| osteomyelitis caused by mycobacterium fortuitum. | a case of osteomylitis of the foot and ankle bones with subsequent complications is presented. antibiotic therapy was unsuccessful and a below-knee amputation was performed. a comparison of the various mycobacteria species and their role as etiologic agents in osteomyelitis follows. | 1977 | 15948 |
| enzymatic and immunological characterization of the mycobacterium fortuitum complex. | the arylsulfatase isozymes of mycobacterium fortuitum, m. peregrinum, m. chelonei subsp. chelonei, and m. chelonei subsp. abscessus were examined to determine the isozymal and immunological relationship among the members of the m. fortuitum complex. cell extracts were subjected to electrophoresis on agarose and polyacrylamide gel, and arylsulfatase activity was localized using beta-naphthyl sulfate as substrate. unique zymograms were produced for m. fortuitum, m. peregrinum, and m. chelonei whic ... | 1978 | 100510 |
| pericarditis due to mycobacterium tuberculosis and mycobacterium fortuitum: a case report. | in this case study, pericarditis results from mycobacterium tuberculosis and mycobacterium fortuitum. both organisms were isolated from three different clinical specimens: a pericardial fluid, pericardium, and a thoracentesis fluid. a mixed mycobacterial culture was initially suspected upon examining ziehl-neelsen stained smears prepared from the primary cultures following seven to ten days of incubation. dilutions and subcultures were subsequently performed, confirming the presence of two diffe ... | 1979 | 106725 |
| immunodiffusion studies of ribosomes in classification of mycobacteria and related taxa. | ribosomal preparations consisting of crude ribosomes (cr), 30s subunits (30s) and 16s core particles (16s) from four strains of the species mycobacterium bovis (bcg), mycobacterium fortuitum, mycobacterium phlei and mycobacterium smegmatis were analyzed by immunodiffusion technique for taxonomical purposes. the ribosomal preparations tested contained several interspecies cross-reacting precipitinogens. the number of precipitinogens demonstrated at the homologous reactions was generally larger th ... | 1979 | 109401 |
| immunodiffusion studies of various structural preparations from mycobacterial cells. | various structures and other preparations from mycobacterial cells were analyzed by immunodiffusion. the preparations were obtained from four strains referred to the species mycobacterium bovis (bcg), mycobacterium fortuitum, mycobacterium phlei and mycobacterium smegmatis. they represented cell walls (cw), culture filtrates (cf), artificially disintegrated cell material (xp), protoplasms (pp), crude ribosomes (cr), ribosomal 50s subunits (50s), ribosomal 30s subunits (30s), ribosomal 16s core p ... | 1979 | 109402 |
| [a case of subcutaneous abscess due to mycobacterium fortuitum (author's transl)]. | | 1977 | 301580 |
| a fluorigenic substrate for the rapid differentiation of mycobacterium fortuitum from mycobacterium chelonei on the basis of heat stable esterase activity. | a fluorigenic substrate, 4-methylumbelliferyl butyrate, enables mycobacterial esterase activity to be easily and rapidly detected and quantitated. by use of this substrate, the esterase activity of mycobacterium fortuitum was found to be significantly more heat resistant than that of m. chelonei. on this basis, a rapid, simple and inexpensive test for the differentiation of these two species has been developed. | 1977 | 339449 |
| mycobacteria isolated from exotic animals. | mycobacteria were isolated from 263 of 474 specimens submitted from captive exotic (nondomesticated) animals over a 5-year period. mycobacterium avium was isolated from 128 animals originating in 13 states and the district of columbia; serotype 1 accounted for 65 of the isolations. mycobacterium bovi was isolated from 74 animals in 7 zoos, 7 game parks, and 4 primate colonies in 1, states: mycobacterium tuberculosis was isolated from 29 animals originating 9 stats; and mycobacterium fortuitum, m ... | 1977 | 406254 |
| infection of prosthetic arthroplasty by mycobacterium fortuitum. two case reports. | | 1979 | 422622 |
| effect of glycerol on viability and other properties of starved mycobacterium fortuitum. | cells of mycobacterium fortuitum kept in 0.85% saline solution containing 0.1% tween 80 (without glycerol) survive for a long time. in glycerol-enriched medium, they continue to lose their viability at a high rate; after 71 days of exposure the percentage of survival as indicated by colony formation and respiratory and dehydrogenase activities is lower than 1%. surviving cells starved in medium without glycerol revealed unchanged sensitivity to streptomycin, p-aminosalicylic acid, and isoniazid. | 1979 | 476541 |
| evidence for two steroid 1,2-dehydrogenase activities in mycobacterium fortuitum. | | 1979 | 486522 |
| mycobacterium fortuitum epidemics after open-heart surgery. | we present the clinical and epidemiological features of mycobacterium fortuitum epidemics involving 19 patients who underwent open-heart surgery. the source of the infection could not be identified. however, bone wax and homografts utilized at that time have been suspected. the infected patients responded poorly to antibiotic management and their courses in most cases were influenced beneficially by total sternectomy and transplantation of the omentum into the mediastinum. the emergence of m. fo ... | 1978 | 619181 |
| delayed hypersensitivity reactions in patients with mycobacterium chelonei and mycobacterium fortuitum infections. | delayed hypersensitivity reactions to skin test antigens prepared from rapidly growing mycobacteria were measured in patients with postoperative wound infections due to mycobacterium chelonei and m. fortuitum. sixteen of 19 patients with m. chelonei infection had more than 10 mm of induration to the m. chelonei purified protein derivative antigen (ppd-cg) and were significantly more likely to react to ppd-cg than patients or hospital personnel who had no evidence of infection. all but one patien ... | 1978 | 629486 |
| cutaneous granulomas associated with mycobacterium fortuitum infection in a cat. | | 1978 | 672196 |
| [mycobacteriosis to mycobacterium fortuitum. apropos of 5 cases]. | | 1978 | 725162 |
| use of phage f-phi wj-1 of mycobacterium fortuitum to discern more phage types of mycobacterium tuberculosis. | a total of 125 strains of mycobacterium tuberculosis from the southeastern area of the united states was subjected to phage typing. in addition to the five major mycobacteriophages, a new phage, f-phi wj-1, was used in the study. the results obtained with the five major phages were: type a0, 35.2%; type b, 29.6%, and type c, 4.0%. the remaining 21.2% of the strains phaged typed as subgroups a1 through a6. these percentages were similar to the typing results of earlier studies. the new phage, f-p ... | 1976 | 818112 |
| susceptibility of organisms in the mycobacterium fortuitum complex to antituberculous and other antimicrobial agents. | of 21 antimicrobial agents tested in vitro, amikacin was the most predictably active against clinical isolates belonging to the mycobacterium fortuitum complex; however, only 50% of strains studied were susceptible to clinically attainable concentrations of the drug. | 1977 | 900925 |
| mycobacterium fortuitum spinal infection: case report. | acute paraplegia followed a vertebral infection with mycobacterium fortuitum. there was a satisfactory response to surgery and antibiotics. no predisposing factors for this primary bone infection could be found. | 1976 | 1018945 |
| isolation and identification of mycobacteria from porcine tissues: a three-year summary. | mycobacteria were isolated from 1,591 (78%) of 2,036 porcine tissues submitted to veterinary services laboratories over a 3-year period (july 1, 1971, to june 30, 1974). the isolates were identified by biochemical and serologic tests. of the 1,547 mycobacterium avium isolates, 452 were serotype 1, 728 were serotype 2, 60 were serotyped 4, 110 were serotype 8, and 51 were serotyped 10; 36 isolates represented 11 other serotypes; 65 isolates shared antigens with more than one serotype; and 45 isol ... | 1975 | 1099946 |
| the nature and incidence of lysogeny in mycobacterium fortuitum. | ten of 28 strain of mycobacterium fortuitum (ranae) were found to be associated with bacteriophage; three were pseudolysogenic, one liberated a phage that lysed a sensitive indicator strain, two liberated morphologically complete phages that did not lyse any of the strains used in this study and four liberated morphologically defective phages. the lysogenic and defectively lysogenic strains showed anomalies in cultural, biochemical and antigenic properties and in susceptibility to superinfecting ... | 1975 | 1142414 |
| [mycobacterium fortuitum (minetti) as a cause of skin abscess after injection puncture (author's transl)]. | | 1975 | 1174096 |
| chronic granulomatous disease. diagnosis in a 27-year-old man with mycobacterium fortuitum. | | 1975 | 1174191 |
| [study of cows experimentally infected with atypical mycobacteria]. | cows were infected subcutaneously with mycobacterium aquae, mycobacterium fortuitum, micobacterium vaccae, and mycobacterium smegmatis. the investigations carried out on the thirtieth day following infection revealed allergic reaction in all cows with close variations when avian and bovine tuberculin were used. the complement-fixation test with blood sera pointed to the presence of specific antibodies for the mycobacterium genus. the histopathologic reaction in the lymph nodes, established after ... | 1975 | 1198916 |
| mycobacterium resembling mycobacterium fortuitum that produces brown pigment. | two cultures of acid-fast bacilli with characteristics most closely resembling those of mycobacterium fortuitum were recovered as casual isolates from sputa of a patient with an apparent brochogenic tumor. one of the cultures was consistenly cream colored to rosy buff. the other, however, changed from buff to rust to dark brown and had the gross appearance of a fungus culture. | 1976 | 1262455 |
| effect of a sputum digestant on the viabiltiy of mycobacterium fortuitum. | a microcolony technique has been demonstrated as being useful for the rapid determination of the viabilities of single cells of myocbacterium fortuitum. cultures of m. fortuitum grown to early logarithmic phase in broth were treated with the sputum digestant n-acetyl-l-cysteine-sodium hydroxide (nalc-naoh) for periods of 10 to 40 s. after growth for three generations (7.5 h) on agar films, viabilities were determined by counting under a phase contrast microscope. the viable mycobacteria grew int ... | 1976 | 1275496 |
| genetic heterogeneity within mycobacterium fortuitum complex species: genotypic criteria for identification. | a 1.5-kb segment of the dna that encodes 16s rrna was amplified by polymerase chain reaction, and 880 nucleotide positions were determined from each of the described biovariants of mycobacterium fortuitum. signature sequences which allow rapid identification of m. fortuitum strains at the biovariant level are described. our data demonstrate a close phylogenetic relationship between mycobacterium senegalense and m. fortuitum and indicate that the described biovariants of m. fortuitum represent ge ... | 1992 | 1280641 |
| peritonitis with mycobacterium fortuitum in a patient on continuous ambulatory peritoneal dialysis. | a 35-year-old man on continuous ambulatory peritoneal dialysis (capd) developed peritonitis due to mycobacterium fortuitum and coagulase-negative staphylococci, following an unsuccessful renal transplantation. infection subsided after removal of the dialysis catheter and treatment with amikacin. clinicians and microbiologists should be aware of m. fortuitum as a potential cause of peritonitis in patients with debilitating underlying diseases. it is able to grow on ordinary culture media, but det ... | 1992 | 1287816 |
| isoelectric focusing patterns of beta-lactamases in the rapidly growing mycobacteria. | beta-lactamases from 259 strains of rapidly growing mycobacteria that included the third biovariant complex of mycobacterium fortuitum, m. peregrinum, m. abscessus, m. chelonae, the m. chelonae-like organisms (mclo), and m. smegmatis were analyzed by isoelectric focusing (ief). all isolates produced acidic beta-lactamases with major band isoelectric points (pis) between 4.4 and 6.0. each of the 6 taxonomic groups exhibited 1 or 2 characteristic beta-lactamase ief patterns. heterogeneity among ie ... | 1992 | 1292713 |
| ci-960 (pd127391 or am-1091), sparfloxacin, win 57273, and isepamicin activity against clinical isolates of mycobacterium avium-intracellularae complex, m. chelonae, and m. fortuitum. | a 7h9 broth microdilution method against ci-960, sparfloxacin, win57273, ciprofloxacin, norfloxacin, isepamicin, amikacin, kanamycin, ethambutol, isoniazid, and rifampin was used to test 35 mycobacterium avium-intracellulare complex (mai) and five m. chelonae-fortuitum strains. the majority of mai isolates were inhibited by all tested compounds, with sparfloxacin (mic90, 0.5 micrograms/ml) being the most active among the fluoroquinolones; isepamicin (mic90, 4 micrograms/ml), the most potent amin ... | 1992 | 1315233 |
| activities of four macrolides, including clarithromycin, against mycobacterium fortuitum, mycobacterium chelonae, and m. chelonae-like organisms. | susceptibilities to erythromycin by broth microdilution were compared with those to the newer macrolide clarithromycin for 223 isolates of rapidly growing mycobacteria belonging to seven taxonomic groups. seventy-nine random isolates were also tested against azithromycin and roxithromycin. the mic of clarithromycin for 90% of strains tested (mic90) was 0.25 microgram/ml for isolates of mycobacterium chelonae subsp. chelonae and 0.5 microgram/ml for m. chelonae subsp. abscessus, with 100% of stra ... | 1992 | 1317144 |
| functional analysis of pal5000 plasmid in mycobacterium fortuitum. | four of the five open reading frames (orfs) present in myobacterium fortuitum pal5000 plasmid (orf1, orf3, orf4, and orf5) are dispensable for replication in m. fortuitum. however, two additional orfs (orf1 and orf5) were necessary for replication in a myobacterium smegmatis heterologous host containing an efficient plasmid transformation mutation. | 1992 | 1409973 |
| disseminated mycobacterium fortuitum disease in an aids patient. | | 1992 | 1415313 |
| a case of prolonged urinary tract infection caused by mycobacterium fortuitum. | a case of prolonged urinary tract infection caused by mycobacterium fortuitum in a 56-year old female patient is reported. the infection, which was resistant to therapy with conventional antituberculous agents, responded well to a combination of trimethoprim, sulfamethoxazole and doxycycline. | 1992 | 1425732 |
| [mycobacterium fortuitum pulmonary infection in a healthy 17-year-old man]. | a 17-year-old man was admitted with a 5-month history of intermittent dyspnea on exertion, 10 kg weight loss, cough, sputa and fever. he did not smoke, had no apparent underlying pulmonary disease, and was not immunocompromised. mycobacterium fortuitum was cultured from sputa at admission. chest radiograph showed many thin-walled cavities and infiltration in the bilateral middle and upper fields. chest ct detected multiple cystic lesions that were not revealed in conventional x-ray. it was sugge ... | 1992 | 1434323 |
| [mycobacterium fortuitum in a patient with human immunodeficiency syndrome (aids) in benin)]. | the authors report a case of mycobacterium fortuitum infection in one aids patient. this case underlines the interest for the clinicians to investigate systematically a possible infection by mycobacterium fortuitum in all aids patients with pulmonary tuberculosis. | 1992 | 1435192 |
| mycobacterium fortuitum endocarditis in a patient with chronic renal failure on hemodialysis. | a case of infective endocarditis due to m. fortuitum in a 54 yr old female with chronic renal failure on hemodialysis is presented. clinical, microbiological and autopsy findings are discussed. | 1992 | 1437294 |
| ciprofloxacin in the treatment of mycobacterium fortuitum infection of the peroneal tendons. a case report. | in the case reported, m. fortuitum was sensitive in vitro to amikacin, erythromycin, tobramycin, and ciprofloxacin. because the patient did not respond to long-term therapy with amikacin and erythromycin, an experimental antibiotic, ciprofloxacin, was tried. only after extensive surgical debridement and 2 1/2 months of oral ciprofloxacin therapy was the infection eradicated and wound healing obtained. the authors conclude that a wound that has reopened, but remains indolent, exudes a clear, sero ... | 1992 | 1432657 |
| imipenem in the treatment of lung infections due to mycobacterium fortuitum and mycobacterium chelonae: further experience. | | 1992 | 1457638 |
| [mycobacterium fortuitum: the determination of its susceptibility by the disk diffusion technic]. | a study was carried out on 40 mycobacterium fortuitum strains isolated from 39 symptomatic respiratory patients and 1 from a chronic skin ulcer, the susceptibility of whom to different antimicrobial agents was determined by the disk diffusion method. the strain showed sensitivity to aminoglucosides such as amikacin, gentamicin and kanamycin, and in all cases resistance to the penicillins ans cephalosporins used. | 1992 | 1344681 |
| structure of mycoside f, a family of trehalose-containing glycolipids of mycobacterium fortuitum. | nuclear magnetic resonance spectroscopy, fast-atom bombardment mass spectrometry, gas chromatography-mass spectrometry, as well as chemical degradations were used to elucidate the structure of the major glycolipids of mycobacterium fortuitum. three main glycoconjugates were detected and their structures established as 2,3-diacyl, 2,3,4- and 2,3,6-triacyl trehalose. the characteristic infrared spectrum which led to their original designation as mycoside f, a family of glycolipids limited in distr ... | 1992 | 1459422 |
| laboratory aspects of "mycobacterium genavense," a proposed species isolated from aids patients. | "mycobacterium genavense" is a proposed new species recently reported to cause disseminated infections in 18 patients with aids in europe. we have recovered "m. genavense" as slowly growing fastidious mycobacteria in blood cultures of seven patients with aids. in the original studies of "m. genavense," the fastidious organism grew only in bactec 13a vials. the seattle, washington, isolates of "m. genavense" also failed to grow when subcultured from 13a vials to routine solid media, but dysgonic ... | 1992 | 1280652 |
| monocarboxylic acids from oxidation of acyclic isoprenoid alkanes by mycobacterium fortuitum. | mycobacterium fortuitum utilizes certain stereoisometric mixtures of individual multimethyl branched alkanes as sole carbon source, including 2,6(r), 10(s), 14(rs)-tetramethylhexadecane; 2.6(r), 10(s), 14(rs)-tetramethylheptadecane; 2,6(rs), 10(rs)-trimethyltetradecane, and 2,6(r), 10(s)-trimethylpentadecane. products of oxidation isolated from the bacterial lipids were acids derived predominantly from oxidation of the isopropyl terminus of each alkane, except in the case of 2,6(rs), 10(rs)-trim ... | 1976 | 1250070 |
| [coincidence of lung diseases caused by mycobacterium fortuitum and esophageal achalasia--case report and review of the literature]. | we report on a case of lung infection due to mycobacterium fortuitum in conjunction with esophageal achalasia. a review of literature and a discussion on pathophysiological, clinical and therapeutical aspects are included. we conclude that bacterial poly-resistance in case of infections resembling tuberculosis should prompt a search for atypical mycobacteria. patients suffering from nontuberculous mycobacteriosis of the lung should be subject to oesophageal examination. | 1992 | 1475267 |
| mycobacterium fortuitum infections of the hand. report of five cases. | five cases are reported of infection due to mycobacterium fortuitum involving the hand following contaminated injection or traumatic wounds. synovectomy, debridement, or amputation together with prolonged chemotherapy using kanamycin or amikacin were required. doxycycline and sulphamethoxasole also seemed to be the effective antibiotics for this organism. a high index of suspicion is important in order to obtain the correct diagnosis. | 1992 | 1484253 |
| [proceedings: mycobacterium fortuitum infection]. | | 1975 | 1211864 |
| resistance to beta-lactams in mycobacterium fortuitum. | it is widely assumed that the high level of intrinsic resistance to beta-lactam antibiotics exhibited by mycobacteria results from the combination of factors including permeability to the drugs, beta-lactamase production, and affinity for penicillin-binding proteins (pbps). we conducted an evaluation of the second and third factors by isolating nitrosoguanidine-induced mutants from the beta-lactamase-producing strain mycobacterium fortuitum atcc 19542 that displayed either elevated or reduced re ... | 1992 | 1510395 |
| [mycobacterium fortuitum (minetti) as a cause of skin abscess after injection puncture (author's transl)]. | | 1975 | 1175072 |
| application of newly synthesized detergents in the side chain degradation of plant sterols by mycobacterium fortuitum. | newly synthesized detergents of polyoxyethylene polyoxypropylene co-polymers (co-eopo), polyoxyethylene polyoxypropylene adducts of the diethylene triamine (deta-eopo), and steroidal detergents (sdd) stimulate significantly side chain degradation of plant sterols referring to both the sterol degradation and the formation of the product, 9 alpha-hydroxy-androsta-4-ene-3,17-dione (9 oh-ad), by mycobacterium fortuitum nrrl-b-8119. highest stimulative effects were observed with derivatives of the de ... | 1992 | 1512705 |
| selection and characterization of new microorganisms for the manufacture of 9-oh-ad from sterols. | using a special selection procedure, several mutants of mycobacterium vaccae were isolated which were capable of converting sterols to 9 alpha-hydroxyandrost-4-ene-3,17-dion (9-oh-ad). two mutants, mycobacterium vaccae zimet 11052 and 11053, respectively, were further investigated. strains of the species mycobacterium fortuitum are mainly used for commercially obtaining 9-oh-ad from sterols. in contrast to the species mycobacterium fortuitum the species mycobacterium vaccae has not been reported ... | 1992 | 1527709 |
| an escherichia coli-mycobacterium shuttle cosmid vector, pmsc1. | a shuttle cosmid vector, pmsc1, has been constructed which replicates in escherichia coli and mycobacterium smegmatis. the vector was mainly derived from the lambda ori cosmid, lawrist4, and the mycobacterium fortuitum cryptic plasmid, pal5000, which replicates in m. smegmatis and mycobacterium bovis bcg. the vector contains two cos sites which facilitates library construction, unique bamhi and hindiii sites for cloning, and a kanamycin-resistance-encoding gene for selection in mycobacteria. aft ... | 1992 | 1531970 |
| tuberculosis pleurisy due to mycobacterium fortuitum in a patient with chronic granulocytic leukemia. | a case of tuberculous pleurisy due to mycobacterium fortuitum in a 47-year-old woman with chronic granulocytic leukemia is described. the mycobacterial aetiology of the pleurisy was confirmed by pleural biopsy and by positive culture of m. fortuitum in pleural fluid. antituberculosis chemotherapy with inh, rmp and emb, combined initially with prednisolone, was successful in spite of total resistance of the strain to the drugs used. a short review of mycobacterioses and of recent literature on th ... | 1975 | 1062852 |
| proposal of mycobacterium peregrinum sp. nov., nom. rev., and elevation of mycobacterium chelonae subsp. abscessus (kubica et al.) to species status: mycobacterium abscessus comb. nov. | we studied the taxonomic positions of the rapidly growing organism mycobacterium fortuitum and phenotypically related organisms. we confirmed that "mycobacterium peregrinum" atcc 14467t (t = type strain) is genetically independent of m. fortuitum atcc 6841t by using various dna hybridization conditions. strains that were genetically identified as "m. peregrinum" were phenotypically differentiated from m. fortuitum atcc 6841t. thus, we propose that "m. peregrinum" should be revived as an independ ... | 1992 | 1581184 |
| mycobacterium fortuitum mastoiditis. | improved techniques of bacteriologic identification have led to increasing recognition of the clinical significance of the atypical or anomymous mycobacteria. mycobacterium fortuitum, included in group iv of runyon's classification because of its characteristic rapid growth, is widespread in nature as a saprophyte. its facultative pathogenicity has received increasing attention in the literature recently with reports of a number of isolated infections, epidemics, and deaths. we report a case of ... | 1976 | 962700 |
| large restriction fragment patterns of genomic mycobacterium fortuitum dna as strain-specific markers and their use in epidemiologic investigation of four nosocomial outbreaks. | pulsed-field gel electrophoresis and restriction endonucleases with rare recognition sites were used to generate large restriction fragment (lrf) patterns of genomic dna from 48 isolates of mycobacterium fortuitum biovariant fortuitum. epidemiologically unrelated isolates gave highly diverse patterns when asni, hpai, aflii, drai, ndei, xbai, spei, or sspi was used. epidemiologically related isolates produced identical or minimally different lrf patterns. minor variations in lrf patterns were see ... | 1992 | 1583127 |
| the pathogenicity of mycobacterium fortuitum and mycobacterium chelonei in man: a report of seven cases. | the clinical records of 7 patients referred to the national jewish hospital and research center over a 6-year period for evaluation of an abnormal chest x-ray and repeated sputum isolates of rapidly growing mycobacteria (runyon's group iv) were reviewed to determine the potential pathogenicity of these organisms. mycobacterium fortuitum was isolated from 5 patients and mycobacterium chelonei from 2. haemoptysis, cough and weight loss were prominent in 6. three had rheumatoid arthritis. although ... | 1976 | 941300 |
| bioconversion of sitosterol to useful steroidal intermediates by mutants of mycobacterium fortuitum. | a series of mutants which are blocked at various stages of the sterol degradative pathway have been isolated from the potent sterol degrader mycobacterium fortuitum atcc-6842. sitosterol bioconversions by these mutants result in the accumulation of a number of intermediate compounds, some of which are potentially useful as substrates in the manufacture of medically important steroids. these intermediates include androst-4-ene-3,17-dione, androsta-1,4-diene,3,17-dione, ring a-degraded tricyclic c ... | 1978 | 737192 |
| mfoai, a novel isoschizomer of haeiii from mycobacterium fortuitum recognizing 5'-gg/cc-3'. | | 1992 | 1614877 |
| cloning and dna sequence of the mycobacterium fortuitum var fortuitum plasmid pal5000. | the complete nucleotide sequence of the mycobacterium fortuitum var fortuitum plasmid pal5000 has been determined. computer analysis of this 4821-bp plasmid for protein coding regions, based on mycobacterial codon usage preferences, reveals the presence of two putative protein coding regions immediately downstream from typical mycobacterial promoter and ribosome binding sites. both open reading frames, orf1 and orf2, produced proteins with the predicted respective sizes previously shown in minic ... | 1992 | 1615063 |
| mycobacterial diseases other than tuberculosis. | the incidence of tuberculosis in the united states declined steadily until 1985, while at the same time, for at least the past 15 years, the frequency of disease attributable to other mycobacteria increased both in actual numbers and in the proportion of the total burden of mycobacterioses. chronic pulmonary disease, lymphadenitis in children, skin and soft-tissue involvement, and infections of the skeletal system were predominant, and the principal etiologic agents were mycobacterium avium/myco ... | 1992 | 1617048 |
| mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids. | between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ... | 1992 | 1617056 |
| right middle lobe syndrome caused by mycobacterium fortuitum in a patient with human immunodeficiency virus infection. | we have reported a previously undescribed syndrome of mycobacterium fortuitum infection manifested as localized pulmonary disease that required lung resection and prolonged combined chemotherapy for clinical response in a patient with hiv infection. m fortuitum infections must be considered in hiv-infected patients with possible infectious pulmonary complications. | 1992 | 1631699 |
| mycobacterium fortuitum infections: a review with two illustrative cases. | two outbreaks of postoperative wound infections by organisms of the mycobacterium fortuitum complex have focused attention on this notoriously drug resistant organism. in this report 2 cases are presented which developed infections with this organism, one of which responded to systemic antimicrobials despite discouraging in vitro sensitivities. surgical debridement must remain the choice of treatment; however, systemic antibiotics may prove effective in some cases. | 1978 | 729293 |
| microbial oxidation of oleic acid. | resting cells of saccharomyces cerevisiae (baker's yeast, type ii; sigma) were used to convert oleic acid into 10-hydroxyoctadecanoic acid with a 45% yield. nocardia aurantia (atcc 12674), nocardia sp. (nrrl 5646), and mycobacterium fortuitum (ui 53378) all converted oleic acid into 10-oxo-octadecanoic acid with 65, 55, and 80% yields, respectively. structures of all metabolites were suggested by 1h and 13c nuclear magnetic resonance and by infrared and mass spectrometry. structures of isomeric ... | 1992 | 1637152 |
| evaluation of a mechanical/chemical infectious waste disposal system. | the mechanical/chemical infectious waste disposal system (iwds), model z-5000 hc, manufactured by medical safetec inc. (indianapolis, indiana) was evaluated for its ability to disinfect biomedical waste. | 1992 | 1640095 |
| activity of amikacin, erythromycin and doxycyline against mycobacterium chelonei and mycobacterium fortuitum. | the activity of amikacin, erythromycin and doxycycline was studied against 18 strains of m. fortuitum and 10 of m. chelonei. the agar dilution technique was used for the evaluation of the minimum inhibitory concentration. between the three drugs tested, amikacin was the most active, since 66.6% of the m. fortuitum and 80% of m. chelonei strains were inhibited at 12.8 microgram/ml. it is possible that in some circumstances amikacin could be useful in the treatment of infections caused by m. fortu ... | 1978 | 726085 |
| prosthetic valve endocarditis due to mycobacterium fortuitum. | | 1978 | 679115 |
| lipoid pneumonia in children following aspiration of animal fat (ghee). | exogenous lipoid pneumonia induced by modified animal fat (ghee) in 10 children is described. the initial presentation was of an acute or chronic pneumonia which proved refractory to anti-microbial chemotherapy. the radiological presentation varied from mild perihilar consolidation to diffuse and extensive bilateral involvement, particularly of the posterior lung segments. a history of administration of ghee provided the initial clue to the diagnosis, which was confirmed by demonstration of fat ... | 1991 | 1714701 |
| problems in diagnosis and therapy of mycobacterium fortuitum infections. | mycobacterium fortuitum was isolated 11 times from 8 patients during a 6-year period. six of the isolates were from sputum; one was from aspiration of a lymph node, and 4 were from wound cultures. the isolation from sputum was believed not to be associated with pulmonary infection in all 6 instances. the difficulty in diagnosis and therapy of infections with mycobacterium fortuitum is illustrated by these cases and by others from the literature. amikacin and doxycycline may offer some therapeuti ... | 1978 | 646215 |
| catheter-related infections caused by the mycobacterium fortuitum complex: 15 cases and review. | fifteen cancer patients have developed catheter-related infections caused by the mycobacterium fortuitum complex (m. fortuitum and mycobacterium chelonae) at m. d. anderson cancer center since 1978. eleven patients had bacteremia and four had catheter site infections. nine infections were caused by m. fortuitum and six by m. chelonae. all four bacteremic patients whose catheters were initially removed and who were treated with antibiotics recovered, whereas for all of the seven bacteremic patien ... | 1991 | 1775845 |
| in vitro susceptiiblity of mycobacterium fortuitum and mycobacterium chelonei to amikacin. | infections due to runyon group iv atypical mycobacteria, mycobacterium fortuitum and mycobacterium chelonei, in humans have been difficult to treat in the past because of the organisms' resistance to all of the conventional antimycobacterial drugs. determinations of minimal inhibitory concentrations (mics) by the agar dilution method suggest that amikacin may be useful in the treatment of infections due to m. fortuitum and m. chelonei. further support for the efficacy of antimicrobial agents wit ... | 1978 | 632627 |
| development of bcg as a live recombinant vector system: potential use as an hiv vaccine. | bacille calmette-guèrin (bcg), a live attenuated tubercle bacillus, is currently the most widely used vaccine in the world. because of its unique characteristics, including low toxicity, adjuvant potential, and long-lasting immunity, bcg represents a novel vaccine vehicle with which to deliver protective antigens of multiple pathogens. we have developed episomal and integrative expression vectors employing regulatory sequences of major bcg heat shock proteins for stable maintenance and expressio ... | 1991 | 1845119 |
| mycobacterium fortuitum epidemics after open heart surgery. | | 1977 | 610989 |
| nontuberculous mycobacterial sternal osteomyelitis in a patient without predisposing condition. | a woman is reported with a ten-year history of nonspecific chest pain. bone scintigraphy showed increased local uptake, suggesting isolated sternal osteomyelitis. radiographic investigations were positive 18 months later. cultures of needle aspirations of the sternal bone marrow isolated mycobacterium fortuitum as well as mycobacterium simiae. due to its indolent nature, nontuberculous mycobacterial disease is easily missed, especially in non-compromised hosts. | 1991 | 1881498 |
| tuberculosis in saudi arabia: epidemiology and incidence of mycobacterium tuberculosis and other mycobacterial species. | the epidemiology of mycobacterial infections was studied in a wide cross-section of the jeddah population over 2 years (1987-1989). saudis, non-saudis and patients from a stable population attending national guard king khalid hospital (ngkkh) were compared. the ratio of saudi to non-saudi was 1:2 and males accounted for 65% of the total. the incidence was highest among young adults although the peak varied slightly between saudi and non-saudi patients. extra-pulmonary tuberculosis was also prepo ... | 1991 | 1882445 |
| distribution of a novel mycolic acid in species of the genus mycobacterium. | we found that mycobacterium porcinum atcc 33776t (t = type strain) contains a new kind of mycolic acid with a methoxy group at the omega-1 position. this mycolic acid was identified by comparing it with the previously described methoxymycolic acids. the patterns of mycolic acid methyl esters from 418 strains belonging to 44 species of mycobacteria were studied by using thin-layer chromatography. in addition to m. procinum atcc 33776t, representative strains of m. porcinum, mycobacterium fortuitu ... | 1991 | 1883713 |
| mycobacterium fortuitum presenting as an asymptomatic enlarging pulmonary nodule. | a case of mycobacterium fortuitum presenting as an asymptomatic enlarging pulmonary nodule is described. this case is unusual because the patient was female, did not have underlying pulmonary disease, was not immunocompromised, had no evidence of dissemination, and had no history of aspiration or diabetes mellitus. the patient underwent thoractomy for resection of the pulmonary nodule, which led to the diagnosis. she recovered fully and is doing well without chemotherapy. | 1991 | 1892152 |
| an outbreak of soft-tissue infections due to mycobacterium fortuitum associated with electromyography. | an outbreak of infections due to mycobacterium fortuitum associated with electromyography (emg) is described. during a 6-week period, six patients who received emg at one facility developed soft-tissue infections manifested by slowly expanding suppurative nodules at sites of needle electrode insertion. m. fortuitum was isolated from five patients; four isolates that were evaluated further were m. fortuitum biovariant fortuitum. emg procedures were done in one laboratory by one physician and assi ... | 1991 | 1902248 |
| infection of a shunt by mycobacterium fortuitum: case report. | mycobacterium fortuitum is a rare cause of central nervous system infection; however, shunt infection caused by this organism has not been reported. we report a case of shunt infection subsequent to insertion of a ventriculoatrial shunt for obstructive hydrocephalus caused by a cerebellar hematoma. the shunt infection was controlled by removal of the shunt and a combination of systemic and intraventricular administration of amikacin, and oral administration of ofloxacin. the case is discussed an ... | 1991 | 1922723 |
| mycobacterium fortuitum pneumonia--treatment with enoxacin and cotrimoxazole. | | 1991 | 1923088 |
| glycopeptidolipids from mycobacterium fortuitum: a variant in the structure of c-mycoside. | strains from the mycobacterium fortuitum complex contain surface species-specific lipids allowing their precise identification. in m. fortuitum biovar. peregrinum two major glycopeptidolipids, of the c-mycoside type, were characterized by a combination of chemical analyses, nmr, and fab mass spectrometry. important information was obtained by mass spectrometry both on their molecular weight and on the peptide and saccharide sequences without any derivatization. the basic structure of the two com ... | 1991 | 1931976 |
| granulomatous prostatitis. association with isolation of mycobacterium kansasii and mycobacterium fortuitum. | | 1977 | 576944 |
| mycobacterium fortuitum pulmonary infection complicating achalasia. | achalasia is a cause of chronic aspiration pneumonia that may be complicated by pulmonary infection with mycobacterium fortuitum. in any patient with achalasia, the presence of a pulmonary infiltrate that does not respond to routine antibiotic therapy should suggest the possibility of m fortuitum pulmonary infection, and sputum should be cultured for these organisms. | 1991 | 1948232 |
| disk diffusion testing of susceptibility of mycobacterium fortuitum and mycobacterium chelonei to antibacterial agents. | although recent studies have suggested that some antibacterial agents have good activity against the rapidly growing mycobacteria mycobacterium fortuitum and mycobacterium chelonei, an easily applicable method for susceptibility testing of clinical isolates is not yet available. we evaluated a disk diffusion method with mueller-hinton agar and 48-h readings with 59 strains of m. fortuitum and 11 strains of m. chelonei and compared the results to agar dilution susceptibilities for nine antimicrob ... | 1979 | 526002 |
| comparison of proteins from mycobacterium fortuitum, mycobacterium nonchromogenicum and mycobacterium terrae using flat bed electrophoresis. | polyacrylamide gel electrophoresis of bacterial lysates in a flat bed gives a linear relationship between 1n mol. wt of the proteins and the square root of their migration distances, thereby allowing standardization of different electrophoresis runs and precise comparison between homologous bands. the results obtained with mycobacterium fortuitum, m. terrae and m. nonchromogenicum strains were used in numerical analysis. mycobacterium fortuitum and m. nonchromogenicum showed a greater internal s ... | 1979 | 479829 |
| beta-lactamase of mycobacterium fortuitum: kinetics of production and relationship with resistance to beta-lactam antibiotics. | the kinetics of both intracellular and extracellular beta-lactamase production and the relationship between extracellular enzyme and in vitro susceptibility of mycobacterium fortuitum to beta-lactam antibiotics have been studied. to this end we used a panel of stable nitrosoguanidine-induced mutants of m. fortuitum derived from the parental strain atcc 19542 and differing in beta-lactamase production from 0.0001 to 278 u/liter in mueller-hinton broth. for overproducers of beta-lactamase (mutants ... | 1991 | 1952844 |
| clinical disease, drug susceptibility, and biochemical patterns of the unnamed third biovariant complex of mycobacterium fortuitum. | previous studies of mycobacterium fortuitum identified isolates that did not fit its two recognized biovariants. eighty-five clinical isolates of this group, the "third biovariant complex", were evaluated. they represented 16% of 410 isolates of m. fortuitum submitted to a texas laboratory and 22% of 45 isolates in queensland, australia. most infections (76%) involved skin, soft tissue, or bone and occurred after metal puncture wounds or open fractures. isolates differed from biovar fortuitum in ... | 1991 | 1995732 |
| antimicrobial susceptibility testing of mycobacterium fortuitum complex. | a total of 24 strains of the mycobacterium fortuitum complex were tested for susceptibility to antimicrobial agents by the disk diffusion and agar dilution techniques. by comparing zones of inhibition obtained with the disk diffusion technique with results of minimal inhibitory concentration determinations, it was shown that disk diffusion results could predict in vitro susceptibility to selected antimicrobial agents. all of 17 strains of m. fortuitum were susceptible to </=1 mug of amikacin per ... | 1979 | 475359 |
| cervical lymphadenitis in childhood due to mycobacteria of the fortuitum group. | two children with cervical lymphadenitis due to mycobacterium fortuitum infection are described; both presented with erythema nodosum. | 1979 | 453916 |
| aortitis caused by mycobacterium fortuitum. | aortic valve replacement was complicated by sternal wound infection with mycobacterium fortuitum. the wound was treated with débridement and antibiotic therapy. five months later the patient developed fever, and blood cultures yielded m fortuitum. at surgery, aortitis with pseudo-aneurysm formation was encountered. mycobacterium fortuitum grew from the aortic lesion. this is the first report of m fortuitum causing aortitis, although this organism is known to infect sternal wounds and mediastinum ... | 1991 | 2025125 |
| [mycobacterium fortuitum infection after total hip prosthesis. a report of 3 cases (author's transl)]. | the authors have observed three instances of sepsis due to mycobacterium fortuitum complicating total hip replacement for osteoarthritis. the case histories are fully described. the requirements are given for recognition of the organism which grows on special culture media and which may be mistaken for mycobacterium tuberculosis. this feature explains why, in some cases, the organism may not be discovered. antibiotics were ineffective but the general condition of the patient was not greatly affe ... | 1979 | 156387 |
| nontuberculous mycobacterial peritonitis during continuous ambulatory peritoneal dialysis: case report and review of diagnostic and therapeutic strategies. | nontuberculous mycobacteria (ntm) are responsible for an increasing proportion of mycobacterial disease. peritonitis due to ntm is an unusual but treatable complication of continuous ambulatory peritoneal dialysis (capd). its presentation is similar to that of typical bacterial peritonitis, but special culture techniques are required to avoid a delay in diagnosis. successful treatment depends on early catheter removal, drainage of fluid collections, and appropriate use of antimicrobial agents. w ... | 1991 | 2063847 |
| susceptibilities of mycobacterium fortuitum biovar. fortuitum and the two subgroups of mycobacterium chelonae to imipenem, cefmetazole, cefoxitin, and amoxicillin-clavulanic acid. | mics of imipenem, cefoxitin, cefmetazole, and amoxicillin-clavulanic acid were determined against 100 strains of mycobacterium fortuitum and 200 strains of mycobacterium chelonae. imipenem and cefmetazole were more active against m. fortuitum than cefoxitin was, and imipenem (which inhibited 39% of strains at 8 micrograms/ml) was the only beta-lactam active against m. chelonae subsp. chelonae. | 1991 | 2069387 |
| isolation and characterization of efficient plasmid transformation mutants of mycobacterium smegmatis. | recent development of vectors and methodologies to introduce recombinant dna into members of the genus mycobacterium has provided new approaches for investigating these important bacteria. while most pathogenic mycobacteria are slow-growing, mycobacterium smegmatis is a fast-growing, non-pathogenic species that has been used for many years as a host for mycobacteriophage propagation and, recently, as a host for the introduction of recombinant dna. its use as a cloning host for the analysis of my ... | 1990 | 2082148 |
| [mycobacterium fortuitum in patients with chronic renal insufficiency: apropos of 2 cases]. | mycobacterium fortuitum is a rapidly growing mycobacteria recovered from human infections such as skin, soft tissue, skeletal and pulmonary infectious diseases. we report 2 cases of m. fortuitum isolation from clinical samples from two patients placed on dialysis program. our clinical findings were: the first, the presence of an abscess in the area of insertion of a capd catheter and the second, the detection of a lobar pneumonia in a patient placed on long-term hemodialysis program. we consider ... | 1990 | 2090230 |
| polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
| [mycobacterium fortuitum infection after total hip prosthesis. a report of 3 cases (author's transl)]. | the authors have observed three instances of sepsis due to mycobacterium fortuitum complicating total hip replacement for osteoarthritis. the case histories are fully described. the requirements are given for recognition of the organism which grows on special culture media and which may be mistaken for mycobacterium tuberculosis. this feature explains why, in some cases, the organism may not be discovered. antibiotics were ineffective but the general condition of the patient was not greatly affe ... | 1979 | 155857 |
| [mycobacteriosis in sea mammals and birds]. | different diagnostic techniques for mycobacteria were studied in sea lions, sea elephants, fur seals, dolphins, killer whales and penguins from a sea aquarium. three strains were isolated from fur seals. two were classified as mycobacterium chelonae and one as mycobacterium fortuitum complex. there was good correlation between the results given by the intradermal tuberculin test and elisa, but the former is recommended as a screening test on the basis of its practicality. results and methodology ... | 1990 | 2132708 |
| functional analysis of pal5000, a plasmid from mycobacterium fortuitum: construction of a "mini" mycobacterium-escherichia coli shuttle vector. | functional domains of pal5000 were determined by gene disruption and deletion analysis. of the five plasmid open reading frames (orfs), orf1 to orf5, and a putative origin of replication previously identified (j. rauzier, j. moniz-pereira, and b. gicquel-sanzey, gene 71:315-321), two of the orfs (orf3 and orf4) were deemed dispensable for plasmid replication. a "mini" mycobacterium-escherichia coli shuttle plasmid applicable for general recombinant dna studies in mycobacteria was constructed by ... | 1990 | 2158981 |
| [atypical mycobacterial infection due to mycobacterium fortuitum]. | the case is presented of a 48-year-old woman who, in association with repeated septic temperatures, developed abscesses in the region of the right shoulder and in the right ankly. histological examination from excisates revealed caseous tuberculoid granulomas. mycobacterium fortuitum was isolated from the pus of both abscesses. although the mycobacterium fortuitum was resistant to nine commonly used tuberculostatics, it was found to be sensitive to ethionamide and capreomycine. the use of these ... | 1978 | 77556 |
| structure of a novel sulfate-containing mycobacterial glycolipid. | we described previously the unusual structures of the two major c-mycoside glycopeptidolipids from mycobacterium fortuitum biovar. peregrinum. more polar glycolipids, potentially more interesting in terms of antigenicity, were also present in the strains. a combination of fab mass spectrometry, nmr, chemical analyses, and radiolabeling was successfully applied to these glycolipids to arrive at the unexpected and novel structure for the more polar compound. this consisted of the "orthodox" basic ... | 1992 | 1445849 |