Publications
Title | Abstract | Year Filter | PMID(sorted ascending) Filter |
---|
use of cross-linking in studying the structure of rna tumour viruses. | treatment of intact avian myeloblastosis virus (amv) with dimethyl suberimidate dihydrochloride (dms), a cross-linking agent specific for amino groups, was found to result in progressive cross-linking among viral proteins, as revealed by polyacrylamide gel electrophoresis (page) in the presence of sodium dodecyl sulphate (sds). free viral proteins were not cross-linked. the cross-linked protein complex with an apparent molecular weight of 50,000 daltons was studied in detail. | 1976 | 9823 |
a study of the states of aggregation of alfalfa mosaic virus protein. | the states of aggregation of alfalfa mosaic virus (amv) protein have been characterized by sedimentation velocity experiments and electron microscopy. the main association product is a spherical particle with an s value of about 30s. it is highly likely that the assembly of this particle starts with dimers of the 25000 molecular mass unit resulting in an icosahedral particle made of 30 dimers. no intermediate aggregation products have been detected. the clustering pattern of the protein in the c ... | 1976 | 13424 |
transmission of alfalfa mosaic virus through nicandra physaloides seeds and its localization in embryo cotyledons. | alfalfa mosaic virus (amv) was found to be transmitted through seeds of nicandra physaloids l. the average seed transmission rate of the amv isolates t6, lmbg-4 and st amounted to 23, 4 and 0 per cent, repectively. in the cytoplasm of parenchyma cells of embryo cotyledons of seeds from plants infected with the t6 isolate, electron microscopy revealed amv aggregates of type 2a and aggregations of irregularly viral particles with a tendency to subparallel alignment, representing early stages of ty ... | 1977 | 20770 |
protein kinase from avian myeloblastosis virus. | a protein kinase associated with purified virions of avian myeloblastosis bai strain a was partially purified by ion-exchange chromatography and gel filtration. the transfer of phosphate catalyzed by this enzyme required a divalent metal ion and atp as phosphate donor. gtp could not be substituted for atp, and the reaction was unaffected by either cyclic amp or beef-heart protein-kinase inhibitor. of the virus and nonvirus proteins tested as phosphate acceptors, only acidic proteins were phospho ... | 1978 | 24125 |
studies on reverse transcriptase of rna tumor viruses. i. localization of thermolabile dna polymerase and rnase h activities on one polypeptide. | purified reverse transcriptase from avian myeloblastosis virus or rous sarcoma virus consists of two subunits of average mol wt of 100,000 and 60,000. the lower-molecular-weight subunit, alpha, has been isolated from avian myeloblastosis virus, rous sarcoma virus and a temperature-sensitive mutant of rous sarcoma virus, la337. subunit alpha manifests both the dna polymerase and rnase h activities associated with purified reverse transcriptase of avian rna tumor viruses. the thermal inactivation ... | 1975 | 46281 |
binding properties of avian myeloblastosis virus dna polymerases to nucleic acid affinity columns. | a new method for the analysis and purification of the rna-directed dna polymerase of rna tumor viruses has been developed. this nucleic acid affinity chromatography system utilizes an immobilized oligo (dt) moiety annealed with poly (a). the alpha and alphabeta dna polymerases of avain myeloblastosis virus bound effectively to poly (a) oligo (dt)-cellulose. alpha dna polymerase did not bind effectively to poly (a) oligo (dt)-cellulose, poly (a)-cellulose, or to cellulose. alphabeta bound to olig ... | 1975 | 46287 |
purification and characterization of the dna polymerase and rnase h activities in moloney murine sarcoma-leukemia virus. | two rnase h (rna-dna hybrid ribonucleotidohydrolase, ec 3.1.4.34) activities separable by sephadex g-100 gel filtration were identified in lysates of moloney murine sarcoma-leukemia virus (msv). the larger enzyme, which we have called rnase h-i, represented about 10% of the rnase h activity in the virion. rnase h-i (i) copurified with rna-directed dna polymerase from the virus, (ii) had a sedimentation coefficient of 4.4s (corresponds to an apparent mol wt of 70,000), (iii) required mn-2+ (2 mm ... | 1975 | 46924 |
studies on reverse transcriptase of rna tumor viruses iii. properties of purified moloney murine leukemia virus dna polymerase and associated rnase h. | dna polymerase was purified from a cloned isolate of moloney murine leukemia virus (m-mulv). purified m-mulv dna polymerase, upon analysis by polyacrylamide gel electrophoresis, showed one major polypeptide of mol wt 80,000. estimation of molecular weight from the sedimentation rate of the purifed enzyme in a glycerol gradient was consistent with a structure containing one polypeptide. m-mulv dna polymerase could transcribe ribopolymers, deoxyribopolymers, and heteropolymers as efficiently as di ... | 1975 | 46925 |
full length and discrete partial reverse transcripts of globin and chorion mrnas. | rabbit globin mrna was copied by amv reverse transcriptase in the presence of various concentrations of deoxyribonucleotides (dntps). the cdnas were analyzed by electrophoresis under denaturing conditions in formamide-polyacrylamide gels. discrete size products were detected, ranging from 65 to 650 nucleotides-that is, up to the full length of the mrna template. increasing the concentrations of all four dntps stimulated formation of full-length transcripts and made the incomplete copies less abu ... | 1975 | 47272 |
inhibition of rna-dependent dna polymerase of oncorna viruses by carbopol 934. | 1975 | 47299 | |
control of transcription of the globin gene. | this report provides a more rigorous proof of previous findings that the rna transcribed in vitro from the chromatins of different organs shows different sequence specificities. here the particular case of the globin gene is considered for a comparison of embryonic mouse liver chromatin and mouse brain chromatin using the reverse transcriptase cdna copy of globin 9s m rna as a definitive probe. it can be shown that globin sequences are transcribed in vitro from embryonic liver chromatin and not ... | 1975 | 47332 |
complexity of cytoplasmic rna in different mouse tissues measured by hybridization of polyadenylated rna to complementary dna. | the kinetics of hybridization of polyadenylated rna from mouse l-cells with complementary dna (cdna) synthesized with reverse transcriptase revealed three classes of differing abundance. the simplest interpretation requires three frequency classes representing polyadenylated rna; 5, 45, and 50 percent of the total polyadenylated rna and about 3, 300, and 7600 different rna sequences of 6 times 10-5 daltons, respectively. the complementary dna synthesized with l-cell polyadenylated rna as templat ... | 1975 | 47757 |
unique and repetitive sequences in multiple genes for feather keratin. | embryonic chick feather keratins are a family of homologous polypeptide chains. the mrna coding for these has been obtained in a pure state and transcribed into complementary dna (cdna) using the reverse transcriptase from avian myeloblastosis virus. studies on the kinetics of hybridisation and reannealing of cdna indicate that there are 25-35 different keratin mrna species in the embryonic chick feather, and a total of 100-240 keratin genes in the chick genome. each keratin gene contains both a ... | 1975 | 48196 |
synthesis of dna complementary to separated human alpha and beta globin messenger rnas. | human globulin messenger rna, purified by oligo(dt)-cellulose column chromatography, is reproducibly separated into two bands by polyacrylamide gel electrophoresis in the presence of 99% formamide. the more rapidly migrating (fast) band is somewhat more abundant than the slow band in normal (nonthalassemic) total reticulocyte globin messenger rna. in alpha-thalassemic (hb h disease) messenger rna, the slow band is 6.5 times more abundant than the fast band, whereas in beta-thalassemic messenger ... | 1975 | 48254 |
the binding of polynucleotides to the dna polymerase of avian myeloblastosis virus. | 1975 | 48357 | |
inhibition of reverse transcriptase activity of rna-tumor viruses by fagaronine+. | 1975 | 48379 | |
quantitation of avian rna tumor virus reverse transcriptase by radioimmunoassay. | a radioimmunoassay was developed that can detect and quantitate 3 ng or more of the avian rna tumor virus reverse transcriptase. the assay detected no antigenic sites in rous sarcoma virus alpha virions or in virions of a murine rna tumor virus. about 70 molecules of reverse transcriptase were found per virion of avian myleloblastosis virus with this assay or with an assay based on antibody inhibition of enzymatic activity. the assay detected about 270 ng of enzyme per mg of cell protein in viru ... | 1975 | 48558 |
analysis of antigenic determinants of structural polypeptides of avian type c tumor viruses. | radioimmunoassays were developed for the 19,000, 15,000, and 12,000 molecular weight polypeptides of avian myeloblastosis virus and for the 19,000 and 12,000 polypeptides of rav-0, a subgroup e avian tumor virus. each polypeptide was shown to possess both group- and type-specific antigenic determinants, in contrast to the 27,000 mol wt polypeptide, which contained only group-specific determinants. the corresponding low-molecular-weight polypeptides of subgroup a, b, and e viruses were shown to b ... | 1975 | 48560 |
ability of tryptophan trna to hybridize with 35s rna of avian myeloblastosis virus and to prime reverse transcription in vitro. | selected species of 4s rna of chick embryo cells will hybridize in vitro with 35s rna of avian myeloblastosis virus. a major trna component of the hybridizable 4s rna is tryptophan trna. a hybrid prepared from purified tryptophan tran and 35s rna of avian myeloblastosis virus in vitro is an efficient templateprimer for dna synthesis catalyzed by reverse transcriptase (rna-dependent dna polymerase). | 1975 | 49054 |
human globin gene analysis for a patient with beta-o/delta beta-thalassemia. | complementary dna (cdna) was prepared with rna-dependent dna polymerase from human globin messenger rna (mrna). annealing and translation experimenta with total mrna from circulating cells from a patient with heterozygous beta/heterozygous beta-delta-o thalassemia (beta-o/delta beta-o-thalassemia) demonstrated no detectable mrna for beta-globin. cdna enriched in sequences homologous to beta-globin mrna was prepared by hydroxylapatite fractionation of hybrids formed between beta-o/delta beta-o-th ... | 1975 | 49057 |
immunological properties of avian oncornavirus polypeptides. | 1975 | 49120 | |
the initial nucleotide sequence of dna transcribed from avian myeloblastosis virus 70 s rna by rna-dependent dna polymerase. | 1975 | 49976 | |
microwave excitation emission spectrometry. determination of picogram quantities of metals in metalloenzymes. | 1975 | 50024 | |
use of a specific probe for ovalbumin messenger rna to quantitate estrogen-induced gene transcripts. | dna complementary to purified ovalbumin messenger rna (cdna ov) was synthesized in vitro using rna-directed dna olymerase from avian myeloblastosis virus. this cdnaov was then employed in hybridization assays to determine the effect of estrogen on the number of ovalbumin mrna (mrnaov) molecules per tubular gland cell of the chick oviduct. the changes in mrnaov were measured in immature chicks during primary stimulation, after hormone withdrawal and again following secondary stimulation of the ch ... | 1975 | 50081 |
sequence relatedness between the subunits of avian myeloblastosis virus reverse transcriptase. | one- and two-diminsional tryptic and chymotryptic peptide maps of 125-i-labeled alpha and alphabeta avian myeloblastosis virus dna polymerase demonstrate that the alpha polypeptide of the one and two subunit enzymes are structurally similar, if not identical. furthermore, the beta subunit contains the same major 125i-labeled peptides as alpha, plus several additional peptides. these relationships and the fact that aging of purified alphabeta avian myeloblastosis virus dna polymerase increases th ... | 1975 | 50321 |
hybridization of pigeon globin messenger rna with complementary dna synthesized in vitro by reverse transcription: influence of the homopolymeric regions. | the kinetics of hybridization of pigeon globin messenger rna with complementary cdna synthesized by means of amv reverse transcriptase is complex. addition of poly a or poly u in excess to the reaction mixture normalized the kinetics. it is concluded that association of the complementary homopolymeric regions of mrna and cdna accelerates the complex formation between heteropolymeric sequences in a fraction of the molecules. | 1975 | 50588 |
effect of bleomycin on an rna-dna hybrid. | 1975 | 50843 | |
role of the subunits of the avian rna tumor virus reverse transcriptase. | 1975 | 50898 | |
reverse transcriptase and rnase h: present in a murine virus and in both subunits of an avian virus. | 1975 | 50901 | |
properties of oncornavirus rna-directed dna polymerase, the rna template, and the intracellular products formed early during infection and cell transformation. | we have investigated three aspects of rna turmor virus replication and cell transformation: (1) the properties of the purified avian and mammalian viral rna-directed dna polumerase, (2) some characteristics of the viral 60-70s rna genome, 30-40s rna subunits and intracellular viral rna species, and (3) the interaction of the viral dna polymerase with its rna template early during infection and cell transformation by the murine sarcoma-leukemia virus (msv[mlv]). avian myeloblastosis virus (amv) c ... | 1975 | 50902 |
inhibition of purified dna polymerase of rna tumor viruses by fluoranthene derivatives and analogues of tilorone hydrochloride. | at concentrations of 7 times 10(-6) to 7 times 10(-5) m, derivatives consisting of the polycylic ring structures fluoranthene, fluorenone, fluorene, anthraquinone, xanthenone, and dibenzofuran with appropriate amine side chains inhibited by over 90% the purified rna-directed dna polymerase of avian myeloblastosis virus acting on poly(deoxyadenylate-deoxythymidylate) [poly(da-dt)]. of these, only the fluoranthene derivatives were strong inhibitors of the viral dna polymerase directed by polyadeny ... | 1975 | 51087 |
quantitation of rna tumor viruses by spectroscopy of density gradient gels. | we have developed a system for virus particle quantitation based on the measurement of the optical absorbance of stained viruses which first have been banded at their buoyant density in an equilibrum 24 to 53% (wt/wt) sucrose density gradient, then fixed in position in the gradient by photopolymerizing an acrylamide-riboflavin mixture in the sucrose, and finally stained and destained. using plasma from mice infected with leukemia virus (rauscher) or chickens infected with avian myeloblastosis vi ... | 1975 | 51099 |
group-specific antigenic determinants of the large envelope glycoprotein of avian oncornaviruses. | 1975 | 51537 | |
sequences related to the rna tumor viruses in the rna and dna of human leukemias and lymphomas. | dna-rna hybridization was used to explore whether human neoplasias contain rna molecules having sequence homologies to those of the rna tumor viruses known to cause similar diseases in animals. the pattern of specific rnas found in the human tumors showed a remarkable concordance with the predictions deducible from the animal systems. thus human breast cancer contains rna homologous only to that of the murine mammary tumor virus (mmtv). human leukemias, sarcomas, and lymphomas (including hodgkin ... | 1975 | 51626 |
region of immunoglobulin light-chain mrna transcribed into complementary dna by rna-dependent dna polymerase of avian myeloblastosis virus. | the mrna coding for a kappa-type immunoglobulin light (l)-chain and its complementary dna (cdna) hybridize with a crt1/2 of 2.6 x 10(-4) moles of ribonucleotide x liter-1 x sec, forming well-matched duplexes (melting temperature tm equals 89 degrees). the molecular weight of the cdna is about 280,000 (840 nucleotides) as determined by alkaline sucrose gradient centrifugation and from the extent of protection of the mrna by the cdna from ribonuclease digestion. the cdna anneals with kappa-type mr ... | 1975 | 52155 |
specific binding of tryptophan transfer rna to avian myeloblastosis virus rna-dependent dna polymerase (reverse transcriptase). | the ability of tryptophan trna (trnatrp) to initiate reverse transcription of the 70s rna of avian rna tumor viruses suggested that the reverse transcriptase (rna-dependent dna polymerase; deoxynucleosidetriphosphate: dna deoxynucleotidyltransferase; ec 2.7.7.7) might have a specific binding site for the trna. a complex of trnatrp and the avian myeloblastosis virus reverse transcriptase has been demonstrated using chromatography on sephadex g-100 columns. of all the chicken trnas, only trnatrp a ... | 1975 | 52156 |
essential arginyl residues in reverse transcriptase. | 1975 | 52361 | |
transcription of 70s rna by dna polymerases from mammalian rna viruses. | dna polymerases purified by the same procedure from four mammalian rna viruses, simian sarcoma virus type 1, gibbon ape lymphoma virus, mason-pfizer monkey virus, and rauscher murine leukemia virus are capable of transcribing heteropolymeric regions of viral 70s rna without any other primer. in this reconstituted system the enzymes from simian sarcoma virus type 1, mason-pfizer monkey virus, and rauscher murine leukemia virus transcribe viral 70s rna almost as efficiently as the dna polymerase f ... | 1975 | 53295 |
dna-synthesis on giant nuclear rna by amv dna polymerase. | the reverse transcription of pre-mrna isolated from rat liver or mouse ehrlich ascites carcinoma cells with the aid of hot phenol fractionation technique is described. pre-mrna isolated at 85 degrees c is a more active template than the 65 degree c fraction. the addition of oligo(dt) as a primer strongly stimulated the template activity of the 65 degree c fraction. the size of product corresponds to a sedimentation value of 7 s as measured in alkaline sucrose gradient and is essentially less tha ... | 1975 | 53784 |
elimination of residual rnase activity from purified preparations of rna-directed dna polymerase. | 1975 | 54167 | |
calf lens messenger ribonucleoprotein complexes. characterization and comparison of template activity with corresponding mrnas. | lens messenger ribonucleoprotein complexes have been isolated from calf lens polysomes by sucrose gradient centrifugation after puromycin-induced dissociation. a 10 s mrna was released from a 13 s messenger ribonucleoprotein complex and a 14 s mrna from a 19 s messenger ribonucleoprotein complex. two major protein components with molecular weights of approx. 64 000 and 40 000 were isolated from each of the messenger ribonucleoprotein complexes after rnaase digestion. buoyant density determinatio ... | 1976 | 54193 |
the synthesis and properties of the complete complementary dna transcript of ovalbumin mrna. | the synthesis of a complementary dna copy (cdna) of hen ovalbumin mrna using amv rna-directed dna polymerase was studied under different conditions of salt, deoxyribonucleotide concentrations, temperature, and time. it was observed that in the absence of monovalent cation at 46 degrees c a complete transcript of ovalbumin mrna could be effected by the enzyme. the minimum deoxyribonucleotide requirement for complete synthesis was 35 mum for datp, dgtp, and dctp and 200 mum dttp. by a number of di ... | 1976 | 55272 |
mechanism of phosphonoacetate inhibition of herpesvirus-induced dna polymerase. | phosphonoacetate was an effective inhibitor of both the marek's disease herpesvirus- and the herpesvirus of turkey-induced dna polymerase. using the herpesvirus of turkey-induced dna polymerase, phosphonoacetate inhibition studies for the dna polymerization reaction and for the deoxyribonucleoside triphosphate-pyrophosphate exchange reaction were carried out. the results demonstrated that phosphonoacetate inhibited the polymerase by interacting with it at the pyrophosphate binding site to create ... | 1976 | 55273 |
[rna-directed dna synthesis in vitro: detection of polydeoxyadenylate in dna, complementary to antimessenger-dna]. | 1975 | 55338 | |
on the fidelity of dna replication. enzyme activities associated with dna polymerases from rna tumor viruses. | dna polymerase from rna tumor viruses ("reverse transcriptase") has been analyzed for activities which have been associated with other dna polymerases. homogeneous dna polymerase from avian myeoblastosis virus catalyzes pyrophosphate exchange and pyrophosphorolysis. pyrophosphate exchange is dependent on a template and is base-specific. with avian myeloblastosis virus dna polymerase, ribonucleotide templates are more efficient for synthesis while deoxyribonucleotide templates are more effective ... | 1976 | 55414 |
on the fidelity of dna replication. lack of exodeoxyribonuclease activity and error-correcting function in avian myeloblastosis virus dna polymerase. | homogeneous dna polymerase ("reverse transcriptase") from avian myeoblastosis virus was assayed for exodeoxyribonuclease activity. the substrates were defined template-initiator complexes in which different radioactive nucleotides were present at the 3'-oh termini of the initiator. even when the number of molecules of enzyme was equal to the number of initiator termini there was no significant release of radioactivity with any of the template-initiator combinations tested. under similar conditio ... | 1976 | 55415 |
[dna synthesis on the heterogeneous nuclear rna template catalysed by dna polymerase of avian myeloblastosis virus]. | template activity of nuclear pre-mrna has been investigated in dna-polymerase reaction. active synthesis of dna was demonstrated on pre-mrna as a template in the absence of primer. a part of synthetic activity may be attributed to the traces of dna present in the pre-mrna preparation. addition of oligo(dt)10 to the template stimulated the synthesis of dna product due to transcription of heteropolymeric regions near the poly(a). the rate of dna synthesis was different depending on the fraction of ... | 1975 | 55956 |
transcription of single base oligonucleotides by ribonucleic acid-directed deoxyribonucleic acid polymerase. | the synthesis of dna products complementary to artificial templates by the enzyme rna-directed dna polymerase isolated from avian myeloblastosis virus has been studied. of the single base polyribonucleotides, poly (rc), poly(ra), and poly(ri) were active while poly (rg) and poly (ru) were almost inactive. the minimum length showing activity for an oligo (rc) template was 9; the minimum primer length of oligo(dg) was 3 or 4. in order to examine the fidelity of transcription, single base oligoribo ... | 1976 | 55999 |
formation of an infectious virus-antibody complex with rous sarcoma virus and antibodies directed against the major virus glycoprotein. | preparations of rous sarcoma virus (rsv) can form an infectious viral-antibody complex with antibodies raised against the major glycoprotein, gp85, isolated from avian myeloblastosis virus and prague-rsv subgroup c. binding of anti-gp85 antibodies to rsv can be demonstrated by the inhibition of focus-forming activity after addition of goat anti-rabbit immunoglobulin and by a shift in density of virions treated with anti-gp85 serum. group- rather than subgroup- specific regions of viral gp85 appe ... | 1976 | 56458 |
dissociation of alpha beta dna polymerase of avian myeloblastosis virus by dimethyl sulfoxide. | the alpha beta dna polymerase of avian myeloblastosis virus was treated with dimethyl sulfoxide to dissociate the enzyme subunits. the dimethyl sulfoxide treated enzymes were passed over phosphocellulose to purify and characterize the dissociated subunits as well as to remove the dimethyl sulfoxide. rna-directed dna polymerase, rnase h, and nucleic acid-binding activity were monitored, as well as the subunit structure (on sodium dodecyl sulfate-polyacrylamide gels) of the various enzyme species ... | 1976 | 56461 |
mechanism of interaction of avian myeloblastosis virus reverse transcriptase with avian myeloblastosis virus rna. | the synthesis of dna on avian myeloblastosis virus (amv) rna as the primer-template using amv reverse transcriptase in vitro has been examined as a function of the concentrations of these components, as well as a function of the ionic strenth of the assay medium. the results are consistent with the hypothesis that two types of sites exist on the amv rna: inactive "dead-end" sites that merely bind the enzyme, and active binding sites that lead to dna synthesis. velocity sedimentation studies of r ... | 1976 | 56463 |
reverse transcriptase activity per virion for avian myeloblastosis virus and rauscher murine leukemia virus. | we have measured reverse transcriptase enzyme activity per virus particle for samples of avian myeloblastosis virus (bai strain) and murine leukemia virus (rauscher) using the synthetic template poly(rc)-oligo(dg). absolute virus concentrations were determined directly by laser beat frequency spectroscopy. enzyme activity per virion was determined from the slope of the activity plotted as a function of virus concentration. with this reverse transcriptase assay, the minimum activity (expressed as ... | 1976 | 56465 |
cycling of rna-directed dna polymerase on natural and synthetic rna templates. | 1976 | 56719 | |
preparation and characterization of myosin copy dna. | 1976 | 56938 | |
[study of the reproduction conditions of the avian myeloblastosis virus for separation of the "reverse transcriptase" enzyme]. | sensitivity of eight chick lines to the avian myeloblastosis virus as the main source for rna-dependent dna-polymerase recovery was studied in the course of the "revertase" project. the virus (0.1 ml) was inoculated intracardially or intraperitoneally to one-day chicks, and then the virus titer was determined according to the atp-activity. c and d-lines of the enya-cross were shown to be most sensitive (sensitivity 75%) among the lines studied. | 1975 | 56958 |
bovine leukemia virus: an exogenous rna oncogenic virus. | short-term cultures of bovine leukemic lymphocytes release virus particles with biochemical properties of rna oncogenic viruses. these particles, tentatively called bovine leukemia virus (blv), have a high molecular weight rna-reverse transcriptase complex and a density of 1.155 g/ml in sucrose solutions. molecular hybridizations between blv/[3h]cdna and several viral rnas show that blv is not related to mason-pfizer monkey virus, simian sarcoma associated virus, feline leukemia virus, or avian ... | 1976 | 57616 |
evidence for circularization of the avian oncornavirus rna genome during proviral dna synthesis from studies of reverse transcription in vitro. | the rna-directed dna polymerase (deoxynucleosidetriphosphate:dna deoxynucleotidyltransferase ec 2.7.7.7) of avian oncornavirus requires a tryptophan trna (trnatrp) primer molecule located close to the 5' end of the viral rna genome for the initiation of dna synthesis in vitro. in this communication we demonstrate that the dna product, transcribed from avian myeloblastosis virus (amv) 35s rna containing only trnatrp as primer, is located also at the 5' end of the rna genome. more importantly, we ... | 1976 | 57620 |
mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus dna polymerase. | storage of the dimeric (alphabeta) form of avian myeloblastosis virus (amv) dna polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. this reduction appears to be the result of cleavages introduced by traces o ... | 1976 | 58080 |
initiation of dna synthesis by the avian oncornavirus rna-directed dna polymerase: structural and functional localization of the major species of primer rna on the oncornavirus genome. | 1976 | 58468 | |
importance of full size complementary dna in nucleic acid hybridization. | the size of the dna product synthesized by rna-directed dna polymerase (isolated from avian myeloblastosis virus) was found to be important for complementary dna (cdna)-mrna hybridization reactions. incomplete cdna to rabbit reticulocyte globin mrna formed poor hybrids and presumably lacked sequences needed for hybridization. the size of the cdna synthesized was influenced by the reaction conditions used. the complementary dna product contained 10 s material when synthesis was done at high deoxy ... | 1976 | 58864 |
stepwise dissociation of high molecular weight avian myeloblastosis virus rna: 30-40s rna subunits--the best natural template-primer for viral reverse transcriptase. | controlled disruption of 60s amv rna with formamide was used to prepare 50-55s and 30-40s rnas. when the activities of these rnas as templates for amv reverse transcriptase were compared it was found that 50-55s rna was 1-5 times and 30-40s rna 2 to 3 times more active than 60s rna. the 30-40s rna produced by heating, instead of formamide disruption, was inactive as a template but activity was restored by addition of oligo(dt). 40% of the 4s rna initially associated with the 60s rna remained ass ... | 1976 | 59791 |
synthesis of extensive, possibly complete, dna copies of poliovirus rna in high yields and at high specific activities. | the synthesis of large, possibly complete, complementary dna (cdna) copies of poliovirus rna by avian myeloblastosis virus dna polymerase is described. the cdna consists of two size classes, the larger of which is approximately 7500 nucleotides. in the presence of excess deoxynucleoside triphosphates, ribonucleoside triphosphates, or sodium pyrophosphate, only the larger material is obtained. yields of the large cdna are 50-75% of the input rna. | 1976 | 59925 |
on the association of reverse transcriptase with polynucleotide templates during catalysis. | the association of avian myeloblastosis virus (amv) dna polymerase with polynucleotide templates during catalysis has been studied. during the course of polymerization, different template-primer complexes were added and the ability of the enzyme to switch from one polynucleotide template to another was determined. at 37 degrees c as well as at 4 degrees c, the polymerase is able to switch from certain template-primer complexes to others. for example, the addition of poly(a)-oligo(dt) during the ... | 1976 | 60129 |
observations on the pyridoxal 5'-phosphate inhibition of dna polymerases. | pyridoxal 5'-phosphate at concentrations greater than 0.5 mm inhibits polymerization of deoxynucleoside triphosphate catalyzed by a variety of dna polymerases. the requirement for a phosphate as well as aldehyde moiety of pyridoxal phosphate for inhibition to occur is clearly shown by the fact that neither pyridoxal nor pyridoxamine phosphate are effective inhibitors. since the addition of nonenzyme protein or increasing the amount of template primer exerted no protective effect, there appears t ... | 1976 | 60130 |
studies on the mechanism of enzymatic dna elongation by escherichia coli dna polymerase ii. | 1976 | 60493 | |
human milk samples from different ethnic groups contain rnase that inhibits, and plasma membrane that stimulates, reverse transcription. | 1976 | 60710 | |
role of plasma membranes in stimulation of rna-directed dna synthesis. | 1976 | 60711 | |
observations on template-specific conditions for dna synthesis by avian myeloblastosis virus dna polymerase. | the effects of mg++, mn++, and kcl addition, individually and in combination, on the rate of dna- and rna-primed dna synthesis by avian myeloblastosis virus dna polymerase (reverse transcriptase) using a variety of natural and synthetic template-primer combinations were examined. optimal divalent cation concentrations were found to vary by as much as 10-fold depending upon the template-primer used to direct synthesis. addition of kcl to reaction mixtures containing optimal divalent cation concen ... | 1976 | 60740 |
poly 2'-o-ethylcytidylate, an inhibitor and poor template for amv reverse transcriptase. | poly(2'-o-ethylcytidylate) is a poor template-primer for purified avian myeloblastosis virus reverse transcriptase; the relative activities of the template-primers poly(c)-oligo(dg), poly(cm)-oligo(dg) and poly(ce)-oligo(dg) are 23:16:1. a mixture of poly(ce) and poly(di) is inactive as template-primer, in agreement with the observed inability of these to form a helical complex. by contrast the inactivity of poly(ce)-poly(i) is shown to be due to the influence of the 2'-o-ethyl residue. poly(ce) ... | 1976 | 60742 |
a simplified procedure for the quantitative isolation of dna and rna transcripts synthesized in vitro. | 1976 | 60891 | |
comparison between an avian and a murine viral reverse transcriptase-rnase h complex. | 1975 | 60996 | |
ordered transcription of rna tumor virus genomes. | 1976 | 61277 | |
rna-dependent dna polymerase activity of rna tumor virus. vi. processive mode of action of avian myeloblastosis virus polymerase. | purified avian myeloblastosis virus (amv) polymerase consisting of alpha,beta subunits has been shown to act processively in catalyzing dna synthesis primed with 34s amv rna oligo(dt), poly(a)-poly(dt), and poly(i)-poly(dc). dna transcripts prepared with 34s amv rna-oligo(dt)14 and amv polymerase (alphabeta) have been shown to have a molecular weight of 1.05 x 10(6), or approximately one-third the size of the 34s rna genome. polymerase subunit alpha acts nonprocessively with the above templates. | 1976 | 61286 |
nucleotide sequence from the coding region of rabbit beta-globin messenger rna. | a sequence of 89 nucleotides from rabbit beta-globin mrna has been determined and is shown to code for residues 107 to 137 of the beta-globin protein. in addition, a sequence heterogeneity has been identified within this 89 nucleotide long sequence which corresponds to a known polymorphic variant of rabbit beta-globin.images | 1976 | 61580 |
influence of phosphate on activity and stability of reverse transcriptase from avian myeloblastosis virus. | activity of rna-dependent dna polymerase (rddp) from avian myeloblastosis virus (amv), either in purified form or in virus lysates, was increased by phosphorylation. stability of rddp in lysates buffered with phosphate was much greater (no loss of activity in 48 hours at 4 degrees) than that in lysates buffered with tris-cl (76% loss). activity lost in the tris-buffered extracts was completely restored by phosphorylation. the findings suggested that amv rddp activity is influenced by the degree ... | 1976 | 61581 |
detection by immunofluorescence of avian myeloblastosis virus reverse transcriptase. | peripheral blood cells of avian myeloblastosis virus (amv-(infected chickens were examined at various intervals post infection by immunofluorescence. amv revertase was identified in pro- and myeloblasts; it was localized mainly in the perinuclear zone or throughout the cytoplasm. no revertase was found in erythrocytes or granulocytes. blood cells from uninfected chickens of man contained no revertase. | 1976 | 61720 |
[comparative study of rna-dependent dna polymerases (revertases) of avian myeloblastosis virus and visna virus]. | 1976 | 61846 | |
purification of the alpha subunit of avian myeloblastosis virus dna polymerase by polyuridylic acid-sepharose. | the alpha subunit of the avian myeloblastosis virus dna polymerase could be readily purified to near homogeneity using a polyuridylic acid-sepharose column chromatography step. | 1976 | 62057 |
anticomplementary nature of smaller dna produced during synthesis of extensive dna copies of poliovirus rna. | the reverse transcriptase (rna-directed dna nucleotidyltransferase) from avian myeloblastosis virus is able to make an extensive, possibly complete, complementary dna copy of intact poliovirus rna. in the presence of high concentrations of deoxyribonucleoside triphosphates, ribonucleoside triphosphates, or sodium pyrophosphate, this dna is the only species produced. without these additives, however, a second size class of dna is also synthesized. this material has a sedimentation coefficient bet ... | 1976 | 62359 |
stepwise biosynthesis in vitro of globin genes from globin mrna by dna polymerase of avian myeloblastosis virus. | two approaches have been explored for the synthesis of double-stranded dna from single-stranded dna template complementary to rabbit 9s globin mrna (cdna). (i) cdna was elongated with dcmp or dtmp homopolymeric tracts using terminal deoxynucleotidyltransferase (ec 2.7.7.31; nucleosidetriphosphate:dna deoxynucleotidylexotransferase). cdna-dc, in the presence of an oligo(dg)10 primer, was an efficient template with either dna polymerase of escherichia coli (ec 2.7.7.7; deoxynucleosidetriphosphate: ... | 1976 | 62360 |
different states of avian myeloblastosis virus dna polymerase and their binding capacity to primer rrnatrp. | 1976 | 62451 | |
preparation of (125i)-dctp and its use as a substrate for rna- and dna-directed dna synthesis. | 1976 | 62576 | |
structural features of encephalomyocarditis virus rna from analysis of reverse transcription products. | the presence in encephalomyocarditis (emc) virus rna of homonucleotide tracts 10 nucleotides or more in length has been investigated by testing the ability of homo-oligodeoxynucleotides to prime dna synthesis in the reverse transcriptase from avian myeloblastosis virus. neither (dc)10 nor (da)10 promoted incorporation of [3h]deoxynucleotides into acid-insoluble material but (dg)10 and (dt)12-18 were effective primers and produced dna products approximately 2000 nucleotides in length. we conclude ... | 1976 | 62663 |
quantitation of casein messenger ribonucleic acid sequences using a specific complementary dna hybridization probe. | two highly purified rat casein mrna fractions were used as templates to synthesize complementary dna (cdna) hybridization probes using rna-directed dna polymerase isolated from avian myeloblastosis virus. both of the probes selectively hybridized to rna isolated from lactating mammary tissue, but not to poly(adenylic acid)-containing rat liver rna. an analysis of the kinetics of hybridization of the cdna derived from the 15s casein mrna (cdna12s) with their individual mrna templates indicated th ... | 1976 | 63286 |
purification and characterization of gibbon ape leukemia virus dna polymerase. | an rna directed dna polymerase was purified over 2500 fold from gibbon ape leukemia virus by successive column chromatography on sephadex g100, deae cellulose, phosphocellulose and hydroxyapatite. the purified dna polymerase has a molecular weight of 68 000, a ph optimum of 7.5, a mn2+ optimum of 0.8 mm, and kcl optimum of 80 mm. the purified enzyme transcribes heteropolymeric regions of viral 60-70 s rna isolated from avian myeloblastosis virus, rauscher murine leukemia virus and simian sarcoma ... | 1976 | 63292 |
the ovalbumin gene. in vitro enzymatic synthesis and characterization. | using purified single-stranded ovalbumin complementary dna (cdnaov) as a template for avian myeloblastosis (am) virus reverse transcriptase, we have enzymatically synthesized a complete double-stranded cdnaov sequence. our data suggests that many single-stranded cdnaov molecules contain short double-stranded sequences (hairpins) at their 3' termini capable of acting as primers for synthesis of complete double-stranded cdnas. optimum conditions for synthesis of the double-stranded cdnaov were fou ... | 1976 | 63459 |
translation of 35s rna from avian myeloblastosis virus into viral specific polypeptides in xenopus oocytes. | 1976 | 64192 | |
bovine leukemia virus: an exogenous rna oncogenic virus? | short term cultures of bovine leukemic lymphocytes release virus particles with biochemical properties of rna oncogenic viruses. these particles, tentatively called bovine leukemia virus (blv) have a high molecular weight-reverse transcriptase complex and a density averaging 1.155 g/ml in sucrose solutions. molecular hybridizations between blv-3h cdna and several viral rnas show that blv is not related to mason-pfizer monkey virus (mpmv) simian sarcoma associated virus (ssv-1) feline leukemia vi ... | 1976 | 64382 |
purification and properties of rauscher leukemia virus dna polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. | rauscher leukemia virus rna-directed dna polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. the purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. the enzyme is free of dnase, but has rnase h activity. analysis of the requirements for optimal rates of dna synthesis by this enzyme using synthetic and nat ... | 1977 | 64468 |
gene specific priming of complementary dna synthesis. | dna, complementary to chicken globin mrna was synthesized using either avian myeloblastosis virus reverse transcriptase, or e. coli dna polymerase i. transcriptase cdna sediments at 9 s on sucrose gradients, and is 620 nucleotides in length, representing a complete copy of globin mrna template. in contrast, polymerase i cdna sediments at 4 s, is 100 to 200 nucleotides in length, and is a copy of a small region at the 3'(poly a) end of globin mrna. similarly, transcriptase cdna and polymerase i c ... | 1976 | 64922 |
different modes of inhibition of purified ribonucleic acid directed deoxyribonucleic acid polymerase of avian myeloblastosis virus by rifamycin sv derivatives. | 1977 | 65179 | |
[presence in immunostimulated cells of an rna molecule utilizable as template for reverse transcriptase of avian myeloblastosis virus (amv)]. | cytoplasmic rna extracted from antigen stimulated immunocompetant cells is transcribed in vitro into dna by the rna directed dna polymerase from avian myeloblastosis virus, in the absence of any added primer. cytoplasmic rna from other organs of the same animal, from non-stimulated immunocompetent cells, or from cells in tissue culture is not transcribed in the absence of exogenous primer. | 1977 | 65233 |
chemical modification of dna polymerase phosphoprotein from avian myeloblastosis virus. | fractionation of purified avian myeloblastosis virus dna polymerase, after phosphorylation in vitro, revealed the presence of a small acidic proten, a phosphate acceptor polypeptide with high specific activity. its presence in the phosphorylated form with the polymerase resulted in as much as a 10-fold increase in the rate of dna synthesis. its presence in the dephosphorylated form with the polymerase had no effect in the rate of dna synthesis. | 1977 | 65734 |
immunological distinction between ribonuclease h activity of alpha and alph beta forms of avian myeloblastosis virus (amv) dna polymerase. | 1977 | 65831 | |
the reverse transcriptase. | 1977 | 66065 | |
primer recognition by avian myeloblastosis virus rna-directed dna polymerase. | tryptophanyl-trna was specifically labeled at the 3' end with [3h]tryptophan and cleaved in half with rnase under denaturing conditions, and the 3' half was shown to hybridize exclusively at the 5' end of avian myeloblastosis virus rna. the rna-dependent dna polymerase of avian myeloblastosis virus is capable of efficiently binding the 3' half of the primer molecule. | 1977 | 66328 |
protein kinase and phosphoproteins of avian myeloblastosis virus. | a protein kinase associated with purified virions of avian myeloblastosis virus, bai strain a, was highly purified by ion-exchange chromatography and gel filtration. on the basis of molecular sieving on sephadex g-200, the enzyme protein appeared to have a molecular weight of about 50,000 to 60,000; disc gel electrophoresis in sodium dodecyl sulfate-acrylamide gels revealed the presence of at least two polypeptide chains; and isoelectric focusing on acrylamide gels revealed two protein bands wit ... | 1977 | 66329 |
dimensions of homo- and heteropolymeric sections of dna synthesized by reverse transcription from globin mrna matrices. | the lengths of globin messenger rnas, isolated from rabbit and pigeon reticulocytes, and single-stranded complementary dnas, synthesized from mrna in presence of rna-directed dna-polymerase and oligo(dt) have been investigated by polyacrylamide gel electrophoresis under denaturing conditions. the cdna preparations contained a fraction which corresponded in length to the alpha and beta chains of the mrna used as a matrix. the lengthwise distribution of poly(a) sequences, isolated from globin mrna ... | 1976 | 66625 |
rous sarcoma virus genome is terminally redundant: the 3' sequence. | a sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(a) in rous sarcoma virus (prague strain, subgroup c) 35s rna has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(a) with purified reverse transcriptase (rna-directed dna polymerase; deoxynucleosidetriphosphate:dna deoxynucleotidyltransferase, ec 2.7.7.7) from avian myeloblastosis virus. the sequence is 5'gccauuuuaccauucaccac ... | 1977 | 66684 |
characterization of a new reverse transcriptase of possibly cellular origin in the chicken system. | the properties of an rna-dependent dna polymerase, which occurs ubiquitously in the allantoic fluid of uninfected, leukosis-virus-free eggs, are described. it is shown that the enzyme can synthesize faithful transcripts from natural rna (globin mrna). with biochemical and immunological methods, the enzyme can be clearly distinguished from the reverse transcriptases of the known chicken rna tumour viruses and therefore seems to be a member of a so far unknown class of chicken polymerases. our dat ... | 1977 | 66920 |