Publications
| Title | Abstract | Year Filter | PMID(sorted descending) Filter |
|---|
| studies of the injection of poly(a)+ protamine mrna into xenopus laevis oocytes. | 1978 | 569063 | |
| post-translational assembly of lens alpha-crystallin in the reticulocyte lysate and in xenopus laevis oocytes. | lens mrna was translated in reticulocyte lysate predominantly into monomeric alpha-crystallin chains. lens polyribosomes added to the cell-free system produced the same polypeptides, but these were detected predominantly in alpha-crystallin aggregates. lens mrna, after microinjection into xenopus laevis oocytes, produced alpha-crystallin subunits that were exclusively found in the form of high-molecular-weight complexes. also after injection of the purified 14-s mrna, coding for the alphaa subui ... | 1978 | 569053 |
| transmembrane effects of lectins. i. effects of wheat germ agglutinin and soybean agglutinin on furrow formation and cortical wound healing in xenopus laevis eggs. | 1978 | 568554 | |
| the simultaneous production of two classes of cytoplasmic immunoglobulins by single cells in xenopus laevis. | 1978 | 568035 | |
| frequency response of the lateral-line organ of xenopus laevis. | the stimulus response relation of the epidermal lateral-line organ of xenopus laevis was studied by recording activity of single afferent nerve fibres in isolated preparations. linear frequency response analysis over a frequency range of 0.1--100hz was performed under steady-state conditions, using small amplitude, sinusoidal water displacements produced by a glass sphere at a short distance from the skin. period histograms of afferent nerve activity were computed, and amplitude, phase and mean ... | 1978 | 567787 |
| in vivo aminoacylation and 'processing' of turnip yellow mosaic virus rna in xenopus laevis oocytes. | 1978 | 567751 | |
| [modulation of the citrate cycle in mitochondria of xenopus laevis oocytes and biorhythms. i. characteristics of "holocoherent" mitochondria]. | 1978 | 567416 | |
| changes of the external and internal pigment pattern upon fertilization in the egg of xenopus laevis. | external and internal pigment shifts in xenopus laevis eggs were studied between fertilization and first cleavage. externally visible, constant features are: (1) the 'activation contraction', a pigment shift towards the animal side taking place between 5 and 15 min post fertilization (p.f.) and (2) the concentration of the pigment around the sperm entrance point leading to the formation of the grey crescent at the opposite side of the egg. hence, in xenopus the grey crescent is not formed by rot ... | 1978 | 566780 |
| translation "in vitro" of globin mrna from xenopus laevis. | rna isolated from xenopus laevis reticulocytes and characterized as globin mrna (meza et al., 1978) was tested for its capacity to stimulate "in vitro" a wheat germ translation system, and the ability to synthesize a polypeptide. the latter was identified as globin by its electrophoretic mobility and immunoprecipitation with antiglobin antibody. | 1978 | 566631 |
| translation of mouse interferon mrna in xenopus laevis oocytes and in rabbit reticulocyte lysates. | 1978 | 566552 | |
| the nucleotide sequence of oocyte 5s dna in xenopus laevis. ii. the gc-rich region. | the primary sequence of the gc-rich half of the repeating unit in x. laevis 5s dna has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. the gc-rich half of the repeating unit contains a single long duplication of 174 nucleotides. the duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. the duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotid ... | 1978 | 566164 |
| the nucleotide sequence of oocyte 5s dna in xenopus laevis. i. the at-rich spacer. | the primary sequence of the principal spacer region in x. laevis oocyte 5s dna has been determined. the spacer is at-rich and comprises half or more of each repeating unit. the sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: caacagttttcaaaaggtttcgaagttttt(t). the spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (a2) which is variable in length in different repeating units, flanked ... | 1978 | 566163 |
| changes of nucleosome frequency in nucleolar and non-nucleolar chromatin as a function of transcription: an electron microscopic study. | the morphology of nucleolar and non-nucleolar (lampbrush chromosome loops) chromatin was studied in the electron microscope during states of reduced transcriptional activity in amphibian oocytes (xenopus laevis, triturus alpestris, t. cristatus). reduced transcriptional activity was observed in maturing stages of oocyte development and after treatment with an inhibitor, actinomycin d. strands of nucleolar chromatin appear smooth and thin, and contain only few, if any, nucleosomal particles in th ... | 1978 | 566162 |
| the effects of high hydrostatic pressure on microfilaments and microtubules in xenopus laevis. | xenopus laevis embryos of stages 14-20 were subjected, for periods of 5-330 min, to hydrostatic pressures ranging from 500 to 10 000 psi. the specimens were fixed under corresponding pressures and their neuroepithelium was studied under light and electron microscopy. a pressure of 3000 psi, maintained for as long as 180 min, did not inhibit neurulation though it induced slight deformities of the neuroepithelium. a pressure of 4000 psi, applied for 180 min, disrupted the apical ring of microfilam ... | 1978 | 565800 |
| actin in xenopus oocytes. ii. intracellular distribution and polymerizability. | the largest oocytes of xenopus laevis were broken open in the absence of shearing forces which might transfer actin from particulate to supernatant fractions. particulate and postmitochondrial supernatant fractions were prepared by centrifugation. sds-electrophoretic fractionation on polyacrylamide gels and quantitative scanning techniques were used to separate actin and to assay its amount in cellular fractions. the actin has been identified in electrophoretograms by its molecular weight and it ... | 1978 | 565782 |
| studies on the conformation of the 3' terminus of 18-s rrna. | we have studied the conformation of the 3' end of 18-s rna from human, hamster and xenopus laevis cells. the 3'-terminal oligonucleotide in a t1 ribonuclease digest of 18-s rna from hela cells was identified, using a standard fingerprinting method. the sequence (g)-a-u-c-a-u-u-a, established by eladari and galibert for hela 18-s rrna, was confirmed. an identical 3' terminus is present in hamster fibroblasts and xenopus laevis cells. the ease of identification of this oligonucleotide has enabled ... | 1978 | 565287 |
| analysis of xenopus laevis ovary and somatic cell polyadenylated rna by molecular hybridization. | 1978 | 564793 | |
| three-dimensional structure of the lipovitellin-phosvitin complex from amphibian oocytes. | microcrystals of the lipoprotein-phosphoprotein complex which are found in the oocytes of xenopus laevis were examined using electron microscopy. analysis of fourier transforms of the images of the (010) and (001) projections showed the space group to be p2(1)22(1). ten projections were combined to produce a map of the complex having about 20 a resolution. the lipoprotein complex consists of two subunits related by a local twofold symmetry axis. the density was averaged around the local symmetry ... | 1978 | 564460 |
| dna synthesis in a multi-enzyme system from xenopus laevis eggs. | cytoplasm from unfertilized eggs of the frog xenopus laevis was separated by deae-cellulose column chromatography into nine fractions. supercoiled pxir 11 dna molecules (pxir 11 is a col el-based recombinant plasmid containing part of the xenopus laevis 18s and 28s ribosomal genes and transcribed spacer region) were incubated with each fraction singly and in various combinations. after incubation for 4 hr at 26 degrees c, the pxir 11 dna was reisolated and examined by electron microscopy. using ... | 1978 | 564241 |
| diffusible and bound actin nuclei of xenopus laevis oocytes. | several criteria have been used to identify actin in hand-isolated nuclei of xenopus laevis oocytes; these include co-migration with actin on sds-polyacrylamide gels, immunological cross-reactivity with antiserum against actin, binding to dnaase i and peptide mapping on sds gels. the use of hand-isolated nuclei precludes the possibility of contamination from cytoplasmic actin or the leakage of significant amounts of actin from nuclei during isolation. actin constitutes roughly 6% of the total nu ... | 1977 | 563771 |
| the isolation and characterization of a second oocyte 5s dna from xenopus laevis. | a second and minor dna component containing 5s rna genes has been purified from the genomic dna of xenopus laevis (xit 5s dna). some of its physical and chemical characteristics are described. it contains a 5s rna gene sequence which has some oocyte and some somatic-specific residues, as well as nucleotides which differ from both types of 5s rna. there are about 2000 of these 5s rna genes per haploid complement of dna compared to about 24,000 of the principal oocyte 5s rna genes. the multiple re ... | 1977 | 563770 |
| comparison of in vivo and in vitro ribosomal rna synthesis in nucleolar mutants of xenopus laevis. | cells of embryos carrying a lethal nucleolar mutation have been maintained in vitro for extended periods of time. normally these mutants live only 9 to 12 days after fertilization but their cells in culture will survive for more than 3 months. the extent of ribosomal rna (rrna) synthesis was determined in primary cultures prepared from normal embryos and nucleolar mutants having different numbers of ribosomal rna genes. we found that the accumulation of radioactivity into rrna for normal and mut ... | 1977 | 562840 |
| calcium, potassium, and sodium exchange by full-grown and maturing xenopus laevis oocytes. | 1977 | 562807 | |
| cellular localization of dna polymerase activities in full-grown oocytes and embryos of xenopus laevis. | 1977 | 562269 | |
| recombinant dna formation in a cell-free system from xenopus laevis eggs. | a cell-free system is described which formed very high levels of recombinant dna structures in 4 hr at 26 degrees c. it consisted of a single fraction of a high speed supernatant prepared from an extract of unfertilized eggs of the frog xenopus laevis. this fraction eluted at 0.16-0.18 m tris homogenization buffer from a deae-cellulose column. when two partially homologous supercoiled dna molecules of different contour lengths were incubated simultaneously in this system, high levels of heterolo ... | 1977 | 561663 |
| a pseudogene structure in 5s dna of xenopus laevis. | the 5s dna of xenopus laevis, coding for oocyte-type 5s rna, consists of many copies of a tandemly repeated unit of about 700 base pairs. each unit contains a "pseudogene" in addition to the gene. the pseudogene has been partly sequenced and appears to be an almost perfect repeat of 101 residues of the gene. the order of components in the repeat unit is (5') long spacer--gene--linker--pseudogene (3') in the "+" strand (or h strand) of the dna. the possible function of the pseudogene is discussed ... | 1977 | 561661 |
| protein synthesis in oocytes of xenopus laevis is not regulated by the supply of messenger rna. | 1977 | 560911 | |
| synthesis of heterogeneous nuclear rna in full-grown oocytes of xenopus laevis (daudin). | at various times following injection of either 3h-gtp or 32po4 into full-grown (stage 6) xenopus laevis oocytes, rna has been extracted and fractionated on polyacrylamide gels. based on size, base composition and incorporation data, we have defined the kinetics of synthesis and accumulation of ribosomal rna (40s, 28s, 18s), heterogeneous rna of high molecular weight (greater than 40s) and heterogeneous rna migrating with molecular weights of from 4s to 40s. nuclear isolations have been performe ... | 1977 | 560257 |
| restriction analysis of the nontranscribed spacers of xenopus laevis ribosomal dna. | 1977 | 560255 | |
| citrus exocortis viroid: survey of protein synthesis in xenopus laevis oocytes following addition of viroid rna. | 1977 | 560084 | |
| transcriptional organization of the 5.8s ribosomal rna cistron in xenopus laevis ribosomal dna. | hybridization of purified, 32p-labeled 5.8s ribosomal rna from xenopus laevis to fragments generated from x. laevis rdna by the restriction endonuclease, ecori, demonstrates that the 5.8s rrna cistron lies within the transcribed region that links the 18s and 28s rrna cistrons. | 1977 | 559301 |
| the synthesis and storage of histones during the oogenesis of xenopus laevis. | 1977 | 558925 | |
| [molecular mechanisms for establishing the block to polyspermy at fertilization of xenopus laevis egg (author's transl)]. | 1977 | 558632 | |
| a method for enucleating oocytes of xenopus laevis. | a method is described for the enucleation and complete healing of xenopus oocytes so that the enucleated oocytes withstand multiple injections and culture for several days. the oocytes are defolliculated and enucleated manually and allowed to heal in a potassium phosphate buffer. oocytes enucleated in this way support rna synthesis by injected hela-cell nuclei 3 days later. this method is valuable in providing a low-background system in which transcription of injected nuclei can be studied. | 1977 | 558275 |
| 5'-terminal structure and mrna stability. | reovirus mrnas with 5'terminal m7gpppgm or gpppg are more stable than mrna containing unblocked ppg 5'-ends when injected into xenopus laevis oocytes or incubated in cell-free protein synthesising extracts of wheat germ and mouse l cells. the greater stability of mrna with blocked 5' termini is not dependent upon translation but seems to result from protection against 5'-exonucleolytic degradation. | 1977 | 557727 |
| concanavalin a binding to oocytes and eggs of xenopus laevis. | 1977 | 556994 | |
| mitochondrial dna synthesis in large and mature oocytes of xenopus laevis. | 1977 | 556708 | |
| histological changes in xenopus laevis daudin specimens kept under dry conditions, then moved back to their natural aquatic environment. i. pituitary, thyroid and testis. | the histofunctional picture of the hypophysis, thyroid and testis was studied in xenopus laevis specimens 1) kept in their natural aquatic environment; 2) gradually exposed to dehydration conditions under which they were kept one week; and 3) returned from the dry environment to water for 24 hr or 7 days. of particular interest are the changes displayed in the hypophysis by type ii acidophils, i.e. presumably prolactin producing cells. in the pituitary of "dry" animals and of those 24 hr after t ... | 1978 | 555326 |
| axonal-ependymal associations during early regeneration of the transected spinal cord in xenopus laevis tadpoles. | the nature and organization of the cellular substrate supporting axonal outgrowth during early regeneration of the spinal cord following transection and/or segment removal were examined in xenopus tadpoles. longitudinal axonal compartments, formed by radial ependymal processes in unoperated spinal cords, were maintained within the rostral and caudal stumps throughout the early post-operative period. the first neuritic sprouts to appear near the cut ends of the cord were frequently associated wit ... | 1979 | 553146 |
| indirect identification of prolactin-producing cells in the pituitary gland of xenopus laevis daudin. | 1979 | 550867 | |
| expression of regenerative capacity of caudal spinal cord during the larval development of xenopus laevis. | 1979 | 547620 | |
| a new method for local artificial insemination of xenopus laevis eggs. | 1979 | 545168 | |
| a trna gene of xenopus laevis contains at least two sites promoting transcription. | a small cloned dna segment previously shown to contain all genetic information for the expression of the trna1met gene of xenopus laevis was cleaved into an anterior and posterior portion by hae iii restriction. both restriction fragments were cloned in pcr1 using ecori linkers. starting from these tdna subclones, a series of new recombinants were constructed. the transcriptional activity of the cloned dna's was tested both in an in vitro transcriptional system and by means of the oocyte injecti ... | 1979 | 537910 |
| expression of sea urchin histone genes in the oocyte of xenopus laevis. | 1979 | 537089 | |
| calcium-induced dehiscence of cortical granules in xenopus laevis oocytes. | microinjection of 0.1 microgram of ca++ into xenopus laevis oocytes induces breakdown of the cortical granules. the cortical granules disappeared in both full grown (stage vi) and small growing (stage iv) oocytes. microinjection of mg++, k+, or na+ had no effect on cortical granules in either stage iv or stage vi oocytes. small quantities (0.03 microgram) of ca++ induced dehiscence of the cortical granules only in proximity to the injection site. | 1979 | 536708 |
| cell number in relation to primary pattern formation in the embryo of xenopus laevis. ii. sequential cell recruitment, and control of the cell cycle, during mesoderm formation. | morphological evidence is presented that definitive mesoderm formation in xenopus is best understood as extending to the end of the neurula phase of development. a process of recruitment of cells from the deep neurectoderm layers into mesodermal position and behaviour, strictly comparable with that already agreed to occur around the internal blastoporal 'lip' during gastrula stage 20 (earliest tail bud). spatial patterns of incidence of mitosis are described for the fifteen hours of development ... | 1979 | 536690 |
| a quantitative electron-microscope analysis of chromatin from xenopus laevis lampbrush chromosomes. | the morphology of the dnp axis and rnp transcripts from xenopus laevis lampbrush chromosomes has been analysed using a modified miller spreading technique. two basictypes of chromatin have been distinguished. (1) discrete portions of dnp exhibiting high levels of transcriptive activity, with clear initiation and termination points (transcription units). interspersed with the units are sequences with little or no transcriptive activity (spacer dnp). the combination of transcription unit plus spac ... | 1979 | 536383 |
| neurite complexes with merkel cells in larval tentacles of xenopus laevis. | 1979 | 535028 | |
| metabolic state dependent preservation of cells by fixatives for electron microscopy. | the preservation of mitochondria, cytoplasmic vacuoles and cytoplasm by various fixatives after various pretreatments of ethothelial heart cells from xenopus laevis tadpoles in tissue culture was investigated. the study was based on phase contrast cinemicrographic recordings and on qualitative and quantitative observations with the electron microscope. three fixatives were used: 3% glutaraldehyde in phosphate buffer, followed by 1% osmium tetroxide postfixation, fixation only with 1% osmium tetr ... | 1979 | 530094 |
| structure and formation of ankylosis in xenopus laevis. | the structure of ankylotic teeth in xenopus laevis was studied by light, transmission, and scanning electron microscopy as well as by microradiography in decalcified and undecalcified specimens. the mature teeth of xenopus laevis are calcified from the crown to the base, fused to the jaw bone, and have no uncalcified area, such as a fibrous ring separating the tooth into the crown and pedicle. microradiography shows that the mature tooth and jaw bone appear as an x-ray opaque area, except for th ... | 1979 | 529293 |
| use of different carriers to demonstrate thymic-dependent and thymic-independent anti-trinitrophenyl reactivity in the ambhibian xenopus laevis. | 1979 | 527747 | |
| the use of radioiodinated protein substrates for the assay of trypsin and the hatching enzyme from the amphibian xenopus laevis. | 1979 | 525784 | |
| the emergence, localization and maturation of neurotransmitter systems during development of the retina in xenopus laevis. i. gamma aminobutyric acid. | the high-affinity uptake, biosynthesis and release of gaba have been studied in the retina of xenopus laevis. in the mature retina, [3h]-gaba is accumulated predominantly by horizontal cells. a second population of cells located in the inner nuclear layer (possibly a type of amacrine cell) also showed a specific gaba uptake. in addition, this retina contains significant activities of l-glutamic acid decarboxylase and also releases [3h]-gaba in response to increasing k+ concentrations in the medi ... | 1979 | 521507 |
| the localisation of lead in the skin of light- and dark-adapted xenopus laevis. | toads pretreated for 2 months on either a dark or a light background were then exposed to lead nitrate at 50 ppm lead for 21 days, the illumination regimes being maintained. metal analysis of dorsal skin showed significantly higher lead levels (p less than 0.01) in dark-adapted toads. no precipitated lead deposits were observed at the ultrastructural level, necessitating x-ray microanalysis of sections containing melanophores, gland cells and general (non-melanophore) cytoplasm. analysis showed ... | 1979 | 521319 |
| elimination and metabolism of dimethylnitrosamine (dmn) by xenopus laevis and other amphibians. | the elimination of (14c)-dmn after i.p. injection into xenopus was measured, as was the metabolism in vitro of (14c)-dmn by liver from xenopus and 9 other amphibian species. in view of its rapid elimination from the body and low rate of metabolism by xenopus liver in vitro, dmn is unlikely to be toxic or carcinogenic in xenopus. | 1979 | 520492 |
| influence of ci-628 (cn-55, 945-27) on estrogen-induced vitellogenin synthesis and on the ultrastructure of hepatocytes in male xenopus laevis. | 1979 | 520332 | |
| sequestration and turnover of guinea-pig milk proteins and chicken ovalbumin in xenopus oocytes. | the stability and distribution of proteins within the living cell can be studied using xenopus laevis oocytes. microinjection of messenger rnas and secretory proteins, followed by cell fractionation, shows that transfer of ovalbumin and milk proteins across intracellular membranes of the oocyte only occurs during their synthesis. thus milk protein primary translation products, made in the wheat germ cell-free system, when injected into oocytes remain in the cytosol and are not recovered within m ... | 1979 | 520309 |
| aerobic and anaerobic contributions to sustained activity in xenopus laevis. | in conditions of declining water po2, xenopus obtains the majority of resting oxygen needs from lung breathing at 15 degrees and 25 degrees c. the critical oxygen tension was 120 +/- 9 mm hg at 15 degrees c, and 90 +/- 10 mm hg at 25 degrees c. during 30 min stimulation of activity to complete exhaustion at 15 degrees c, frogs exhibited an aerobic capacity of 1.7 microliter o2.g-1.h-1 and accumulated 2.22 mg lactate . g-1. following activity these animals exhibited an oxygen debt of 49.2 microli ... | 1979 | 515565 |
| [elongated mitotic cells in the neuroepithelium of xenopus laevis and notophtalmus viridescens]. | most neuroepithelial cells in the embryos of xenopus laevis and notophtalmus viridescens become round upon entering into mitosis. however, many maintain their elongated form, or show long cytoplasmic processes, during mitosis. it therefore seems possible that, in these species, two groups of microtubules are present during mitosis: cytoplasmic microtubules and mitotic microtubules. | 1979 | 515478 |
| relationships between eye factors and lens-forming transformations in the cornea and pericorneal epidermis of larval xenopus laevis. | larval xenopus laevis at stage 56 (nieuwkoop and faber, '56) were subjected to various types of lentectomy: (1) simple lentectomy, from the pupillary space after incision of outer and inner cornea; (2) lentectomy from the dorsal region of the eye; (3) lentectomy from the dorsal region of the eye and simultaneous incision of the outer cornea; (4) lentectomy from the dorsal region of the eye and simultaneous incision of the outer and inner cornea. the results obtained show that the outer cornea un ... | 1979 | 512595 |
| post-translational modification of rat immunoglobulins synthesized in the xenopus oocyte translation system. | the post-translational modification of rat immunoglobulin synthesised in xenopus laevis oocytes was studied. the major products of translation of rat spleen poly-(a) containing mrna were found to be assembled 7s immunoglobulin molecules indicating extensive modification of primary translation products. the possibility that these immunoglobulin molecules might include antibodies of defined specificity was investigated using spleen mrna from rats hyperimmunized with ferritin and keyhole limpet hae ... | 1979 | 511214 |
| analysis of xenopus laevis globins during development and erythroid cell maturation and the construction of recombinant plasmids containing sequences derived from adult globin mrna. | 1979 | 510792 | |
| the activity and properties of poly(adenosine diphosphate ribose) polymerase in vitro during the embryonic development of the south african clawed toad xenopus laevis. | 1979 | 510788 | |
| phylogeny of immunocompetent cells: iii. mitogen response characteristics of lymphocyte subpopulations from normal and thymectomized frogs (xenopus laevis). | 1979 | 509538 | |
| utilization of stored mrna in xenopus embryos and its replacement by newly synthesized transcripts: histone h1 synthesis using interspecies hybrids. | we studied h1 gene expression in hybrids of xenopus laevis (female) x xenopus borealis (male) and saw paternal h1 synthesis in mid-blastulae, which indicates that the h1 genes are active by this stage. the behavior of the maternal store of h1 histone mrna was studied in androgenetic haploids. in which all stored mrna is of the laevis type and all new transcripts are borealis. this showed that the initial activation of h1 synthesis occurs entirely by mobilizing maternal transcripts and that these ... | 1979 | 509520 |
| unusual particle trajectories and structural arrangements in myelinated nerve fibers. | others have reported that axonally transported particles, which usually travel in a direction roughly parallel to the axis of the nerve fiber, may suddenly shift sideways as though changing tracks. examples of this rare type of movement are shown for particles undergoing transport in myelinated axons of xenopus laevis. an examination of the structure of axons from xenopus showed that some microtubules, neurofilaments, and elements of endoplasmic reticulum may also exhibit marked deviations from ... | 1979 | 509371 |
| [determination of the decrease in the regenerative power of the optic tectum of xenopus laevis (daudin) during the tadpole stage]. | 1979 | 506629 | |
| transcription initiation of xenopus 5s ribosomal rna genes in vitro. | we have studied initiation of transcription of 5s rna genes in extracts of xenopus laevis oocyte nuclei. to aid in this study we developed a general assay for specificity of transcription initiation that does not require accurate termination of transcription. following in vitro transcription with gamma-32p-labeled nucleoside triphosphages, the rna is digested with pancreatic rnaase and fingerprinted by two dimensional chromatography. a 5s rna gene with a variant sequence, in which the g residue ... | 1979 | 503853 |
| the time scale of tooth development and replacement in xenopus laevis (daudin). | one hundred and seventy two larval specimens of xenopus laevis were reared in such a way that their rates of development (as measured by external criteria) were similar, and so the course of dental development could be examined histologically in a cross sectional study. in this way the events of tooth development were observed, and a time scale constructed for these events. the teeth took an average time of 26 days to develop, erupt and become ankylosed to the bony pedestal, after which each too ... | 1979 | 500489 |
| turnover and processing of poly(a) in full-grown oocytes and during progesterone-induced oocyte maturation in xenopus laevis. | 1979 | 499663 | |
| expression of the mitochondrial genome in xenopus laevis: a map of transcripts. | the twelve most abundant transcripts in x. laevis mitochondria were characterized, and their coding regions were mapped on the mitochondrial dna (mtdna) by r loop mapping in the electron microscope and by rna gel transfer hybridization. the transcripts map in nonoverlapping positions with one exception, and they account for about 80% of the coding capacity of mtdna. ten of the twelve rna molecules contain poly(a): the two poly(a)-lacking transcripts are the rrnas. analysis withe single-strand-sp ... | 1979 | 498281 |
| the putative promoter of a xenopus laevis ribosomal gene is reduplicated. | with the aid of a novel poly-da tailing-partial restriction technique and s1-protection mapping, the 5' terminal coding sequence for the 40s precursor ribosomal rna of xenopus laevis has been exactly identified. since the promoter sequence for the 40s rna should lie close to its 5' terminal coding sequence, we are able to conclude that the "bam-island" sequence reduplication (1) almost certainly represents a promoter reduplication. | 1979 | 493120 |
| toxicity of selenium to developing xenopus laevis embryos. | se in the form of sodium selenite is toxic to xenopus laevis embryos and tadpoles continuously exposed to concentrations above 1 ppm. concentrations of 2 ppm and above result in severe developmental abnormalities and increased mortality. uptake and loss of radioactive se from water are rapid, but depuration is not complete indicating that some se can remain bound by the organism. the facts that se is toxic at low levels to xenopus embryos and tadpoles, can cause developmental abnormalities, and ... | 1979 | 490681 |
| x-ray effect on the development of xenopus laevis embryos--with special reference to primordial germ cells. | 1979 | 490458 | |
| trochlear-oculomotor nerve interactions in xenopus laevis tadpoles: a temporal study. | when the trochlear nerve (niv), which innervates the superior oblique muscle (som), is crushed or cut at stages 48-49 in xenopus tadpoles, fibers from the oculomotor nerve (niii) sprout and invade the som. the maximal percentage of specimens having at least one oculomotor nerve fiber on the som on a given day increased from 9.1% following a single crushing of niv to 84.2% following three successive severings of niv and the average number of silver-impregnated niii fibers per specimen increased f ... | 1979 | 490132 |
| alpha-melanotropin-like substances in the pituitary and plasma of xenopus laevis in relation to colour change responses. | 1979 | 488671 | |
| enrichment and characterization of the dna coding for vitellogenin in xenopus laevis. | purified vitellogenin mrna of xenopus laevis was incubated with mechanically sheared dna in high concentrations of formamide and the resulting r-loops (i.e. rna . dna hybrid fragments) separated from the bulk dna by caesium chloride buoyant density centrifugation. hybridization with 125i-labeled vitellogenin mrna revealed a 15--30-fold enrichment of the dna coding for vitellogenin. restriction analysis of the r-loop-enriched dna demonstrated that all known endonuclease hindiii fragments coding f ... | 1979 | 488117 |
| quantitative determination of amplified rdna and its distribution during oogenesis in xenopus laevis. | the number of extra-chromosomal nucleoli and their rdna content were determined during oogenesis in xenopus laevis. the highly variable number of nucleoli (500 to 2,500) in oocytes of the same stage and from the same female or of different stages or from different females is not a measure of the extent of amplification. in all oocytes examined, a inversely proportional relation was found between the number of nucleoli in an oocyte and their mean rdna content. these results indicate that there is ... | 1979 | 487908 |
| contrasting denaturation maps of xenopus laevis and xenopus borealis mitochondrial dnas. | denaturation maps of mitochondrial dnas of xenopus laevis and xenopus borealis are radically different from each other. this is in striking contrast to the invariant denaturation patterns previously recognized among mtdnas of various drosophila species, particularly, since the two toads may be even more closely related to each other than the drosophila species. | 1979 | 486484 |
| [cell proliferation and migration in the roof of the mesencephalon (tectum) in xenopus laevis tadpoles and adult frogs normally and in brain injury. ii. cell proliferation and differentiation of the tectum in frogs]. | the proliferation and directions of cell differentiation in tectum opticum were studied in the young frogs under the conditions of normal development and upon brain trauma by means of 3h-thymidine autoradiography. the same types of cells were shown to be able of proliferation in both the cases: cells of the ventricle zone and glioblasts (gliocytes) in all other tectum layers. a study of directions of the tectum proliferating cells' differentiation in the frogs has shown that the proliferating ce ... | 1979 | 481850 |
| structural changes in single muscle fibers after stimulation at a low frequency. | direct stimulation of single muscle fibers from xenopus laevis at a frequency of 1 hz results in a decline of the peak isometric twitch tension after about 200 twitches. fibers were chemically fixed in glutaraldehyde after a varying number of twitches and at several fatigue levels, and the ultrastructural appearance was compared with that of resting fibers treated by identical fixation methods. no gross structural abnormalities were observed but subtle changes occurred. the mitochondria of stimu ... | 1979 | 479818 |
| the activity of cholinesterases during the development of xenopus laevis. | the activity of cholinesterases during the early development of xenopus laevis has been examined, and the activity of acetylcholinesterase in particular has been distinguished from other cholinesterases. in contrast to some earlier findings, the activity of acetylcholinesterase is low at early stages and gradually increases during development. possible reasons for the differences between the earlier results and those reported here are discussed. | 1979 | 479745 |
| cell number in relation to primary pattern formation in the embryo of xenopus laevis. i. the cell cycle during new pattern formation in response to implanted organizers. | results are presented which offer strong evidence that extensive alteration of the fates of embryonic xenopus cells occurs independently of the schedule of cell division, after operations which lead to a doubling of the axial pattern of mesodermal differentiation in the gastrula. the experimental strategy was to make estimates of total mesodermal cell numbers and mitotic index in closely matched sets, each of three synchronous sibling embryos, fixed during the ten hours following the close of ga ... | 1979 | 479743 |
| the ultrastructure of the dorsal yolk-free cytoplasm and the immediately surrounding cytoplasm in the symmetrized egg of xenopus laevis. | cytoplasmic segregation and subsequent dorsad displacement of the segregated cytoplasm lead to symmetrization of the egg of xenopus laevis. at 60 min post-fertilization (p.f.) the 'dorsal yolk-free cytoplasm' (dyfc) is located in the dorso-animal part of the egg. its ultrastructure and that of the immediately surrounding cytoplasm have been studied with transmission electron microscopy (tem). the endoplasmic reticulum (er) within the dyfc consists of single or paired cisternae and many small ves ... | 1979 | 479742 |
| embryonic appearance of alpha, beta, and gamma crystallins in the periodic albinism (ap) mutant of xenopus laevis. | the appearance of the crystallins during lens development in the periodic albinism (ap/ap) mutant of xenopus laevis has been studied. using antibodies specific for total crystallins, alpha + beta crystallins, and gamma crystallins in the immunofluorescence technique, the first positive reaction for all could be demonstrated in the nieuwkoop-faber stage 31 lens rudiment. the antibody to alpha + beta crystallins exhibited differences in intensity from cell to cell in the early rudiment, while the ... | 1979 | 478209 |
| isolation from xenopus laevis embryonic cells of a factor which stimulates tibosomal rna synthesis by isolated nuclei. | 1979 | 478171 | |
| a cell-free assay system for the analysis of changes in rna synthesis during the development of xenopus laevis. | 1979 | 478170 | |
| synthesis of dictyostelium discoideum secretory proteins in xenopus laevis oocytes. | 1979 | 477987 | |
| export of proteins from oocytes of xenopus laevis. | when human lymphoblastoid mrna was microinjected into x. laevis oocytes, titers of interferon rapidly reached a maximum inside the oocyte while accumulation of interferon continued in the incubation medium for at least 45 hr. if interferon protein was injected into oocytes it was rapidly inactivated. significantly, newly synthesized interferon but not injected interferon was found to be membrane-associated. further experiments involving the co-injection of mrnas coding for secretory proteins (gu ... | 1979 | 476830 |
| meiotic maturation in xenopus laevis oocytes initiated by insulin. | insulin can induce meiotic division in xenopus laevis oocytes. this effect shows the specificity expected of a receptor-mediated mechanism. it is potentiated by ethynylestradiol, a steroid antagonist of pregesterone (the natural hormone that provokes meiosis). the xenopus laevis oocytes may serve as a model for the study of the poorly understood effect of insulin on cell division. | 1979 | 472755 |
| development of synaptic ultrastructure at neuromuscular contacts in an amphibian cell culture system. | cultures of dissociated myotomal muscle and spinal cord derived from embryos of xenopus laevis were grown in the presence of curare in order to abolish neuromuscular activity and were examined by electron microscopy. in one-day-old cultures a few of the neuromuscular contacts already displayed several synaptic specializations including 500 a vesicles clustered against the axolemma, increased axolemmal densities, basal lamina in the cleft, an increased sarcolemmal density and subsarcolemmal filam ... | 1979 | 469576 |
| in vitro synthesis of rna by xenopus spermatogenic cells i. evidence for polyadenylated and non-polyadenylated rna synthesis in different cell populations. | premeiotic and postmeiotic (haploid) gene expression during spermatogenesis in the anuran, xenopus laevis, was studied by analyzing the accumulation of radioactively labelled cytoplasmic polyadenylated [poly (a +)] and non-polyadenylated [poly (a -)] rnas. dissociated spermatogenic cells were labelled and maintained in an in vitro system capable of supporting cell differentiation. labelled cells were separated by density gradient centrifugation into subpopulations enriched for individual spermat ... | 1979 | 469479 |
| classes of proteins synthesized in oocytes, eggs, embryos, and differentiated tissues of xenopus laevis. | two-dimensional gel electrophoresis has been used to analyse protein synthesis in embryonic stages and in three differentiated tissues of xenopus laevis. the patterns found in oocyte, unfertilized eggs, embryos shortly after fertilization and at progressively later stages of development have been characterized and compared with the patterns found in the brain, heart and liver of tadpoles. the results suggest that at least four classes of proteins can be recognized among the proteins synthesized, ... | 1979 | 467870 |
| synthesis and glycosylation of rat prostatic binding protein in xenopus laevis oocytes. | 1979 | 467658 | |
| biochemical research on oogenesis. transfer rna is fully charged in the 42-s storage particles of xenopus laevis oocytes. | 1. transfer rna makes up 30-40% of total rna in previtellogenic oocytes of xenopus laevis. the bulk of trna is associated with 5-s rna and two proteins in a high-molecular-weight complex sedimenting at 42s. 2. we show here that all kinds of trna are present in the 42-s particles and all of them sediment coincidently. particle trna is fully charged in vivo. during purification of the 42-s particles trna becomes partially uncharged. when purified particles are incubated in vitro with amino acids a ... | 1979 | 467449 |
| the nucleolus organizers of plethodon and aneides located by in situ nucleic acid hybridization with xenopus 3h-ribosomal rna. | the main clusters of ribosomal genes, or nucleolus organizers, have been located by in situ nucleic acid hybridization of xenopus laevis 3h labelled ribosomal rna to mitotic chromosomes in squash preparations of intestinal epithelium from 7 species of plethodon and 3 species of aneides. the species used were chosen on account of having well known karyotypes and genome sizes. the plethodon species covered a range of genome size of 20--69.4 pg. the locations of those nucleolus organizers that coul ... | 1979 | 467168 |
| newly synthesized histones in chromatin of early embryos of xenopus laevis. | 1979 | 466704 | |
| the carbohydrate content of isolated yolk platelets from early developmental stages of xenopus laevis. | 1979 | 466703 | |
| toxicity and teratogenicity of aromatic amines to xenopus laevis. | 1979 | 465773 | |
| chromatin structure of the 5s ribonucleic acid genes of xenopus laevis. | 1979 | 465464 |