| serological studies and isolations of serotype hardjo and leptospira biflexa strains from horses of argentina. | three pathogenic leptosipras and 12 saprophytic leptospira biflexa strains were isolated from 72 apparently normal horse kidneys collected at an abattoir in argentina. cross-agglutination reaction patterns of the pathogens showed that they were antigenically homologous with members of the hebdomadis group. when one of the strains was compared to hebdomadis serotypes in reciprocal agglutination-absorption tests, it was found to be serologically homologous to serotype hardjo. this is the first kno ... | 1976 | 59735 |
| [study of a specific polyoside and a group antigen extracted from leptospira biflexa patoc, patoc i strain]. | we extracted from l. biflexa patoc a fraction f, reacting in hemagglutination and ring tests with sera prepared against more than ten different serogroups. this fraction contains mainly a polysaccharide (65 per cent), the role of which was clearly demonstrated in the precipitation reaction with homologous antisera, through periodic oxidation; it also contains lipids (20 per cent) and proteins (10 per cent). we isolated from this fraction f, by biogel column chromatography, 2 distinct antigens, o ... | 1976 | 61770 |
| broadly reacting precipitating and agglutinating antigen of leptospirae. | a saprophytic leptospira biflexa strain of equine origin was found which cross-reacts with immune rabbit antisera to 14 pathogenic leptospira interrogans serotypes. sera from goats experimentally inoculated with the saprophyte showed multiple low-level cross-agglutination reactions against a battery of live l. interrogans serotypes. sonically treated and saline-extracted suspensions of the l. biflexa strain and serotypes canicola, icterohaemorrhagiae, and pomona yielded a common precipitating pr ... | 1978 | 83327 |
| suppression of antibody response to leptospira biflexa and brucella abortus and recovery from immunosuppression after berenil treatment. | zebu cattle infected with either trypanosoma congolense eatro 1800 or trypanosoma vivax eatro 1721 had suppressed humoral immune responses to leptospira biflexa injected intravenously and to attenuated brucella abortus injected subcutaneously. t. congolense infections were more suppressive than t. vivax infections. in cattle infected with t. vivax, the suppression of immune responses to both bacterial immunogens was abrogated when the animals were treated with berenil at the time of antigen admi ... | 1979 | 118933 |
| antigenic competition between the particulated and soluble fractions of the leptospira biflexa patoc i. | | 1977 | 354586 |
| antibodies against leptospira biflexa serotypes patoc and são paulo in pigs: possible occurrence and importance for the intracutaneous test for leptospirosis. | leptospirin for the diagnosis of leptospirosis by an intracutaneous test contains antigenic material from 5 pathogenic leptospira serotypes (10). during experiments with rabbits and pigs, leptospirin was injected into 6 pigs which had been infected artificially with apathogenic leptospira biflexa serotypes patoc and são paulo. three out of the 6 pigs showed a positive leptospirin reaction (11). this interfering reaction in animals having been infected with apathogenic l. biflexa was the reason t ... | 1979 | 506540 |
| factor analysis of serogroups botanica and aurisina of leptospira biflexa. | factor analysis is performed on serovars of botanica and aurisina serogroup of leptospira biflexa. the results show the arrangement of main factors serovar and serogroup specific, as well as the antigens common with serovars of heterologous serogroups. | 1977 | 602518 |
| enzymatic degradation of h2o2 by leptospira. | the enzymes responsible for reducing h2o2 were surveyed in 49 strains of leptospira by using semiquantitative assays for catalase and peroxidase. the survey revealed a differential distribution of catalase and peroxidase activities between the two leptospiral complexes. the pathogenic leptospira interrogans strains gave strong catalase and weak or negative peroxidase reactions. conversely, the nonpathogenic leptospira biflexa strains gave strong peroxidase and negative or weak catalase reactions ... | 1978 | 730380 |
| patoc 1 and rufino strains of leptospira biflexa, as screening antigens in the diagnosis of leptospirosis. | patoc 1 and rufino from l. complexo bifexa strains employed as screening antigen in the serologic diagnosis of liptospirosis in human and in six different animal species in comparison with a battery of 1.9 l complexo interrogans antigens, patoc strain showed a 98.8% accordance in the sera agglutination tests, in humans; in animal it showed a low percentage of accordance in the sera agglutination tests in humans and in animals. | 1978 | 744706 |
| factor analysis of basovizza serogroup of "leptospira biflexa". | factor analysis is performed on serotypes of basovizza serogroup of "leptospira biflexa". the results show the arrangement of main factors typical for the members of this serogroup as well as the antigens common with serotypes of the heterologous serogroup. the existence of a main haptene-like factor is also hypothesized. | 1977 | 848215 |
| isolation of serotype hardjo and other leptospirae from armadillos in argentina. | a serologic, bacteriologic, and histopathologic examination for leptospires was carried out on 89 armadillos (chaetophractus villosus) from argentina. forty-seven per cent of the serum samples yielded positive results when tested by microscopic-agglutination. predominant agglutination reactions were to the hebdomadis and bataviae serogroups. a total of 15 leptospira isolations (from 16.8 per cent of the animals tested) were obtained from kidney tisse. nine of the isolates were identified as belo ... | 1977 | 901969 |
| occurrence of 3-o-methylmannose in the polysaccharide of leptospira biflexa urawa. | 3-o-methylmannose was identified by gas-liquid chromatography-mass spectrometry in the acid hydrolysate of the polysaccharide of leptospira biflexa urawa. | 1976 | 977543 |
| chemical studies on the cell walls of leptorspira biflexa strain urawa and treponema pallidum strain reiter. | the preparation and chemical properties of the cell walls of leptospira biflexa urawa and treponema pallidum reiter are described. both cell walls are composed mainly of polysaccharides and peptidoglycans. the data of chemical analysis indicate that the cell wall of l. biflexa urawa contains rhamnose, arabinose, xylose, mannose, galactose, glucose and unidentified sugars as neutral sugars, and alanine, glutamic acid, alpha, epsilon-diaminopimelic acid, glucosamine and muramic acid as major amino ... | 1975 | 1099288 |
| [the result-sequence method (sequence analysis) in leptospira research. 3. communication: the bilateral sequential test (de boer, armitage) for testing the difference of mean values of two binomial distributions (author's transl)]. | the influence of the liver-activated and non-activated cytostatic drug cyclophosphamid on the respiration of leptospira biflexa semaranga veldrat s 173 was tested in three different concentrations by group-sequential testing of two relative frequencies in a two-sided test-reading. the conditioned probability theta = 0.82 results from thetan = 0.40 and thetaa = 0.75. on account of a practicable sample size, we choose theta' = 0.80 (activated form superior) and theta'' = 0.20 (non-activated form s ... | 1975 | 1179885 |
| [the immunochemical and biological properties of leptospira membranes]. | the immunochemical and biological properties of purified membrane fractions obtained from leptospira interrogans, serovar copenhageni, strain rat 2, and leptospira biflexa, strain patoc 1, were studied. the presence of genus-specific and group-specific antigens in leptospiral membranes was established by the methods of immunodiffusion analysis, the microagglutination (ma) and lysis tests. in animal experiments cell membrane preparations produced no toxic and allergic effects. leptospiral membran ... | 1992 | 1301663 |
| [the identification of leptospira strains of different origins]. | leptospirosis is at present an ever-increasing problem in human and animal health. by means of the korthof medium, 43 leptospira strains were isolated from samples of human blood, water and soil. for their identification the microagglutination technique was used. the strains corresponded to the species leptospira biflexa and leptospira interrogans. | 1992 | 1344685 |
| biotinylated probes to detect leptospira interrogans on dot blot hybridization or by in situ hybridization. | total genomic biotinylated probes which can identify leptospires by hybridization on filters or by in situ hybridization are described in this study. according to the weak g + c content of the strains studied (35-39%) and owing to the decreasing melting temperature (tm) due to overbiotinylation, hybridization and wash temperatures were optimized at 33 degrees c and at 42 degrees c respectively. fourteen serovars of leptospira interrogans belonging to 11 different serogroups and three serovars of ... | 1991 | 1367181 |
| comparison of flanking regions of the 5s ribosomal ribonucleic acid genes in leptospira biflexa and leptospira interrogans. | one of the genes encoding the 5s ribosomal ribonucleic acid (rrna) for the leptospira biflexa strain patoc i was isolated and sequenced. the physical maps of the 5s rrna genes in leptospira were constructed. the strains of leptospira biflexa had two genes on their chromosome; these two 5s rrna genes were located several kb apart and sequences flanking these genes were divergent. in contrast to saprophytic leptospires, maps in parasitic leptospires that had only one gene for 5s rrna on their geno ... | 1992 | 1376643 |
| [homology study of leptospires by molecular hybridization]. | nick translation and random primer labelling method were applied to prepare three genomic dna probes from leptospira interrogans strain 017, leptospira biflexa strain patoc i and leptonema illini strain 3055, and then hybridized with dna of 17 strains leptospires from different genus, species, serogroup and serovar. the results showed no homology between leptospira and leptonema, and only a low degree of homology between l. interrogans and l. biflexa but it showed a high degree of homology among ... | 1992 | 1398616 |
| polymerase chain reaction for detection of leptospira spp. in clinical samples. | a sensitive assay for leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (pcr). a 331-bp sequence from the leptospira interrogans serovar canicola rrs (16s) gene was amplified, and the pcr products were analyzed by dna-dna hybridization by using a 289-bp fragment internal to the amplified dna. specific pcr products also were obtained with dna from the closely related nonpathogenic leptospira biflexa but not with dna from other spiro ... | 1992 | 1400983 |
| immunoblotting study of the antigenic relationships among eight serogroups of leptospira. | seven strains of leptospira interrogans belonging to seven different serogroups, and one strain of leptospira biflexa were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) with gradient gels and immunoblotting with hyperimmune rabbit sera raised against each strain. the molecular masses of the proteins were calculated with a polynomial regression model. the sds-page patterns of the l. interrogans strains were similar and characterized by 24 common bands. this prof ... | 1992 | 1455625 |
| analysis of leptospira spp., leptonema illini, and rickettsia rickettsii for the 39-kilodalton antigen (p39) of borrelia burgdorferi. | five serovars of leptospira interrogans, leptospira biflexa, leptonema illini, and rickettsia rickettsii were examined and found not to contain the 39-kda antigen (p39) of borrelia burgdorferi, the lyme disease spirochete. the specificity of this antigen and its reactivity with human lyme disease sera should exclude the possibility of false-positive serum samples from patients having had either leptospirosis or rocky mountain spotted fever, as well as tick-borne relapsing fever and syphilis, as ... | 1992 | 1551994 |
| isolation and biological activities of endotoxin from leptospira interrogans. | endotoxins extracted with ethylenediaminetetraacetate (edta) from leptospira interrogans serovars icterohaemorrhagiae and canicola and leptospira biflexa serovar patoc were tested for various biological activities characteristic of endotoxins. the presence of lipopolysaccharide biological activity was demonstrated by the limulus amoebocyte lysate test, pyrogenicity in rabbits, complement interaction inhibiting the erythrocyte lysis, and chicken-embryo lethality. the lipopolysaccharides did not i ... | 1992 | 1611553 |
| cloning, characterization and taxonomic significance of genes for the 5s ribosomal rna of leptonema illini strain 3055. | the genes encoding the 5s ribosomal rna (rrna) for leptonema illini strain 3055 were isolated and sequenced. the 5s rna molecule encoded was 117 nucleotides long. the genome of strain 3055 contained two genes for 5s rrna that were located close together. the nucleotide sequences of the leptonema illini genes exhibited less similarity to the rrna gene of leptospira interrogans strain moulton and also to those of typical eubacterial genes than did the rrna genes of other leptospires. however, the ... | 1991 | 1720165 |
| sample preparation method for polymerase chain reaction-based semiquantitative detection of leptospira interrogans serovar hardjo subtype hardjobovis in bovine urine. | an improved method of preparing bovine urine samples was developed for the rapid, specific, and sensitive detection of leptospira interrogans serovar hardjo (subtype hardjobovis) dna by the polymerase chain reaction (pcr). a total of 100 leptospire-free cows, 4 experimentally infected cows, and 2 negative control cows were used. pcr results were improved by (i) using 10-ml urine samples instead of 1-ml samples, (ii) adding 10(7) to 10(8) leptospira biflexa serovar patoc cells as a carrier to eac ... | 1991 | 1757552 |
| experimental lethal infection of leptospira interrogans in mice treated with cyclophosphamide. | after preadministration of cyclophosphamide (300 mg/kg), balb/c mice were lethally infected with leptospira interrogans serovar lai and a virulent strain of leptospira interrogans serovar copenhageni, and leptospiral cells were detected in both kidneys of infected mice by indirect immunofluorescent assay. nonpathogenic leptospirae, leptospira biflexa serovar patoc, leptonema illini, and an avirulent strain of l. interrogans serovar copenhageni, were not parasitic to the mice treated with cycloph ... | 1991 | 1913341 |
| phylogenetic analysis of the spirochetes. | the 16s rrna sequences were determined for species of spirochaeta, treponema, borrelia, leptospira, leptonema, and serpula, using a modified sanger method of direct rna sequencing. analysis of aligned 16s rrna sequences indicated that the spirochetes form a coherent taxon composed of six major clusters or groups. the first group, termed the treponemes, was divided into two subgroups. the first treponeme subgroup consisted of treponema pallidum, treponema phagedenis, treponema denticola, a thermo ... | 1991 | 1917844 |
| nucleotide sequence and analysis of a gene encoding anthranilate synthase component i in spirochaeta aurantia. | a spirochaeta aurantia dna fragment containing the trpe gene and flanking chromosomal dna was cloned, and the sequence of the trpe structural gene plus 870 bp upstream and 1,257 bp downstream of trpe was determined. the s. aurantia trpe gene codes for a polypeptide of 482 amino acid residues with a predicted molecular weight of 53,629 that showed sequence similarity to trpe proteins from other organisms. the s. aurantia trpe polypeptide is not more closely related to the other published spiroche ... | 1991 | 1987149 |
| cloning of the reca gene from a free-living leptospire and distribution of reca-like protein among spirochetes. | a recombinant plasmid carrying the reca gene of leptospira biflexa serovar patoc was isolated from a cosmid library of genomic dna by complementation of an escherichia coli reca mutation. the cloned serovar patoc reca gene efficiently restored resistance to uv radiation and methyl methanesulfonate. recombination proficiency was also restored, as measured by the formation of lac+ recombinants from duplicated mutant lacz genes. additionally, the cloned reca gene increased the spontaneous and mitom ... | 1991 | 2036006 |
| first isolation of bacteriophages for a spirochaete: potential genetic tools for leptospira. | three bacteriophages of the saprophytic aquicole bacterium leptospira biflexa were isolated from sewage waters from the outskirts of paris, france. these phages do not infect representative strains of the pathogenic species leptospira interrogans, and their host range is restricted to serovar patoc of the saprophytic species. the phages were found to be lytic and no lysogenic state could be demonstrated. electron micrographs showed that the phages were morphologically identical and had polyhedra ... | 1990 | 2092364 |
| nucleotide sequence analysis of the leptospira biflexa serovar patoc rpsl and rpsg genes. | the leptospira biflexa rpsl and rpsg genes were sequenced. although similar in many respects, proteins encoded by these l. biflexa genes had several unusual features when compared with homologous proteins of other organisms. unlike the rpsl genes of other eubacteria, the l. biflexa rpsl gene is adjacent to a rpoc-like gene. | 1990 | 2211535 |
| dna relatedness among strains of leptospira biflexa. | the slot blot method of dna hybridization was used to study 38 strains of leptospira biflexa belonging to 38 serovars. fifteen of these serovars were placed into six groups. the remaining 23 serovars were generally too diverse to show significant dna relatedness either to these groups or to one another. serovar thracia was related to group 5, but it was not included in this group because its percent relatedness was too low. we found that genetically related organisms were antigenically dissimila ... | 1990 | 2397191 |
| broad reacting surface antigens in leptospira biflexa serovar andamana. | previous investigations had demonstrated that genus-specific and species-specific antigens of leptospires are deep-seated within the leptospiral cell. conversely, the present study has shown that strain ch11, serovar andamana of the non-pathogenic species of leptospira biflexa is endowed on its surface with two cross-reacting antigens; a newly recognized antigen common to l. interrogans and l. biflexa spp. and an antigenic determinant common to a previously described genus-specific protein antig ... | 1988 | 2459865 |
| the number of large ribosomal rna genes in leptospira interrogans and leptospira biflexa. | we determined the number of large ribosomal rna genes in five strains of leptospira by hybridization of 15 restriction endonuclease digests of genomic dna to the [32p]-labeled fragment of 23s rrna gene. almost all the restriction gels gave two radioactive bands. the conclusion from these results is that there are at least two rrna genes in these leptospiral strains. furthermore, the hybridization patterns of l. icterohaemorrhagiae strains ictero no. i and rga are almost identical. the number of ... | 1989 | 2475749 |
| identification and nucleotide sequence of the leptospira biflexa serovar patoc trpe and trpg genes. | leptospira biflexa is a representative of an evolutionarily distinct group of eubacteria. in order to better understand the genetic organization and gene regulatory mechanisms of this species, we have chosen to study the genes required for tryptophan biosynthesis in this bacterium. the nucleotide sequence of the region of the l. biflexa serovar patoc chromosome encoding the trpe and trpg genes has been determined. four open reading frames (orfs) were identified in this region, but only three orf ... | 1989 | 2703466 |
| nucleotide sequence analysis of a gene cloned from leptospira biflexa serovar patoc which complements an arge defect in escherichia coli. | the genus leptospira, as a member of the order spirochaetales, forms one of the most ancient evolutionary branches of the eubacteria. these spirochetes are morphologically and physiologically different from most eubacteria, and little is known about leptospira genetics. in this communication, we report the first nucleotide sequence of a leptospira gene. a gene which complements an arge mutation in escherichia coli was isolated from a plasmid-based genomic library composed of leptospira biflexa s ... | 1988 | 2844724 |
| enzyme activities of the strains belonging to family leptospiraceae detected by the api zym system. | a total of 32 strains of the family leptospiraceae (23 strains of leptospira interrogans, 6 strains of leptospira biflexa, 2 strains of leptonema and 1 strain of leptospira parva) were examined for enzyme activities using 89 substrates (api zym system). more than 90% of the strains belonging to the family leptospiraceae possessed strong activities of beta-d-galactosidase, beta-d-glucosidase and 5 esterases (c5, c6, c8, c9 and c10). more than 90% of the strains belonging to the genus leptospira, ... | 1987 | 2892326 |
| analysis of cloned dna from leptospira biflexa serovar patoc which complements a deletion of the escherichia coli trpe gene. | to analyze the cloned region of the chromosome of the spirochete leptospira biflexa serovar patoc which complemented a defect in the trpe gene of escherichia coli, we performed a series of experiments involving subcloning, transposon mutagenesis, and maxicells. by subcloning into pbr322 we were able to isolate the leptospira genes on a 9.7-kilobase pair plasmid (pyc6). transposon mutagenesis with tn5 identified a 2.8-kilobase pair region of this plasmid as being necessary to complement a trpe de ... | 1986 | 3001031 |
| mechanism of streptomycin resistance in leptospira biflexa strain urawa. | the mechanism of streptomycin resistance of leptospira biflexa was investigated. a streptomycin-resistance mutant of leptospira showed cross-resistance to dihydrostreptomycin but not to other antibiotics. enzymatic inactivation of the drug could not be demonstrated in this mutant. protein synthesis on the ribosomes from the mutant was insensitive to streptomycin. these results suggest that ribosomal resistance is the reason for streptomycin resistance in leptospira biflexa. | 1988 | 3173149 |
| serological survey of leptospiral antibodies in cattle in zimbabwe. | a total of 2,382 sera from 92 herds widely distributed throughout zimbabwe were screened using the microscopic agglutination test against representatives of 18 serogroups of leptospira interrogans and one representative of leptospira biflexa. the prevalence of leptospiral titres at a serum dilution of 1:100 was 27%, the most common titres being to antigens from the sejroe and tarassovi serogroups. significantly different proportions of titres were shown among the three farming systems and among ... | 1987 | 3424449 |
| interactions of virulent and avirulent leptospires with primary cultures of renal epithelial cells. | a primary culture system for the cells of mouse renal-tubular epithelium was established and used to observe the adhesion of leptospires. virulent strains of serovars copenhageni and ballum attached themselves to epithelial cells within 3 h of infection whereas an avirulent variant of serovar copenhageni did not adhere to epithelial cells at all within the experimental period of 24 h. the saprophytic leptospira biflexa serovar patoc became attached non-specifically to inert glass surfaces as wel ... | 1986 | 3512834 |
| heterogeneity of lipopolysaccharide banding patterns in leptospira spp. | strains of leptospira interrogans and leptospira biflexa, examined by electrophoresis after whole cell lysis and protein digestion, revealed the presence of 2-keto-3-deoxyoctonate and an heterogeneous lipopolysaccharide electrophoretic banding pattern, which was characteristic of the species. | 1986 | 3760822 |
| antigenic population changes of leptospira biflexa strains grown under the selective pressure of factorial antibodies. | serovars jequitaia and tororò of leptospira biflexa were cultured in the presence of homologous factor serum containing factorial antibodies (fcabs) to their major antigens. after 39 serial passages they were then re-tested to determine whether their major antigens had remained unchanged. it was found that each parent strain had been replaced by an antigenic variant. the disappearance of each parent strain and its replacement by an antigenic variant was attributed to the selective conditions imp ... | 1985 | 4020340 |
| [the use of an antigen of the patoc strain of leptospira biflexa in field investigations of leptospirosis]. | | 1965 | 4221169 |
| contamination of bacteriological media by leptospira biflexa. | contamination of media with a strain of leptospira biflexa was traced to the deionized water supply. the leptospiral contaminant appeared in media sterilized by filtration through 0.45- and 0.22-mum pore size membrane filters. | 1974 | 4417715 |
| on the contamination of cell cultures by leptospira biflexa. | | 1974 | 4476725 |
| purification of polysaccharide antigen from leptospira biflexa strain urawa. | serologically active polysaccharide was isolated from the cells of leptospira biflexa strain urawa and purified. the constituents of this polysaccharide were characterized, and its serological specificity was partially examined. | 1972 | 4637612 |
| evaluation of leptospira biflexa antigens for screening human sera by the microscopic agglutination (ma) test in comparison with the sensitized-erythrocyte-lysis (sel) test. | | 1974 | 4839075 |
| [experience with leptospira biflexa antigens in laboratory diagnosis of suspect cases of leptospirosis]. | | 1969 | 5394173 |
| phospholipase a activity in leptospira biflexa. | | 1970 | 5506586 |
| natural antibody in mammalian serum reacting with an antigen in some leptospires. | serum from normal mammals agglutinated and immobilized nonpathogenic leptospira biflexa and agglutinated avirulent lines of pathogenic serotypes l. icterohaemorrhagiae and l. zanoni. virulent lines of l. icterohaemorrhagiae and l. zanoni were not affected, nor were any of three strains of l. pomona, one of which was avirulent. the active principle in serum was a beta-macroglobulin which was heat-labile and reduced by 2-mercaptoethanol, and acted in conjunction with complement and lysozyme; it wa ... | 1968 | 5640374 |
| the nature of antibodies synthesized during the immune response to leptospira biflexa. | | 1965 | 5845875 |
| [use of the leptospira biflexa patoc antigen in the serodiagnosis of leptospirosis]. | | 1967 | 6031422 |
| screening tests in human serum samples with leptospira biflexa antigens incorporated in galton's macroscopic slide test. | | 1967 | 6034623 |
| serological interrelationship of leptospira serovar and genus-specific antigens by enzyme-linked immunosorbent assay. | the serological interrelationship of a sonicated antigen (pom-s) and an alkali-extracted "fraction 4" antigen (pom-f4) from leptospira interrogans serovar pomona, and an ethanol-precipitated (pat-e) and a formolized, sonicated antigen (pat-f) from leptospira biflexa serovar patoc were investigated. the serological responses of rabbits immunized with these antigens were examined by the enzyme-linked immunosorbent assay (elisa), the microscopic agglutination test, and the 2-mercaptoethanol microsc ... | 1984 | 6084016 |
| cloning of a gene required for tryptophan biosynthesis from leptospira biflexa serovar patoc into escherichia coli. | a clone bank, consisting of approx. 8100 colonies, has been created for the spirochete leptospira biflexa serovar patoc in escherichia coli using pbr322 as the vector. one of these clones contains the genetic information needed to complement a defect in the trpe gene of e. coli. the information resides on a 20.5-kb plasmid designated pyc1, which carries a 16-kb insert consisting of three hindiii fragments. it does not complement defects in other genes needed for the biosynthesis of tryptophan in ... | 1984 | 6376283 |
| sugar synthesis in leptospira. ii. presence of glyoxylate cycle enzymes. | the presence and some properties of the key enzymes of the glyoxylate cycle, isocitrate lyase (threo-ds-isocitrate glyoxylate-lyase, ec 4.1.3.1) and malate synthase (l-malate glyoxylate-lyase (coa-acetylating) ec 4.1.3.2), were investigated in leptospira biflexa. isocitrate lyase activity was found for the first time in the organism. the enzyme was induced by ethanol but not by acetate. the optimum ph was 6.8. the activity was inhibited by phosphoenolpyruvate, a specific inhibitor of isocitrate ... | 1984 | 6472133 |
| serodiagnosis of canine leptospirosis by solid-phase enzyme-linked immunosorbent assay. | an enzyme-linked immunosorbent assay (elisa) to detect antibodies to leptospira interrogans serotype canicola in dogs was developed and evaluated. comparison of the elisa with the microscopic agglutination test (mat) showed that, during the first two weeks after an experimental infection with serotype canicola, the elisa detected antibody at higher dilutions than the mat. after the second week post-infection both tests detected antibody at almost equal titres (r = 0.89). the outer envelope (oe) ... | 1984 | 6485246 |
| phospholipases of leptospira. i. presence of phospholipase a1 and lysophospholipase in leptospira biflexa. | the hydrolysis of phosphatidylethanolamine, phosphatidylcholine, lysophosphatidylcholine, and trioleoylglycerol by leptospira biflexa strain urawa was studied in vitro. phospholipase a1 was identified by the formation of 32p- and 14c-labeled lysoderivatives from 32p-phosphatidylcholine, 32p-phosphatidylethanolamine, or 1-acyl-2-[1-14c]oleoyl-sn-glycero-3-phosphorylcholine. phospholipase a1 activity was independent of lipase in the microorganism since 14c-labeled trioleoylglycerol was scarcely at ... | 1984 | 6493072 |
| role of specific antibody in interaction of leptospires with human monocytes and monocyte-derived macrophages. | it has previously been shown that human neutrophils ingest and kill nonpathogenic leptospira biflexa in the absence of serum but that pathogenic leptospira interrogans is not ingested by neutrophils even in the presence of normal serum. we extended this study by examining the interactions of human monocytes and monocyte-derived macrophages with pathogenic l. interrogans (serovar icterohaemorrhagiae) and evaluating the opsonizing effect of serotype-specific immune serum on the phagocytosis of pat ... | 1984 | 6500713 |
| activation of complement by leptospires and its bactericidal activity. | bactericidal activity of complement was found to be effective on saprophytic leptospira biflexa strains and not on leptospira interrogans strains, by means of viable counting; the killing effect on saprophytic strains was probably due to a direct activation of the complement system via the alternative pathway. on the contrary the pathogenic strains seemed to activate the complement at a lower extent and were, in any case, resistant to the lytic action of the activated complement. | 1983 | 6675348 |
| interaction of leptospires with human polymorphonuclear neutrophils. | the role of the polymorphonuclear neutrophils (pmn) in defense against leptospires has not been adequately studied, in part, because of difficulty in quantitating pathogenic leptospires. by using pour plates to quantitate nonpathogenic leptospires and the most-probable-number procedure to quantitate the pathogenic leptospires, we examined the interactions of nonpathogenic leptospira biflexa and pathogenic leptospira interrogans serovar icterohemorrhagiae with human neutrophils. phase-contrast, s ... | 1984 | 6715045 |
| sugar synthesis in leptospira. i. presence of glucosephosphate isomerase. | the presence of glucosephosphate isomerase, one of the key enzymes in carbohydrate metabolism, was confirmed for the first time in the cell-free extract of leptospira biflexa. the glucosephosphate isomerase of l. biflexa was heat-labile and its optimum ph was about 8.5. the enzyme showed an optimal temperature of about 45 c but was more stable at 30 c. km value of the enzyme was 5.6 x 10(-3)m. the activity of the enzyme was inhibited by the inhibitor, 6-phosphogluconate. from this study, the pre ... | 1984 | 6727717 |
| adhesion of leptospira at a solid-liquid interface: a model. | two strains of the saprophytic leptospira biflexa serovar patoc display reversible and irreversible adhesion at a solid-liquid interface. both forms of adhesion are enhanced in the presence of 20 microm carbonyl cyanide meta-chlorophenyl hydrazone (cccp), an uncoupler which inhibits motility of the bacteria. microscopic observations also indicated that motility may have a role in adhesion as only actively motile organisms were seen to detach from the substratum. a dynamic model is proposed for a ... | 1984 | 6742958 |
| aminopeptidase activity of leptospira strains. | a total of 15 cultures of leptospira were examined for aminopeptidase activity using 22 aminoacyl-beta-naphthylamde substrates. activity was demonstrated in each of the cultures. extracts from serovars of leptospira interrogans preferentially hydrolysed the same range of substrates. the level of hydrolysis of the preferred substrates for the seven strains of l. interrogans was distinctively higher than that demonstrated for the six leptospira biflexa strains. extracts from cultures of leptospira ... | 1983 | 6842179 |
| human leptospirosis in somalia: a serological survey. | sera from somalis of both sexes between the ages of 16 and 60 were examined for leptospiral agglutinins. 37% of 105 apparently healthy individuals living in the arid mogadishu area were positive, as were 64% of 107 schistosomiasis patients living in two villages on the shabeele river (50.5% over-all). pools of sera from similar subjects, as well as leprosy patients living on the juba river and patients in mogadishu hospitals with suspected viral hepatitis showed a similar prevalence rate of 56%. ... | 1982 | 6980503 |
| distribution of superoxide dismutase, catalase, and peroxidase activities among treponema pallidum and other spirochetes. | representative members of spirochaetales were surveyed for their content of superoxide dismutase (sod), catalase, and peroxidase activities. only leptospira exhibited peroxidase activity. obligately anaerobic cultivable treponema and spirochaeta possessed no sod or peroxidative capabilities. upon polyacrylamide gel electrophoresis, spirochaeta aurantia, borrelia hermsi, and five leptospira biflexa serovars showed sod activity associated with one electrophoretic band which was inhibited by h2o2, ... | 1981 | 7024127 |
| the macroscopic agglutination reaction with leptospira biflexa antigens used as a screening test for the human leptospirosis. | | 1982 | 7115056 |
| immunosuppression in bovine trypanosomiasis. the establishment of "memory" in cattle infected with t. congolense and the effect of post infection serum on in vitro (3h)-thymidine uptake by lymphocytes and on leucocyte migration. | cattle infected with trypanosoma congolense were intravenously immunized with leptospira biflexa 15 days after trypanosomal infection. the primary immune response to l. biflexa was considerably reduced as compared to uninfected controls. the infected cattle mounted a secondary response when they were cured of trypanosomes by treatment with berenil 25 days after infection and re-immunized 8 days later. the mean secondary response in these previously infected animals was lower tha, but not signifi ... | 1980 | 7376244 |
| characterization of leptospiral catalase and peroxidase. | peroxidase from leptospira biflexa strain b-16 ad catalase from leptospira interrogans canicola hond utrecht were characterized and compared and both appeared to be heme enzymes as judged by their inhibition profiles and rapid inactivation during catalysis. neither enzyme exhibited monovalent or divalent cation requirements. dialysis of cell-free extracts resulted in loss of peroxidase activity but catalase was unaffected by this procedure. peroxidase had a km for h2o2 of 12.5 microm while catal ... | 1980 | 7407701 |
| isolation of leptospira biflexa from commercially prepared deionized water labeled "sterile for tissue culture". | leptospira biflexa were isolated from urine cultures of two patients with clinical and laboratory findings compatible with leptospirosis. neither patient had detectable leptospiral agglutinins. the source of the l. biflexa was water labeled " "sterile for tissue culture" purchased from m. a. bioproducts, formerly microbological associates. m. a. bioproducts water is sterilized by filtration through a 0.22-mum-pore size membrane filter. leptospiral contamination can occur in products sterilized b ... | 1980 | 7419696 |
| [evaluation of the counterimmunoelectrophoresis technique for the serologic diagnosis of leptospirosis]. | the counterimmunoelectrophoresis (cie) technic was assessed for leptospirosis serological diagnosis by using an antigenic preparation from leptospira biflexa patoc i strain. it was showed that the cie technic had 82% sensitivity and 100% specificity. the antigen used showed a gender-specific reactivity on detecting antibodies in patients infected by different leptospirosis serogroups by microagglutination test. antigen stability for cie technic was 6 months without loss of titre. | 1993 | 7800895 |
| detection of leptospiral dna by pcr. | an ecori fragment (1.2 kb) which is highly conserved among leptospira interrogans isolated in korea was cloned into pbluescript vector from l. interrogans serovar lai wh20. the ecori fragment was sequenced, and a pair of primers (lp1 and lp2) was designed for pcr assay. pcr amplification of target dna obtained from cultured l. interrogans showed that 274 bp could be detected when as little as 100 fg of leptospiral genomic dna was used in the reaction mixture. no amplification of dna was detected ... | 1994 | 8027306 |
| [amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr]. | based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ... | 1993 | 8288193 |
| chromosomal rearrangement and serovar conversion in leptospira biflexa strains. | a bacterial population change involving chromosomal rearrangement and phenotypic changes in antigens, proteins and lipopolysaccharides is described for strains of leptospira biflexa that were previously grown in media containing homologous oligoclonal antibodies. the chromosomal rearrangement phenomenon showed that the variants differed from the parent strains, yet they were similar to phenotypically related serovars already occurring in nature. accordingly, in vitro serovar conversion mediated ... | 1993 | 8353321 |
| antimicrobial activity of two bactenecins against spirochetes. | bac5 and bac7 are antimicrobial peptides of bovine neutrophils that act on enteric gram-negative bacteria. we report here that these two peptides immobilize and kill leptospira interrogans and leptospira biflexa with mbcs of 6 to 25 micrograms/ml. conversely, although both peptides bind to borrelia burgdorferi, the organism is resistant to their action. | 1993 | 8514417 |
| sequence of the leptospira biflexa serovar patoc reca gene. | the nucleotide (nt) sequence of the reca gene of leptospira biflexa serovar patoc strain patoc i has been determined. the deduced amino acid (aa) sequence of the reca protein is 387 aa long with a predicted molecular mass of 42,355 da. the aa sequence has a high degree of identity to the aa sequences of many bacterial reca, including pseudomonas fluorescens, escherichia coli and bacillus subtilis. this is the first reca sequence reported for a bacterium in the order spirochaetales. | 1995 | 8566806 |
| [homology study of leptospires in china with the ompl1 gene]. | southern hybridization analysis with the ompl1 gene was performed. the results of probing ecori-restricted genomic dna from 18 strains in china showed that the homology fragments of ompl1 gene were presented in 12 pathogenic leptospira strains: sero-group icterohaemorrhagiae (2 strains), canicola, ballum, pyrogenes, autumnalis, australis, pomona, grip-potyphosa, hebdomadis, bataviae, and sejroe, but they were not presented in the nonpathogenic leptospira biflexa strain patoc i, leptonema illini ... | 1995 | 8586385 |
| rapid distinction between leptonema and leptospira by pcr amplification of 16s-23s ribosomal dna spacer. | the pcr amplification of the genomic dna of leptonema illini strain 3055 using primers directed against conserved regions of the rrna operon provided evidence that the 16s and 23s rrna genes were linked via an intergenic spacer region. the sequencing of the intergenic spacer region indicated that it was 435 nucleotides in length and sequence similarity searches revealed that it bore no homology to any known sequences including trna available in databases. further investigations using southern bl ... | 1996 | 8759793 |
| invasion of vero cells and induction of apoptosis in macrophages by pathogenic leptospira interrogans are correlated with virulence. | interactions of virulent leptospira interrogans serovar icterohaemorrhagiae strain verdun with vero cells (african green monkey kidney fibroblasts) and a monocyte-macrophage-like cell line (j774a.1) were assayed by a double-fluorescence immunolabelling method. infectivity profiles were investigated according to (i) the duration of contact between leptospires and eukaryotic cells and (ii) the number of in vitro passages after primary isolation from lethally infected guinea pigs. comparative exper ... | 1997 | 9009336 |
| rapid distinction between leptospira interrogans and leptospira biflexa by pcr amplification of 23s ribosomal dna. | bacterial specific primers were used to amplify 23s rrna genes from a representative strain from each of the 23 serogroups of the pathogenic leptospira interrogans and 8 strains from 6 serogroups of the non-pathogenic leptospira biflexa. only regions of extreme variability, which had been identified on the basis of homology-based search of all the 23s rrna sequences available in genbank database, were sequenced from the amplified products. pcr primers that had the potential to distinguish l. int ... | 1997 | 9163900 |
| development and initial evaluation of an indirect enzyme-linked immunosorbent assay for the detection of leptospira interrogans serovar hardjo antibodies in bovine sera. | outer sheath antigen from leptospira interrogans serovar hardjo type hardjoprajitno and acetic acid extracted antigens from serovar hardjo types hardjoprajitno and hardjobovis were evaluated in an immunoassay for ability to detect hyperimmune rabbit serum to serovar hardjo. the degree of cross-reactivity with hyperimmune rabbit sera to l. interrogans serovars pomona, copenhageni, grippotyphosa, canicola and sejroe, and leptospira biflexa serovar patoc was also measured for each antigen. all of t ... | 1997 | 9342449 |
| development of a monoclonal antibody-based competitive enzyme-linked immunosorbent assay for the detection of leptospira borgpetersenii serovar hardjo type hardjobovis antibodies in bovine sera. | a murine monoclonal antibody (designated m553) that binds to an epitope on whole cell antigens prepared from leptospira borgpetersenii serovar hardjo type hardjobovis and leptospira interrogans serovar hardjo type hardjoprajitno, was produced and incorporated into a competitive enzyme-linked immunosorbent assay for the detection of bovine antibodies to serovar hardjo. the epitope recognized by m553 was susceptible to periodate oxidation. the m553 antibody was characterized by western blot with h ... | 1997 | 9342450 |
| identification of pathogenic leptospira genospecies by continuous monitoring of fluorogenic hybridization probes during rapid-cycle pcr. | partial sequences of 23s rrna gene pcr products from 23 strains of 6 pathogenic leptospira genospecies and from 8 strains of the saprophytic leptospira biflexa were determined. sequence analyses enabled leptospira genus-specific amplification primers and pathogen-specific fluorogenic adjacent hybridization probes to be designed and synthesized. a pcr protocol was developed in which changes in fluorescence emission resulting from specific annealing of fluorogenic adjacent hybridization probes to ... | 1997 | 9399509 |
| evaluation of the indirect hemagglutination assay for diagnosis of acute leptospirosis. | serology plays an important role in the diagnosis of leptospirosis. few laboratories have the resources and expertise to perform the microscopic agglutination test. there is a need for rapid and simple serological tests which facilitate the early diagnosis of leptospirosis, while antibiotic therapy may be most effective. a commercially available indirect hemagglutination assay (iha; mrl diagnostics, cypress, calif.) was evaluated with multiple serum specimens from 107 patients being investigated ... | 1998 | 9431911 |
| characterization of leptospiral outer membrane lipoprotein lipl36: downregulation associated with late-log-phase growth and mammalian infection. | we report the cloning of the gene encoding a 36-kda leptospiral outer membrane lipoprotein, designated lipl36. we obtained the n-terminal amino acid sequence of a staphylococcal v8 proteolytic-digest fragment in order to design an oligonucleotide probe. a lambda-zap ii library containing ecori fragments of leptospira kirschneri dna was screened, and a 2.3-kb dna fragment which contained the entire structural lipl36 gene was identified. several lines of evidence indicate that lipl36 is lipid modi ... | 1998 | 9529084 |
| production and characterization of monoclonal antibodies specific for leptospira borgpetersenii serovar hardjo type hardjobovis and leptospira interrogans serovar hardjo type hardjoprajitno. | murine monoclonal antibodies were produced by immunizing balb/c mice with a killed whole-cell antigen prepared from leptospira borgpetersenii serovar hardjo type hardjobovis. six of these antibodies recognized epitopes on the homologous antigen and on whole-cell antigen prepared from leptospira interrogans serovar hardjo type hardjoprajitno. these antibodies did not cross-react with whole-cell antigens prepared from l. borgpetersenii serovar sejroe, 10 other pathogenic leptospira serovars, or th ... | 1999 | 9918336 |
| identification of leptospira biflexa by real-time homogeneous detection of rapid cycle pcr product. | sequence analysis of 16s rrna genes extracted from nucleic acids databases enabled the identification of a leptospira biflexa (l. biflexa) signature sequence, against which a reverse primer designated l613, was designed. this primer, when used in conjunction with a universal bacterial specific forward primer designated fd1, enabled the development of a lightcycler-based pcr protocol in which fluorescence emission due to binding of sybr green i dye to amplified products could be detected and moni ... | 1999 | 10076627 |
| international multicenter evaluation of the clinical utility of a dipstick assay for detection of leptospira-specific immunoglobulin m antibodies in human serum specimens. | we performed a multicenter evaluation of a robust and easily performed dipstick assay for the serodiagnosis of human leptospirosis. the assay is aimed at the detection of leptospira-specific immunoglobulin m (igm) antibodies. the study involved 2,665 serum samples collected from 2,057 patients with suspected leptospirosis in 12 countries on five continents with different levels of endemicity and different surveillance systems. the patients were grouped as laboratory-confirmed leptospirosis case ... | 1999 | 10449473 |
| molecular evidence for a new bacteriophage of borrelia burgdorferi. | we have recovered a dnase-protected, chloroform-resistant molecule of dna from the cell-free supernatant of a borrelia burgdorferi culture. the dna is a 32-kb double-stranded linear molecule that is derived from the 32-kb circular plasmids (cp32s) of the b. burgdorferi genome. electron microscopy of samples from which the 32-kb dna molecule was purified revealed bacteriophage particles. the bacteriophage has a polyhedral head with a diameter of 55 nm and appears to have a simple 100-nm-long tail ... | 1999 | 10572135 |
| phosphofructokinase activities within the order spirochaetales and the characterisation of the pyrophosphate-dependent phosphofructokinase from spirochaeta thermophila | the subtype of phosphofructokinase activity, either atp-, adp- or pyrophosphate-dependent, present in members of three genera from the spirochaetales was investigated. the individual species/strains examined included spirochaeta alkalica, s. asiatica, s. halophila, s. isovalerica, s. litoralis, s. zuelzerae, s. thermophila, two thermophilic spirochetes, treponema bryantii, t. denticola, paragraph signt. pectinovorum, leptospira biflexa and l. interrogans. all of the spirochaeta strains, regardle ... | 1999 | 10591850 |
| monoclonal antibodies suitable for incorporation into a competitive enzyme-linked immunosorbent assay (elisa) for detection of specific antibodies to leptospira interrogans serovar pomona. | monoclonal antibodies (mab) were produced by fusing sp2/0-ag14 myeloma cells with spleen cells from balb/c and nd4 mice that were immunized with killed leptospira interrogans serovar pomona whole cells. thirty hybridomas which produced antibodies (of the igg1, igg2a, igg2b, or igg3 isotype) that bound to epitopes on the serovar pomona whole cell antigen were identified by an indirect enzyme-linked immunosorbent assay (elisa). twenty-eight of these 30 mabs cross-reacted in the indirect elisa with ... | 2000 | 10665542 |
| the leptospiral major outer membrane protein lipl32 is a lipoprotein expressed during mammalian infection. | we report the cloning of the gene encoding the 32-kda lipoprotein, designated lipl32, the most prominent protein in the leptospiral protein profile. we obtained the n-terminal amino acid sequence of a staphylococcal v8 proteolytic-digest fragment to design an oligonucleotide probe. a lambda-zap ii library containing ecori fragments of leptospira kirschneri dna was screened, and a 5.0-kb dna fragment which contained the entire structural lipl32 gene was identified. several lines of evidence indic ... | 2000 | 10722630 |
| direct molecular typing of borrelia burgdorferi sensu lato species in synovial samples from patients with lyme arthritis. | since lyme arthritis was first described in the united states, it has now been reported in many countries of europe. however, very few strains of the causative bacterium, borrelia burgdorferi, have been isolated from synovial samples. for this reason, different molecular direct typing methods were developed recently to assess which species could be involved in lyme arthritis in europe. we developed a simple oligonucleotide typing method with pcr fragments from the flagellin gene of b. burgdorfer ... | 2000 | 10790118 |
| rpob gene analysis as a novel strategy for identification of spirochetes from the genera borrelia, treponema, and leptospira. | spirochetes are emerging pathogens for which culture and identification are partly unresolved. in fact, 16s rrna-based sequencing is by far the most widely used pcr methodology that is able to detect such uncultivable pathogens. however, this assay actually has some limitations linked to potential problems of contamination, which hampers diagnosis. to circumvent this, we have devised a simple pcr strategy involving targeting of the gene encoding the rna polymerase beta subunit (rpob), a highly c ... | 2000 | 10834976 |
| the le1 bacteriophage replicates as a plasmid within leptospira biflexa: construction of an l. biflexa-escherichia coli shuttle vector. | we have discovered that le1, one of the plaque-forming phages previously described as lytic for the leptospira biflexa saprophytic spirochete (i. saint girons, d. margarita, p. amouriaux, and g. baranton, res. microbiol. 141:1131-1138, 1990), was indeed temperate. le1 was found to be unusual, as southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. the unavailability of such small endogenous replicons has hindered genetic expe ... | 2000 | 11004167 |
| utilization of exocellular mannan from rhodotorula glutinis as an immunoreactive antigen in diagnosis of leptospirosis. | previously, rhodotorula glutinis was reported to produce a large amount of exocellular mannan, having a repeating unit of -->3)-d-manp-(1-->4)-d-manp-(1-->. recently, we found that antigenic polysaccharides of leptospira biflexa serovar patoc strain patoc i have the same repeating unit and cross-react with antisera raised against extended strains of other leptospires (k. matsuo, e. isogai, and y. araki, carbohydr. res., in press). this structural identity and the difficulty of producing and isol ... | 2000 | 11015396 |
| occurrence of [--> 3)-beta-d-manp-(1 --> 4)-beta-d-manp-(1 -->]n units in the antigenic polysaccharides from leptospira biflexa serovar patoc strain patoc i. | in this study, we isolated three kinds of antigenic polysaccharide components (tentatively designed as ap-1-3) from cells of leptospira biflexa serovar patoc strain patoc i (l. biflexa patoc patoc i) by the hot phenol-water procedure, followed by treatment with mild acid and column chromatography. two of them (ap-1 and ap-2) were recovered from the phenol-soluble fraction whereas another (ap-3) was recovered from the aqueous fraction. all of them reacted toward an anti-l. biflexa serum and also ... | 2000 | 11093707 |
| control of immunologically crossreactive leptospiral infection by administration of lipopolysaccharides from a nonpathogenic strain of leptospira biflexa. | in our previous paper (matsuo, k., isogai, e., and araki, y., carbohydr. res., 328: 517-524, 2000), antigenic polysaccharides obtained from the lipopolysaccharide (lps) fraction of a nonpathogenic leptospira, leptospira biflexa patoc patoc i, are shown to be broadly crossreactable with most rabbit antisera elicited by immunization with various pathogenic leptospires. the result led us to test a protective effect of the same lps in a hamster model system by heterologously challenging with a patho ... | 2000 | 11145268 |
| leptospirosis in kuala lumpur and the comparative evaluation of two rapid commercial diagnostic kits against the mat test for the detection of antibodies to leptospira interrogans. | the aim of the study was to look into the epidemiology of serodiagnosed cases of leptospirosis at the university hospital and compare two commercial elisa assays to the microscopic agglutination test (mat). demographic data for all serodiagnosed cases for the years 1991-1997 were collected. from this data, 104 sera (n = 104) were selected as samples for comparative evaluation of the commercial elisas (indx dip-s-ticks and panbio elisa) to the mat test. thirty two (n = 32) negative control sera w ... | 2000 | 11256343 |