| the synthesis and storage of histones during the oogenesis of xenopus laevis. | | 1977 | 558925 |
| transcriptional organization of the 5.8s ribosomal rna cistron in xenopus laevis ribosomal dna. | hybridization of purified, 32p-labeled 5.8s ribosomal rna from xenopus laevis to fragments generated from x. laevis rdna by the restriction endonuclease, ecori, demonstrates that the 5.8s rrna cistron lies within the transcribed region that links the 18s and 28s rrna cistrons. | 1977 | 559301 |
| citrus exocortis viroid: survey of protein synthesis in xenopus laevis oocytes following addition of viroid rna. | | 1977 | 560084 |
| synthesis of heterogeneous nuclear rna in full-grown oocytes of xenopus laevis (daudin). | at various times following injection of either 3h-gtp or 32po4 into full-grown (stage 6) xenopus laevis oocytes, rna has been extracted and fractionated on polyacrylamide gels. based on size, base composition and incorporation data, we have defined the kinetics of synthesis and accumulation of ribosomal rna (40s, 28s, 18s), heterogeneous rna of high molecular weight (greater than 40s) and heterogeneous rna migrating with molecular weights of from 4s to 40s. nuclear isolations have been performe ... | 1977 | 560257 |
| protein synthesis in oocytes of xenopus laevis is not regulated by the supply of messenger rna. | | 1977 | 560911 |
| recombinant dna formation in a cell-free system from xenopus laevis eggs. | a cell-free system is described which formed very high levels of recombinant dna structures in 4 hr at 26 degrees c. it consisted of a single fraction of a high speed supernatant prepared from an extract of unfertilized eggs of the frog xenopus laevis. this fraction eluted at 0.16-0.18 m tris homogenization buffer from a deae-cellulose column. when two partially homologous supercoiled dna molecules of different contour lengths were incubated simultaneously in this system, high levels of heterolo ... | 1977 | 561663 |
| neurite complexes with merkel cells in larval tentacles of xenopus laevis. | | 1979 | 535028 |
| mitochondrial dna synthesis in large and mature oocytes of xenopus laevis. | | 1977 | 556708 |
| concanavalin a binding to oocytes and eggs of xenopus laevis. | | 1977 | 556994 |
| 5'-terminal structure and mrna stability. | reovirus mrnas with 5'terminal m7gpppgm or gpppg are more stable than mrna containing unblocked ppg 5'-ends when injected into xenopus laevis oocytes or incubated in cell-free protein synthesising extracts of wheat germ and mouse l cells. the greater stability of mrna with blocked 5' termini is not dependent upon translation but seems to result from protection against 5'-exonucleolytic degradation. | 1977 | 557727 |
| a method for enucleating oocytes of xenopus laevis. | a method is described for the enucleation and complete healing of xenopus oocytes so that the enucleated oocytes withstand multiple injections and culture for several days. the oocytes are defolliculated and enucleated manually and allowed to heal in a potassium phosphate buffer. oocytes enucleated in this way support rna synthesis by injected hela-cell nuclei 3 days later. this method is valuable in providing a low-background system in which transcription of injected nuclei can be studied. | 1977 | 558275 |
| the nucleotide sequence of oocyte 5s dna in xenopus laevis. ii. the gc-rich region. | the primary sequence of the gc-rich half of the repeating unit in x. laevis 5s dna has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. the gc-rich half of the repeating unit contains a single long duplication of 174 nucleotides. the duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. the duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotid ... | 1978 | 566164 |
| translation of mouse interferon mrna in xenopus laevis oocytes and in rabbit reticulocyte lysates. | | 1978 | 566552 |
| translation "in vitro" of globin mrna from xenopus laevis. | rna isolated from xenopus laevis reticulocytes and characterized as globin mrna (meza et al., 1978) was tested for its capacity to stimulate "in vitro" a wheat germ translation system, and the ability to synthesize a polypeptide. the latter was identified as globin by its electrophoretic mobility and immunoprecipitation with antiglobin antibody. | 1978 | 566631 |
| changes of the external and internal pigment pattern upon fertilization in the egg of xenopus laevis. | external and internal pigment shifts in xenopus laevis eggs were studied between fertilization and first cleavage. externally visible, constant features are: (1) the 'activation contraction', a pigment shift towards the animal side taking place between 5 and 15 min post fertilization (p.f.) and (2) the concentration of the pigment around the sperm entrance point leading to the formation of the grey crescent at the opposite side of the egg. hence, in xenopus the grey crescent is not formed by rot ... | 1978 | 566780 |
| restriction analysis of the nontranscribed spacers of xenopus laevis ribosomal dna. | | 1977 | 560255 |
| [modulation of the citrate cycle in mitochondria of xenopus laevis oocytes and biorhythms. i. characteristics of "holocoherent" mitochondria]. | | 1978 | 567416 |
| expression of regenerative capacity of caudal spinal cord during the larval development of xenopus laevis. | | 1979 | 547620 |
| cellular localization of dna polymerase activities in full-grown oocytes and embryos of xenopus laevis. | | 1977 | 562269 |
| calcium, potassium, and sodium exchange by full-grown and maturing xenopus laevis oocytes. | | 1977 | 562807 |
| the simultaneous production of two classes of cytoplasmic immunoglobulins by single cells in xenopus laevis. | | 1978 | 568035 |
| comparison of in vivo and in vitro ribosomal rna synthesis in nucleolar mutants of xenopus laevis. | cells of embryos carrying a lethal nucleolar mutation have been maintained in vitro for extended periods of time. normally these mutants live only 9 to 12 days after fertilization but their cells in culture will survive for more than 3 months. the extent of ribosomal rna (rrna) synthesis was determined in primary cultures prepared from normal embryos and nucleolar mutants having different numbers of ribosomal rna genes. we found that the accumulation of radioactivity into rrna for normal and mut ... | 1977 | 562840 |
| the isolation and characterization of a second oocyte 5s dna from xenopus laevis. | a second and minor dna component containing 5s rna genes has been purified from the genomic dna of xenopus laevis (xit 5s dna). some of its physical and chemical characteristics are described. it contains a 5s rna gene sequence which has some oocyte and some somatic-specific residues, as well as nucleotides which differ from both types of 5s rna. there are about 2000 of these 5s rna genes per haploid complement of dna compared to about 24,000 of the principal oocyte 5s rna genes. the multiple re ... | 1977 | 563770 |
| diffusible and bound actin nuclei of xenopus laevis oocytes. | several criteria have been used to identify actin in hand-isolated nuclei of xenopus laevis oocytes; these include co-migration with actin on sds-polyacrylamide gels, immunological cross-reactivity with antiserum against actin, binding to dnaase i and peptide mapping on sds gels. the use of hand-isolated nuclei precludes the possibility of contamination from cytoplasmic actin or the leakage of significant amounts of actin from nuclei during isolation. actin constitutes roughly 6% of the total nu ... | 1977 | 563771 |
| dna synthesis in a multi-enzyme system from xenopus laevis eggs. | cytoplasm from unfertilized eggs of the frog xenopus laevis was separated by deae-cellulose column chromatography into nine fractions. supercoiled pxir 11 dna molecules (pxir 11 is a col el-based recombinant plasmid containing part of the xenopus laevis 18s and 28s ribosomal genes and transcribed spacer region) were incubated with each fraction singly and in various combinations. after incubation for 4 hr at 26 degrees c, the pxir 11 dna was reisolated and examined by electron microscopy. using ... | 1978 | 564241 |
| three-dimensional structure of the lipovitellin-phosvitin complex from amphibian oocytes. | microcrystals of the lipoprotein-phosphoprotein complex which are found in the oocytes of xenopus laevis were examined using electron microscopy. analysis of fourier transforms of the images of the (010) and (001) projections showed the space group to be p2(1)22(1). ten projections were combined to produce a map of the complex having about 20 a resolution. the lipoprotein complex consists of two subunits related by a local twofold symmetry axis. the density was averaged around the local symmetry ... | 1978 | 564460 |
| analysis of xenopus laevis ovary and somatic cell polyadenylated rna by molecular hybridization. | | 1978 | 564793 |
| studies on the conformation of the 3' terminus of 18-s rrna. | we have studied the conformation of the 3' end of 18-s rna from human, hamster and xenopus laevis cells. the 3'-terminal oligonucleotide in a t1 ribonuclease digest of 18-s rna from hela cells was identified, using a standard fingerprinting method. the sequence (g)-a-u-c-a-u-u-a, established by eladari and galibert for hela 18-s rrna, was confirmed. an identical 3' terminus is present in hamster fibroblasts and xenopus laevis cells. the ease of identification of this oligonucleotide has enabled ... | 1978 | 565287 |
| actin in xenopus oocytes. ii. intracellular distribution and polymerizability. | the largest oocytes of xenopus laevis were broken open in the absence of shearing forces which might transfer actin from particulate to supernatant fractions. particulate and postmitochondrial supernatant fractions were prepared by centrifugation. sds-electrophoretic fractionation on polyacrylamide gels and quantitative scanning techniques were used to separate actin and to assay its amount in cellular fractions. the actin has been identified in electrophoretograms by its molecular weight and it ... | 1978 | 565782 |
| the effects of high hydrostatic pressure on microfilaments and microtubules in xenopus laevis. | xenopus laevis embryos of stages 14-20 were subjected, for periods of 5-330 min, to hydrostatic pressures ranging from 500 to 10 000 psi. the specimens were fixed under corresponding pressures and their neuroepithelium was studied under light and electron microscopy. a pressure of 3000 psi, maintained for as long as 180 min, did not inhibit neurulation though it induced slight deformities of the neuroepithelium. a pressure of 4000 psi, applied for 180 min, disrupted the apical ring of microfilam ... | 1978 | 565800 |
| a new method for local artificial insemination of xenopus laevis eggs. | | 1979 | 545168 |
| an ultrastructural study of the effects of wheat germ agglutinin (wga) on cell cortex organization during the first cleavage of xenopus laevis eggs. ii. cortical wound healing. | uncleaved fertilized eggs of xenopus laevis treated with wheat germ agglutinin (wga) have been pricked at the animal pole both inside and outside the regressed furrow region. the wounded cortex of both regions has been studied with the electron microscope and compared with the same region of wounded, untreated eggs. in all 3 cases, filaments are organized in an annular zone in the damaged cortex. when the surface is pricked outside the regressed furrow of wga-treated embryos, bundles of microfil ... | 1979 | 573275 |
| changes of nucleosome frequency in nucleolar and non-nucleolar chromatin as a function of transcription: an electron microscopic study. | the morphology of nucleolar and non-nucleolar (lampbrush chromosome loops) chromatin was studied in the electron microscope during states of reduced transcriptional activity in amphibian oocytes (xenopus laevis, triturus alpestris, t. cristatus). reduced transcriptional activity was observed in maturing stages of oocyte development and after treatment with an inhibitor, actinomycin d. strands of nucleolar chromatin appear smooth and thin, and contain only few, if any, nucleosomal particles in th ... | 1978 | 566162 |
| the nucleotide sequence of oocyte 5s dna in xenopus laevis. i. the at-rich spacer. | the primary sequence of the principal spacer region in x. laevis oocyte 5s dna has been determined. the spacer is at-rich and comprises half or more of each repeating unit. the sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: caacagttttcaaaaggtttcgaagttttt(t). the spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (a2) which is variable in length in different repeating units, flanked ... | 1978 | 566163 |
| surface changes during development and involution of the cement gland of xenopus laevis. | the cement gland was studied from stage 17, when the anlage is established, to stage 49, shortly before its disappearance. at early stages, the apical membrane is covered by small microvilli that are more abundant than in the surrounding epiblast cells. vesicular protrusions along the cell boundaries are also more numerous in the gland cells. when the gland reaches maturity, the apical membranes of gland cells differentiate into two regions. in the cranial, kidney-shaped region, the membranes ar ... | 1978 | 569548 |
| a nuclear extract of xenopus laevis oocytes that accurately transcribes 5s rna genes. | xenopus 5s rna genes in recombinant form with the plasmid pmb9 are transcribed accurately when added to a supernatant fraction obtained from disrupted nuclei of xenopus laevis oocytes. after an initial 30 min lag period, the rate of synthesis of 5s rna is constant for at least an hour and synthesis is still detected after 18 hr. as much as 40% of the total rna synthesized from the recombinant dna used in these experiments can be 5s rna. the coding strand of the 5s rna genes is transcribed at a r ... | 1978 | 569551 |
| effects of estradiol-17beta in the male xenopus laevis: isolation and translation of cytoplasmic messenger rna populations. | total xenopus liver cytoplasmic rna isolated following long-term estrogen administration (14 days) was fractioned using sepharose 4b chromatography. one of the sepharose 4b peaks was shown to contain rna with a molecular weight reported for vitellogenin mrna (approximately 34s). the presence of estrogen-induced vitellogenin mrna in the peak 5 rna was determined by translation of the rna in the oocyte and analysis of the oocyte translational products by immunoprecipitation with anti-vitellogenin. ... | 1978 | 569762 |
| mitochondria dna synthesis in oocytes of xenopus laevis. | | 1979 | 570931 |
| effects of injected inhibitors of microfilament and microtubule function on the gastrulation movement in xenopus laevis. | | 1979 | 571368 |
| the modification of stored histones h3 and h4 during the oogenesis and early development of xenopus laevis. | | 1979 | 571369 |
| ultraviolet effects on presumptive primordial germ cells (ppgcs) in xenopus laevis after the cleavage stage. | | 1979 | 571826 |
| frequency response of the lateral-line organ of xenopus laevis. | the stimulus response relation of the epidermal lateral-line organ of xenopus laevis was studied by recording activity of single afferent nerve fibres in isolated preparations. linear frequency response analysis over a frequency range of 0.1--100hz was performed under steady-state conditions, using small amplitude, sinusoidal water displacements produced by a glass sphere at a short distance from the skin. period histograms of afferent nerve activity were computed, and amplitude, phase and mean ... | 1978 | 567787 |
| modulations of histone messenger rna during the early development of xenopus laevis. | | 1979 | 572787 |
| an ultrastructural study of the effects of wheat germ agglutinin (wga) on cell cortex organization during the first cleavage of xenopus laevis eggs. i. inhibition of furrow formation. | xenopus laevis fertilized eggs have been treated with wheat germ agglutinin (wga) before the onset of the first cleavage, at the stripe stage and during groove deepening. the ultrastructure of the animal cortex of the arrested embryos has been compared with that of the same region of control embryos at different stages of first furrow formation and of cytochalasin b-treated embryos. the outer side of the plasma membrane of wga-treated embryos is covered with a coat which is different from the di ... | 1979 | 573274 |
| changes in protein synthesis during the development of xenopus laevis. | patterns of protein synthesis during the development of xenopus were studied by two-dimensional gel electrophoresis. up to the end of the blastula stage we find no newly synthesized proteins which are not already made in the oocyte. the first new proteins are seen during gastrulation, and they increase in number during neurulation. some of these are restricted to the 'ectodermal' region, and some to the 'endodermal' region of embryos divided into two parts. these new, region-specific proteins in ... | 1979 | 573306 |
| researches on the development of xenopus laevis larvae fed on tubifex tubifex. i. presence of liposoluble vitamins in the lipid extract from tubifex worms. | vitamin e acetate (alpha-tocopheryl acetate) and related tocopherols, vitamin a acetate (dehydroretinyl acetate), vitamin a alcohol (retinol), and cholesterol were identified by thin-layer chromatography in the lipid extract from tubifex tubifex worms. compounds (perhaps vitamin d precursors, or seroidal substances) absorbing short wave uv light and/or reacting with antimony trichloride were also present but not identified. the results are discussed in relation to the growth, metamorphosis and p ... | 1977 | 576033 |
| in vivo aminoacylation and 'processing' of turnip yellow mosaic virus rna in xenopus laevis oocytes. | | 1978 | 567751 |
| events in the germ cell lineage after entry of the primordial germ cells into the genital ridges in normal and u.v.-irradiated xenopus laevis. | | 1977 | 591877 |
| transmembrane effects of lectins. i. effects of wheat germ agglutinin and soybean agglutinin on furrow formation and cortical wound healing in xenopus laevis eggs. | | 1978 | 568554 |
| estradiol-binding protein in the nucleus of male xenopus laevis liver. | | 1978 | 651871 |
| ultrastructural study on hepatic melanin in xenopus laevis. | the livers of xenopus laevis, grouped by chronological age (0.5, 2 and 3 yrs), were studied electron microscopically. ultrastructurally most of the melanin granules in the mature female liver showed an internal structure similar to the melanin granules of the oocytes. the hepatic melanin granules of immature females and of all males were pleomorphic and failed to show the characteristic internal structure similar to those of the oocytes. the oocyte is the probable source of most of the hepatic m ... | 1977 | 597850 |
| abnormalities in the visual system of xenopus after larval optic nerve section. | one optic nerve was cut in a series of larval xenopus laevis; in approximately half of these the corresponding eye was also rotated. the resultant primary visual projections were mapped in the adult. although in most cases the projections were retinotopically normal, some of them were not. these abnormal projections were consistently associated with a very thin optic nerve which reached the tectum via the oculomotor route. animals with rotated eyes which developed retinotopically organised prima ... | 1977 | 598434 |
| comparison of cell division and cell sizes in normal embryos and lithium-induced exogastrulae of xenopus laevis. | | 1977 | 605749 |
| electron microscopic studies of the developing amphibian thymus. | electron-microscopic studies of larval xenopus laevis thymus at three different stages of development are presented. studies of thymus from 5 and 8 day old larvae (ages when early thymectomy is performed) reveal a relatively undifferentiated rudiment composed of epithelial cells and lymphoid cell precursors. these findings are in marked contrast to ultrastructural observations of 30 day old larval thymus, where there exists a well defined corticomedullary differentiation with an abundance of sma ... | 1977 | 612468 |
| antibody-dependent cellular cytotoxicity in poikilotherms. | 51cr-chromate labelled chicken red blood cells, treated with rabbit (anti-chicken red blood cell) serum, are lysed in vitro, in the absence of complement, by spleen cells from xenopus laevis, ambystoma mexicanum or lacerta viridis. optimal conditions for lysis by xenopus spleen cells were determined. the phenomenon seems homologous with antibody-dependent cellular cytotoxicity (adcc) mediated by mammalian or avian k cells. the phylogenetic significance of the finding is discussed. | 1977 | 612470 |
| post-translational assembly of lens alpha-crystallin in the reticulocyte lysate and in xenopus laevis oocytes. | lens mrna was translated in reticulocyte lysate predominantly into monomeric alpha-crystallin chains. lens polyribosomes added to the cell-free system produced the same polypeptides, but these were detected predominantly in alpha-crystallin aggregates. lens mrna, after microinjection into xenopus laevis oocytes, produced alpha-crystallin subunits that were exclusively found in the form of high-molecular-weight complexes. also after injection of the purified 14-s mrna, coding for the alphaa subui ... | 1978 | 569053 |
| studies of the injection of poly(a)+ protamine mrna into xenopus laevis oocytes. | | 1978 | 569063 |
| oocyte-follicle cell gap junctions in xenopus laevis and the effects of gonadotropin on their permeability. | junctions between xenopus laevis oocytes and follicle cells have been identified as gap junctions by the passage of microinjected fluorescent dye from oocytes to follicle cells. the opening or assembly of these junctions, or both, appears to be regulated by gonadotropins. | 1979 | 569364 |
| a natural heterohaemagglutinin in xenopus laevis serum. | in most adult xenopus laevis the serum contains a 'natural' factor capable of lysing the erythrocytes from a wide variety of amniote species. the factor has no effect on the erythrocytes of another amphibian, ambystoma mexicanum, nor will serum from one animal lyse red cells from another xenopus individual. no lysing factor was present in the serum of larval (tadpole) xenopus. heating of xenopus serum to 56 degrees for 30 min, absorption of the serum with zymosan or inulin, or removal of calcium ... | 1978 | 580428 |
| oogenesis in xenopus laevis (daudin). v. relationships between developing oocytes and their investing follicular tissues. | | 1978 | 619165 |
| variability among laboratories in the occurrence of functional modification in the intertectal visual projection of xenopus laevis [proceedings]. | | 1977 | 592182 |
| steroid biosynthesis by ovarian follicles of xenopus laevis in vitro during oogenesis. | | 1978 | 631550 |
| a low molecular weight dna polymerase from ovaries of the frog xenopus laevis. dna polymerase-beta (ovarian). | | 1978 | 632291 |
| mapping of mitochondrial dna in xenopus laevis and x. borealis: the positions of ribosomal genes and d-loops. | | 1978 | 633366 |
| cell specialization in the small intestinal epithelium of adult xenopus laevis: structural aspects. | the structure, cellular composition and organization of the small intestinal epithelium of adult xenopus laevis are described. the mucosa is thrown into a system of longitudinal folds and is composed mainly of columnar cells and goblet cells. leucocytes comprise about 28% of the mucosal cells. the degree of structural specialization of columnar cells varies according to their position in the folds. cells at the crest of the folds display the greastest degree of specialization, evidenced by the d ... | 1978 | 632211 |
| translation and characterization of the fatty acid synthetase messenger rna. | fatty acid synthetase messenger rna was obtained from rat liver polysomal rna and then injected into xenopus laevis oocytes. the radioactive fatty acid synthetase protein synthesized in the oocytes was identified by immunoprecipitation with anti-fatty acid synthetase antibody and the immunoprecipitate was then characterized by electrophoresis on sodium dodecyl sulfate-polyacrylamide gel. co-migration of authentic fatty acid synthetase and the labeled product synthesized in oocytes was observed. ... | 1978 | 632268 |
| use of restriction enzymes to study eukaryotic dna methylation: i. the methylation pattern in ribosomal dna from xenopus laevis. | | 1978 | 625056 |
| oogenesis in xenopus laevis (daudin). vi. the route of injected tracer transport in the follicle and developing oocyte. | in xenopus laevis, vitellogenin (the yolk precursor) is synthesized in the liver and transported via the circulatory system to the ovary. in order to reach developing oocytes where it is sequestered, it must exit the circulatory system and traverse several follicular tissue layers including the theca, the follicle cell layer, and the vitelline envelope. this study demonstrates this pathway by means of electron-opaque tracers, and follows the fate of heterologous macromolecules after their incorp ... | 1978 | 641487 |
| fenestrae in the rough endoplasmic reticulum of xenopus laevis hepatocytes. | the rough endoplasmic reticulum (rer) of xenopus laevis hepatocytes was examined by freeze-fracture and by conventional thin section electron microscopy. much of the rer was present as stacks of cisternae at the cell periphery but, in addition, large whorls of cisternae were seen in the cytoplasm in most sections. freeze-fracture replicas revealed fenestrae in both stacked and whorled cisternae, although the fenestrae were more numerous in the whorls. the role of these fenestrae is unknown, but ... | 1978 | 646133 |
| cell specialization in the epithelium of the small intestine of feeding xenopus laevis tadpoles. | the intestinal epithelium of feeding xenopus laevis tadpoles was studied using light microscope, electron microscope and autoradiographic techniques. the wall of the small intestine differs from that of most other vertebrates studied in that it lacks villous-like folds. a single prominent longitudinal fold, the typhlosole, forms about stage 49, and a series of shallow longitudinal epithelial pleats is also present in some animals. the morphology of the epithelial cells indicates that there are n ... | 1978 | 649494 |
| nuclear surface complex as observed with the high resolution scanning electron microscope. visualization of the membrane surfaces of the neclear envelope and the nuclear cortex from xenopus laevis oocytes. | the nuclear envelope and associated structures from xenopus laevis oocytes (stage vi) have been examined with the high resolution scanning electron microscope (sem). the features of the inner and outer surfaces of the nuclear surface complex were revealed by manual isolation , whereas the membranes facing the perinuclear space (the space between the inner and outer nuclear membranes) were observed by fracturing the nuclear envelope in this plane and splaying the corresponding regions apart. pore ... | 1978 | 649659 |
| neural transduction in xenopus laevis lateral line system. | 1. the process of neural excitation in hair cell systems was studied in an in vitro preparation of the xenopus laevis (african clawed toad) lateral line organ. a specially designed stimulus chamber was used to apply accurately controlled pressure, water movement, or electrical stimuli, and to record the neural responses of the two afferent fibers innervating each organ or stitch. the objective of the study was to determine the characteristics of the neural responses to these stimuli, and thus ga ... | 1978 | 650276 |
| mapping of the xenopus laevis 5.8s rdna by restriction and dna sequencing. | the location of the 5.88 rdna within the internal transcribed spacer has been found by restriction and sequence analysis. these analyses indicate the deletion of a dinucleotide from the known rrna sequence. regions to the 5' and 3' of the gene contain both uncommon sequences and palindromic structures which might provide potential control points. a secondary structure model is suggested for the 5.8s rrna incorporating the flanking sequences. | 1978 | 652517 |
| differently sized rdna repeating units of xenopus laevis are arranged as internally homogeneous clusters along the nucleolar organizer. | the organization of differently sized genes coding for rrna in xenophus laevis has been investigated by partial ecori or hindiii digestion. the electrophoretic patterns obtained revealed that most adjacent repeating units are equally sized. this conclusion is in agreement with a previous suggestion that the nucleolar organizer is made up of internally homogeneous blocks of rrna genes. | 1978 | 652524 |
| histone h2b variants from the erythrocytes of an amphibian, a reptile and a bird. | histones h2b have been isolated from the terminally differentiated diploid erythrocytes of three different classes, amphibia (xenopus laevis), reptilia (crocodilus niloticus) and aves (gallus domesticus). partial amino acid sequences revealed three regions of sequence variation, each variant involving a single amino acid substitution. | 1978 | 638193 |
| xenopus laevis as a model for the study of immunology. | | 1978 | 640116 |
| an autoradiographic analysis of the retinal projection in the frog xenopus laevis: new observations in an anuran visual projection. | | 1978 | 656924 |
| cell specialization in the small intestinal epithelium of adult xenopus laevis: functional aspects. | the functional activity of the epithelial cells of the intestinal folds of xenopus was analysed histochemically. there is a gradient of increasing absorptive, digestive and secretory activity from the trough regions to the crests of the longitudinal folds. the differences in functional activity correspond to differences in structural complexity, and confirm the existence of a more specialized population of cells at the fold crests and a less specialized population at the fold troughs, analogous ... | 1978 | 624675 |
| the permeability of the skin of the aquatic anuran xenopus laevis (pipidae). | the undirectional transcutaneous fluxes of na, cl, water and urea were measured, in vitro, in the pipoid anuran xenopus laevis. an active uptake (outside to inside) of na was observed but cl movements appeared to be passive. the effluxes of na and cl were low compared to those measured in other species of amphibians. the active na transport was less than that of more terrestrial species and, although it could be stimulated by vasotocin, aldosterone was ineffective. the permeability of the skin t ... | 1978 | 624899 |
| electron microscopic studies on the structure of motile primordial germ cells of xenopus laevis in vitro. | primordial germ cells (pgcs) of xenopus laevis have been isolated from early embryos and kept alive in vitro, in order to study the structural basis of their motility, using the transmission and scanning electron microscope. the culture conditions used mimicked as closely as possible the in vivo environment of migrating pgcs, in that isolated pgcs were seeded onto monolayers of amphibian mesentery cells. in these conditions we have demonstrated that: (a) no significant differences were found bet ... | 1978 | 702027 |
| biochemical changes in developmentally retarded xenopus laevis larvae. i. the lens crystallin transition. | premetamorphic tadpoles of xenopus laevis reared in water containing 0.01% propylthiouracil are developmentally retarded and metamorphosis is prevented. when uncrowded, they continue to grow to a giant size. moderate crowding leads to a slower rate of growth. thus morphologically premetamorphic tadpoles were produced with lens diameters appropriate to either normal premetamorphic, climactic or post-metamorphic animals. the lens crystallins of such tadpoles have been separated by immunoelectropho ... | 1978 | 702033 |
| an ultrastructural study of the thyroid gland in the pre-metamorphic xenopus laevis (daudin) tadpole. | a simple method for obtaining the thyroid tissue of anuran tadpoles for ultrastructural study has been described. follicle and colloid formation in the thyroid gland have been observed in xenopus laevis tadpoles at an early stage. the activity of the thyroid gland of pre-metamorphic tadpoles does not seem to depend on the activity of the hypophysis cerebri and the hypothalamus. both 'light' and 'parafollicular' cells are present in the thyroid gland of premetamorphic xenopus laevis tadpoles. | 1978 | 640959 |
| thymocyte stem cell inflow in xenopus laevis, after grafting diploid thymic rudiments into triploid tadpoles. | | 1978 | 710665 |
| the transcription map of mouse mitochondrial dna. | nine transcripts complementary to mouse l cell mitochondrial dna have been detected, sized and mapped to restriction fragments using the method of berk and sharp (1977). rna isolated from l cell mitochondria was hybridized to 32p-labeled, cloned l cell mitochondrial dna restriction fragments in 70% formamide under conditions 5 degrees c above the melting temperature of the dna-dna duplex, but approximately 15 degrees c below the melting temperature of the rna-dna duplex. the heteroduplexed mater ... | 1978 | 667930 |
| effect of the nonionic detergent triton x-100 on sodium permeability of the myelinated nerve fibre of xenopus laevis. | the effect of the nonionic detergent triton x-100 (tx-100) on the na permeability (pna) properties of the nodal membrane in myelinated nerve fibres of xenopus laevis was analysed with potential clamp technique. application of tx-100 caused a rapid initial decrease in pna that was reversible at wash out as well as a slow irreversible block. both effects dependend on [tx-100] and duration of exposure. the reversible reduction of pna at the steady state was 50% at 40--60 micrometer tx-100. the slop ... | 1978 | 654934 |
| relative amounts of newly synthesized poly(a)+ and poly(a)- messenger rna during development of xenopus laevis. | | 1978 | 658590 |
| rapid accumulation of vitellogenin messenger rna during secondary estrogen stimulation of xenopus laevis. | accurate quantitation of low concentrations of vitellogenin mrna by hybridization to vitellogenin cdna allows analysis of the accumulation of new vitellogenin mrna sequences throughout secondary estrogen stimulation. administration of a secondary injection of estradiol-17 beta to male xenopus laevis which have been withdrawn from estrogen for 60 days results in synthesis of complete vitellogenin mrna molecules in as little as 1 h after restimulation. vitellogenin mrna accumulates at a rate of 13 ... | 1978 | 659432 |
| induced formation of asters and cleavage furrows in oocytes of xenopus laevis during in vitro maturation. | we have previously reported that injection of purified basal bodies or sperm into unfertilized eggs of xenopus laevis induced the formation of asters and irregular cleavage furrows. fully grown oocytes were found to be unable to form asters or cleavage furrows. in this paper we show that the oocyte acquires the ability to form asters upon basal body injection at the time of germinal vesicle breakdown during in vitro maturation. our evidence indicates that aster formation requires progesterone-st ... | 1978 | 660144 |
| characterization of globin mrna from xenopus laevis. | a 9s polyadenylated mrna was isolated from 'xenopus laevis reticulocytes and purified by sedimentation and oligo-dt-cellulose chromatography. the size of this rna estimated in denaturing agarose gels was 2.2 x 10(5) daltons. 9s polyadenylated mrna hydridized to total dna with a cot1/2 of 3.8 x 10(3). | 1978 | 667964 |
| lack of effect of blood-volume expansion on short-circuit current across an isolated toad skin incorporated in the circulation of a rat. | 1. evidence for the existence of 'natriuretic hormone' resides, in part, in the demonstration that blood volume expansion in the dog is followed by a transient fall in short-circuit current (scc) across a frog skin incorporated within its circulation. 2. we have attempted to confirm this effect in the rat, with a toad skin (xenopus laevis) incorporated within the circulation. the skins, bathed in whole rat blood, displayed low scc; skins bathed in 'mammalian' ringer solution displayed equally lo ... | 1978 | 668266 |
| the nucleotide sequences of 5.8-s ribosomal rna from xenopus laevis and xenopus borealis. | 1. the nucleotide sequence of 5.8-s rrna from xenopus laevis is given; it differs by a c in equilibrium u transition at position 140 from the 5.8-s rrna of xenopus borealis. 2. the sequence contains two completely modified and two partially modified residues. 3. three different 5' nucleotides are found: pu-c-g (0.4) pc-g (0.2) and pg (0.4). 4. the 3' terminus is c not u as in all other 5.8-s sequences so far determined. 5. the x. laevis sequence differs from the mammalian and turtle sequences by ... | 1978 | 668689 |
| the pseudouridine contents of the ribosomal ribonucleic acids of three vertebrate species. numerical correspondence between pseudouridine residues and 2'-o-methyl groups is not always conserved. | the pseudouridine contents of the rrna species of hela cells, mouse l-cells and xenopus laevis cultured kidney cells were examined. pseudouridine, like 2'-o-methylation, was found to occur relatively frequently in each of the high-molecular-weight rrna species. however, the numerical data do not support the idea that there is a general one-to-one relationship between pseudoridine residues and 2'-o-methyl groups in vertebrate rrna. | 1978 | 666737 |
| [transfer of behavior patterns through transplantation of systems of neuroanatomic structures in amphibian larvae. ii. xenoplastic transplantation of hind brain systems between xenopus laevis (daud.) as well as hymenochirus boettgeri (torn.) and triturus vulgaris]. | by replacing parts of the neural plate (prospective medulla oblongata) of triturus vulgaris by neural ectoderm of xenopus laevis larval chimaeras were obtained, which showed donorlike rhythmical movements of distinct parts of the visceral musculature according to the place of implantation. especially the branchial region with its external gills showed rhythmical movements and is the special object of this investigation. | 1978 | 654606 |
| large scale isolation of nuclei and nucleoli from vitellogenic oocytes of xenopus laevis. | a new method is described which allows the purification of large quantities of nuclei (germinal vesicles) from xenopus laevis vitellogenic oocytes of different developmental stages. from the isolated nuclei, purified nucleoli were obtained. the isolated germinal vesicles are transcriptionally active showing endogenous rna polymerase activity as well as a high level of activity with an exogenously added template. | 1978 | 657930 |
| anatomical mapping of retino-tectal connections in developing and metamorphosed xenopus: evidence for changing connections. | neural connections between the eye and optic tectum in xenopus laevis were anatomically traced by observing the tectal location of wallerian degeneration after discrete retinal lesion. these retinotectal connections were mapped in postmetamorphic frogs and tadpoles at stage 51, the stage at which retinal axons have grown into about the rostral one-half of the tectum. the course of the experimental degeneration was the same in frogs and tadpoles, but degeneration proceeded faster in the younger a ... | 1978 | 670862 |
| somite abnormalities caused by short heat shocks to pre-neurula stages of xenopus laevis. | this paper describes the small disturbances, in the regular pattern of the somites and the fissures between them, that are seen following short (around 300 s) heat shocks at 37.5 degrees c delivered to pre-neurula stages of xenopus laevis. affected groups of cells still finally differentiate as somite muscle, but the normally precise spatio-temporal sequence in which they move beforehand to give rise to the actual pattern of somite blocks, is disrupted. examination of the position and sizes of p ... | 1978 | 670864 |
| the induction of triploidy by pressure in xenopus laevis. | | 1978 | 675141 |
| stimulated dna synthesis in frog nuclei by cytoplasmic extracts of temperature-sensitive mammalian cells. | cytoplasmic extracts of proliferating cells stimulate dna synthesis in isolated nuclei of xenopus laevis liver. when tested by the same assay, cytoplasmic extracts of resting cells are completely inactive. when cytoplasmic extracts are prepared from cell cycle-specific temperature-sensitive mutants arrestd in the g1 phase of the cell cycle by the nonpermissive temperature, they also fail to stimulate dna synthesis in frog nuclei. the results indicate that, to stimulate dna synthesis in isolated ... | 1978 | 675253 |
| studies on the liver of xenopus laevis. iii. the ultrastructure and the glycogen content of the developing liver. | | 1978 | 677479 |
| mapping of mitochondrial 4 s rna genes in xenopus laevis by electron microscopy. | | 1978 | 671539 |