteriosis in patients with malignant disease.mycobacteriosis was found in 59 patients with malignant disease in a five-year period from 1968 to 1973. thirty patients (51%) had mycobacteriosis that was caused by atypical mycobacteria. the most frequent organisms were mycobacterium kansasii and m fortuitum. the most frequent tumors associated with mycobacteriosis were squamous cell carcinoma of the head and neck, testicular carcinoma, and lung carcinoma. the only predisposing factor was treatment with cancer chemotherapy. mortality due to my ...19761247337
mycobacterium kansasii infection in the deep structures of the hand. report of two cases. 19761249105
ventilatory defects in atypical mycobacteriosis. a comparison study with tuberculosis.two hundred thirty-two patients infected with mycobacterium kansasii and 120 patients infected with m. intracellulare who were admitted to the east texas chest hospital between 1965 and 1974 were individually matched according to age (+/- 5 years), sex, and extent of disease with an equal number of patients infected with m. tuberculosis. the ventilatory function in these patients was compared. the frequency of obstructive ventilatory defect, defined as forced expiratory volume in 1 sec less than ...19761259236
mycobacterium kansasii from an environmental source. 19761260624
mycobacterium kansasii infection with dermatologic manifestations.a patient with cutaneous lesions as a manifestation of systemic infection with mycobacterium kansasii is described. to our knowledge, this is the fourth reported case of a patient with dermatologic lesions secondary to m kansasii infection. a brief review of the classification and clinical presentations of atypical mycobacteria is given.19761275527
identification of a genetically distinct subspecies of mycobacterium kansasii.to assess the usefulness of a specific dna probe for mycobacterium kansasii, 105 isolates from australia, belgium, japan, south africa, and switzerland were collected and analyzed. twenty of these isolates were probe negative, of which 18 were from belgium and switzerland. analysis of all isolates by southern blot hybridization indicated a lack of variability among probe-positive isolates, while probe-negative isolates were clearly distinct and showed greater diversity. sequence analysis of the ...19921280644
effects of in vivo t lymphocyte subset depletion on mycobacterial infections in mice.the relative importance of cd4+ and cd8+ t cell subsets in the expression of acquired resistance to systemic infection by mycobacterium kansasii was determined. t cell subsets were depleted in thymectomized c57bl/6 mice by the intravenous administration of monoclonal antibodies directed against the relevant t cell determinants. depletion of the cd4+ subset exacerbated the severity of the infection in intravenously challenged mice. this effect was apparent in the first 2 weeks of the infection an ...19921347311
characterization of a major polymorphic tandem repeat in mycobacterium tuberculosis and its potential use in the epidemiology of mycobacterium kansasii and mycobacterium gordonae.in this study, the occurrence of repeated dna sequences in the chromosome of mycobacterium tuberculosis was investigated systematically. by screening a m. tuberculosis lambda gt-11 gene library with labeled total chromosomal dna, five strongly hybridizing recombinants were selected, and these contained dna sequences that were present in multiple copies in the chromosome of m. tuberculosis. these recombinants all contained repeated sequences belonging to a single family of repetitive dna, which s ...19921350781
typing by dna probe of mycobacterial species isolated from patients with aids.restriction fragment length polymorphism (rflp) types of mycobacterium avium intracellulare and mycobacterium kansasii isolated from patients with aids were examined. we demonstrate that one rflp type is much more common than others which confirms previous findings. carriage of individual rflp types is constant over long periods of time. in addition, we document a disseminated infection in a patient with m. avium intracellulare of three rflp types.19921361938
pyogenic abscess caused by mycobacterium kansasii in advanced aids. 19921391065
bacteriostatic and bactericidal activity of antituberculosis drugs against mycobacterium tuberculosis, mycobacterium avium-mycobacterium intracellulare complex and mycobacterium kansasii in different growth phases.bacteriostatic and bactericidal activities of rifampicin, isoniazid, streptomycin, enviomycin and ethambutol against mycobacterium tuberculosis, mycobacterium avium--m. intracellulare complex and mycobacterium kansasii were studied in different growth phases. bacteriostatic activities of the drugs were similar in different growth phases, except isoniazid. m. tuberculosis was much less susceptible to isoniazid in the lag phase than in the log and the stationary phases. in contrast, bactericidal a ...19921406364
activities of clarithromycin against eight slowly growing species of nontuberculous mycobacteria, determined by using a broth microdilution mic system.mics of clarithromycin against 324 clinical isolates belonging to eight species of slowly growing nontuberculous mycobacteria were determined by using a broth microdilution system. isolates were inoculated into twofold drug dilutions in middlebrook 7h9 broth (ph corrected to 7.4) and then incubated at 30 degrees c for 7 days for mycobacterium marinum and for 14 days for all other species. the mic for 90% of the strains (mic90) was less than or equal to 0.5 micrograms/ml for isolates of mycobacte ...19921416891
in vitro susceptibility of mycobacterium kansasii to clarithromycin.the mics of the macrolide clarithromycin for 31 clinical isolates of mycobacterium kansasii were determined by three different methods. the methods employed were the proportion resistance method on 7h10 agar, the radiometric (bactec) method, and the t100 method of datum analysis. all methods gave similar results. the mics were in a narrow range from 0.16 to 0.50 microgram/ml, with the mics for 90% of isolates tested of 0.50 microgram/ml for the agar dilution and radiometric methods and 0.37 micr ...19921416897
mycobacterium kansasii osteitis of the ischium. 19921417152
[disseminated infection caused by mycobacterium kansasii in acquired immunodeficiency syndrome]. 19921450270
mycobacterium kansasii presenting as an unusual type of rhinophyma. 19921470459
evaluation of new anti-infective drugs for the treatment of disease caused by mycobacterium kansasii and other mycobacteria. infectious diseases society of america and the food and drug administration.mycobacterium kansasii is a photochromogenic nontuberculous mycobacterium that usually causes infections of the respiratory tract in humans. although spontaneous resolution of infection has been reported, most patients require antimycobacterial therapy. a three- or four-drug combination--isoniazid, rifampin, and ethambutol and/or streptomycin--usually is prescribed. for evaluation of a new drug, a randomized, double-blind or evaluator-blinded, active-control comparative study design is recommend ...19921477246
modulation of expression of delayed hypersensitivity by mycobacterial antigen 85 fibronectin-binding proteins.although demonstration of delayed hypersensitivity to purified protein derivative of tuberculin (ppd) is an important element in the diagnosis of infection with mycobacterium tuberculosis, many patients with tuberculosis are anergic. several possible mechanisms for this specific lack of response have been described. we have now uncovered an additional one. t-cell fibronectin (fn), a lymphokine secreted by activated t cells, is closely associated with the initiation of delayed hypersensitivity re ...19921534074
disseminated coinfection with mycobacterium avium complex and mycobacterium kansasii in a patient with aids and liver abscess. 19921554855
antimycobacterial activity of a series of pyrazinoic acid esters.a series of pyrazinoic acid esters has been prepared and evaluated for in vitro antimycobacterial activity. several of the pyrazinoate esters have substantially better activity than the first-line antituberculous agent pyrazinamide against susceptible isolates of mycobacterium turberculosis as well as activity against pyrazinamide-resistant isolates. the minimal inhibitory concentrations (mics) were lower for each organism and at each ph than the mics for pyrazinamide. the esters have activity a ...19921560435
mycobacterium kansasii brain abscess in a patient with aids. 19921562675
niacin-positive mycobacterium kansasii isolated from immunocompromised patients.niacin-positive mycobacterium kansasii was isolated from three patients, two with respiratory infections and one with a perirectal abscess. the isolates were phenotypically similar to other strains of m. kansasii, differing only in their ability to produce niacin. this phenotype has been reported only twice in the literature, during the 1960s.19921583146
peritonitis caused by mycobacterium kansasii in a patient undergoing continuous ambulatory peritoneal dialysis.mycobacterium kansasii was isolated from the peritoneal fluid, peritoneal biopsy, and the tenckhoff catheter of a 62-year-old woman undergoing continuous ambulatory peritoneal dialysis (capd) who presented with the clinical picture of peritonitis. to the best of our knowledge, this is the first case of capd-associated peritonitis caused by m kansasii. routine susceptibility tests using standard concentrations of isoniazid indicated isoniazid resistance; however, the organism was inhibited in vit ...19921595710
[investigation of the cases due to mycobacterium kansasii in our hospital].a clinical study of 23 patients with mycobacterium kansasii infection of the lung encountered at national chiba higashi hospital from 1988 to 1990 was carried out. all 23 cases were male, aged from 25 to 81 years-old. diagnoses were confirmed by sputum culture. the cases consisted of 15 primary infections and 8 secondary infections. out of the 23 cases, 11 were detected by mass screening with chest x-ray findings, 10 cases were discovered when visiting the hospital because of chest complications ...19921597935
usefulness of skin testing with mycobacterial antigens in children with cervical lymphadenopathy.one hundred twenty-three children with chronic cervical lymphadenopathy were skin-tested with purified protein derivative (ppd)-b (mycobacterium intracellulare), ppd-y (mycobacterium kansasii), ppd-g (mycobacterium scrofulaceum) (nontuberculous mycobacterial antigens (ntmags)) and ppd-t (mycobacterium tuberculosis). children with culture-confirmed mycobacterial disease had significantly larger reactions to ntmags and were 6 times more likely to have ppd-b responses of greater than or equal to 10 ...19921608681
mycobacterial diseases other than tuberculosis.the incidence of tuberculosis in the united states declined steadily until 1985, while at the same time, for at least the past 15 years, the frequency of disease attributable to other mycobacteria increased both in actual numbers and in the proportion of the total burden of mycobacterioses. chronic pulmonary disease, lymphadenitis in children, skin and soft-tissue involvement, and infections of the skeletal system were predominant, and the principal etiologic agents were mycobacterium avium/myco ...19921617048
mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids.between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ...19921617056
synthesis of methyl 2,4-di-o-methyl-3-o-(2-o-methyl-alpha-l-rhamnopyranosyl)-alpha-l- rhamnopyranoside and methyl 2,4-di-o-methyl-3-o-[2-o-methyl-3-o-(2-o-methyl-alpha-l-fucopyranosyl)- alpha-l-rhamnopyranosyl]-alpha-l-rhamnopyranoside: di- and tri-saccharide segments of a phenolic glycolipid of mycobacterium kansasii.syntheses of the title glycosides are described. the critical o-glycosylations were carried out in the presence of boron trifluoride etherate with a high degree of alpha-selectivity.19921617686
[mycobacterium kansasii seroma of the skin in hiv infection].we report on an hiv-infected patient with aids in whom a smoothly demarcated area of resistance in the size of a fist was found on the inside of the thigh. investigation by sonography for clinical differential diagnosis confirmed that a haematoma, a seroma or an abscess might be present. upon puncture of the cavity, serous exudate was obtained. the microbiological investigation resulted in the growth of mycobacterium kansasii. the detection of this agent in throat and sputum samples from the pat ...19921628969
sweet's syndrome as the presenting symptom of hairy cell leukemia with concomitant infection by mycobacterium kansasii.a patient with sweet's syndrome and leukopenia is reported. hematological evaluation revealed hairy cell leukemia (hcl). the clinical picture was dominated by persistent fever, which is a common feature of both sweet's syndrome and hcl. since fever frequently reflects concomitant infection in hcl, a thorough search for infectious disease was performed. blood cultures grew mycobacterium kansasii. the patient recovered after treatment with recombinant interferon-alpha (r-ifn-alpha) and tuberculost ...19921643163
mycobacterium kansasii: a cause of treatable pulmonary disease associated with advanced human immunodeficiency virus (hiv) infection.to assess the clinical features and response to therapy of mycobacterium kansasii infection in patients with human immunodeficiency virus (hiv) infection.19911673053
identification of mycobacterium kansasii by dna hybridization.a dna probe specific for mycobacterium kansasii was obtained from a plasmid clone library of ecori-digested genomic dna. the probe specifically identified culture-confirmed isolates of m. kansasii and isolates in cultures of environmental water samples. in an attempt to distinguish between isolates of m. kansasii, we used two methods to demonstrate restriction fragment length polymorphisms in the genomic dna. both of these methods failed to detect any differences between the isolates. these isol ...19911682342
structural and immunological properties of the phenolic glycolipids from mycobacterium gastri and mycobacterium kansasii.mycobacterial species-specific antigens belong to the three following classes: phenolic glycolipids (phe gl), acyltrehalose-containing lipooligosaccharides and polar glycopeptidolipids. these antigens have been chemically defined and alkali-labile epitopes were found to characterize the lipooligosaccharide antigen type. in the present study the major mycobacterium kansasii phenolic glycolipid epitope namely phe gl k-i was delineated as the distal monoacetylated disaccharidic residue: 2,6-dideoxy ...19901691978
carbohydrate epitope structural elucidation by 1h-nmr spectroscopy of a new mycobacterium kansasii phenolic glycolipid antigen.the complete primary structure of the carbohydrate moiety of a new phenolic glycolipid antigen namely phegl k-iv from mycobacterium kansasii was successfully established from only one- and two-dimensional 1h-nmr data. among the scalar two-dimensional techniques, correlated spectroscopy with a 45 degree mixing pulse and phase-sensitive double-quantum-filtered correlated spectroscopy were selected, combined with two-dimensional dipolar techniques (nuclear overhauser effect). these techniques using ...19901699759
establishment of a foreign antigen secretion system in mycobacteria.in order to develop recombinant mycobacterium bovis bcg into a useful multivaccine vehicle, we established a foreign antigen secretion system in mycobacteria in which an extracellular alpha antigen of mycobacterium kansasii was utilized as a carrier. by using this system, a b-cell epitope (glu-12-leu-asp-arg-trp-glu-lys-ile-19) of human immunodeficiency virus type 1 p17gag, which was identified by a fusion protein-based method, has been successfully obtained from bcg along with the alpha antigen ...19901701418
mycobacterium kansasii infection in a patient with aids.we have presented the case of a 45-year-old hiv-positive man who had a 2-week history of shortness of breath and fever and who was found to have pneumonia due to an acid-fast bacillus. despite treatment with isoniazid, rifampin, ethambutol, and clofazimine, he died of the infection. culture results obtained after his death showed the organism to be mycobacterium kansasii. mycobacterial infections are common in patients with aids, but are usually due to m tuberculosis or m avium complex. of the 3 ...19911749988
cutaneous mycobacterium kansasii infection--treatment with erythromycin.a 20-year-old woman developed cutaneous mycobacterium kansasii infection following steroid infiltration of two plaques of lichen simplex. the organism was resistant to many standard antituberculous drugs and following sensitivity studies treatment with erythromycin was begun. this has been effective and well tolerated. treatment of atypical mycobacteria with drugs not traditionally associated with antituberculous activity is being increasingly reported and, so far, resistance has not been a prob ...19911794177
mycobacterium kansasii infection. 19911872499
mycobacterium kansasii infections in western australia (1962-1987).the records of 81 patients with isolations of mycobacterium kansasii in western australia over 26 years have been reviewed. thirty-nine individuals with 40 episodes of infection were considered to have disease due to m. kansasii: 36 in the lungs (90%), two in the joints (5%), and one each in the skin (2.5%) and the lymph nodes (2.5%). the average incidence rate per 100,000 per year was 0.14 for the state with the highest in the geraldton mid-west region (0.57). the male:female ratio was 4:1 and ...19911882111
enzyme-linked immunosorbent assay using monoclonal antibodies for identification of mycobacteria from early cultures.a simple enzyme-linked immunosorbent assay (elisa) for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii has been developed (r. schöningh, c. p. h. j. verstijnen, s. kuijper, and a. h. j. kolk. j. clin. microbiol. 28:708-713, 1990). the test for the routine identification of cultured mycobacteria was introduced in five clinical laboratories located in tanzania, thailand, vietnam, and the ne ...19911909344
[study on recombinant bcg].for the purpose to establish the system to express foreign antigen from mycobacterium bovis bcg. we have cloned, sequenced and expressed genes for secreting proteins, alpha antigen, mpb64, mpb57 and mpb70 from m. bovis bcg. the upstreams and structural genes were characterized. the gene for alpha antigen of mycobacterium kansasii was also characterized. the gene for alpha antigen of m. kansasii (k-alpha) was chosen for the further study at first. this gene was fused with shuttle plasmid pij666-p ...19911942733
[studies on the nontuberculous lung mycobacteriosis in japan. (report of the study in the year 1987 and 1988 of the mycobacteriosis research group of the japanese national chest hospitals)--pulmonary infection caused by mycobacterium kansasii has begun to appear in all over japan including north japan hokkaido].in this study, the mycobacteriosis research group of the japanese national chest hospitals (mrg) presents the reports of study years 1987 and 1988. as reported previously**, pulmonary infection caused by mycobacterium kansasii occurred principally in south-west japan (prefectures south-west of tokyo) and did not appear in north japan. however, this disease appeared in 1987 and 1988 in hokkaido (sapporo hospital). accordingly, we may say the disease occurs all over japan. this is a noteworthy fin ...19911960913
mycobacterium kansasii infections in patients positive for human immunodeficiency virus.the experience with mycobacterium kansasii infections in patients who are infected with human immunodeficiency virus (hiv) at parkland memorial hospital in dallas is presented, and the literature on such infections is reviewed. the absolute and relative paucity of reports of m. kansasii infections in hiv-positive patients is emphasized. m. kansasii infections in hiv-positive patients are classified as either pulmonary or disseminated. evidence of the lack of therapeutic response in patients with ...19911962086
the spectrum of mycobacterium kansasii disease associated with hiv-1 infected patients.louisiana is known to be an area endemic for mycobacterium kansasii (mk). since mk tends to disseminate in immunocompromised patients, one might, therefore, expect to observe an increasing number of mk infections associated with human immunodeficiency virus (hiv-1). a systematic 60-month review of clinical, microbiologic, and radiographic data associated with mk was performed from two major referral centers in new orleans. from june 30, 1983 through june 30, 1988, mk was isolated from 72 patient ...19912016689
promyelocytic leukaemoid reaction: an atypical presentation of mycobacterial infection.a young woman presented with mild pyrexia and antepartal haemorrhage due to disseminated intravascular coagulation. she had pancytopenia in the peripheral blood and granulocytic maturation arrest at the promyelocyte stage in the bone marrow. her urine and bone marrow grew mycobacterium kansasii on culture. antituberculous treatment eliminated the infection and restored the normality of bone marrow and peripheral blood.19912042448
polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis.a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ...19902109022
quantitative and qualitative studies on the major extracellular antigen of mycobacterium tuberculosis h37rv and mycobacterium bovis bcg.the mycobacterium tuberculosis antigen 85 is a biologically important antigen. tuberculosis patients may have strong antibodies against it, and their peripheral blood mononuclear cells respond to it with gamma-interferon production and lymphocyte proliferation. antigen 85 is actively secreted into the culture medium during culture in vitro and is known to bind human fibronectin. a double-antibody enzyme-linked immunosorbent assay (elisa) for quantification of antigen 85 is described. a mouse mon ...19902109556
enzyme immunoassay for identification of heat-killed mycobacteria belonging to the mycobacterium tuberculosis and mycobacterium avium complexes and derived from early cultures.a simple enzyme-linked immunosorbent assay was developed for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii. six monoclonal antibodies were used: two (f23-49 and f24-2) were specific for the m. tuberculosis complex, two (f85-2 and f85-10) were specific for the identification of the m. avium complex, one (f126-22) was specific for m. kansasii, and one (f141-3) was broadly reactive and dis ...19902110180
the mycobacteriology of pulmonary tuberculosis in south african gold miners.two bacteriological surveys of gold miners with pulmonary tuberculosis diagnosed for the first time, have shown a stable level of primary drug resistance which is substantially lower than that reported for the home areas of these men. initial drug resistance was detected in 12.7% of the 205 cultures of mycobacterium tuberculosis in 1983-1984 and in 10.7% of 253 cultures in 1988-1989. resistance to isoniazid was detected in 5.4% and 5.5% of the strains tested, to streptomycin in 6.8% and 5.1% and ...19902115216
[tuberculosis and atypical mycobacterioses in hiv infection. results from the bonn center 1985 to 1989].485 hiv-positive patients have been treated at our institution in bonn during 1985 to 1989. mycobacterial infections occurred in twelve (2.5%) hiv-positive patients. of 166 aids-manifestations according to cdc, eleven (6.6%) were mycobacterial infections. there occurred one case of miliary tuberculosis, six cases of extrapulmonary, one of disseminated tuberculosis and four cases of atypical mycobacteriosis. mycobacteriosis other than tuberculosis (mott) were caused three times by mycobacterium k ...19902115968
Displaying items 1 - 100 of 1164