| complemented palindromic small rnas first discovered from sars coronavirus. | in this study, we report for the first time the existence of complemented palindromic small rnas (cpsrnas) and propose that cpsrnas and palindromic small rnas (psrnas) constitute a novel class of small rnas. the first discovered 19-nt cpsrna uuaacaagcuuguuaaaga, named sars-cov-cpsr-19, was detected from a 22-bp dna complemented palindrome tctttaacaagcttgttaaaga in the severe acute respiratory syndrome coronavirus (sars-cov) genome. the phylogenetic analysis supported that this dna complemented p ... | 2018 | 30189613 |