| growth phase and the number of phosphorylation sites in the mitochondrial electron transport chain of acanthamoeba castellanii. | | 1973 | 4350907 |
| cytochemical identification of phosphatase activity in the contractile vacuole of acanthamoeba castellanii. | | 1973 | 4357463 |
| [the role of adenosine-3',5'-monophosphate in the development of acanthamoeba castellanii (author's transl)]. | | 1974 | 4368284 |
| the effects of cell population density on the plasma membrane of acanthamoeba castellanii. | | 1974 | 4373257 |
| increased phospholipase a activity and formation of communicative contacts between acanthamoeba castellanii cells. effect of 3',5'-cyclic amp. | | 1974 | 4376087 |
| enzymatic properties of microsomal membranes from the protozoan acanthamoeba castellanii. | | 1971 | 4398850 |
| [polyadenylic acid-containing rna and gene expression during the development of acanthamoeba castellanii (author's transl)]. | | 1974 | 4429739 |
| uridine diphosphate glucose pyrophosphorylase of acanthamoeba castellanii. purification, kinetic, and developmental studies. | | 1974 | 4430676 |
| growth and encystation of acanthamoeba castellanii. | | 1974 | 4436650 |
| [development of acanthamoeba castellanii into a cyst with and without modification of gene activity pattern]. | | 1974 | 4449098 |
| the genomic complexity of acanthamoeba castellanii mitochondrial dna. | | 1974 | 4452364 |
| [the adenosinephosphate system during growth and development of acanthamoeba castellanii (author's transl)]. | | 1974 | 4455132 |
| isolation and characterization of mitochondrial deoxyribonucleic acid of acanthamoeba castellanii. | dna was prepared from isolated mitochondria of acanthamoeba castellanii and was shown to behave as a single component in density gradients, on ;melting' and on renaturation. from measurements of renaturation kinetics, sedimentation coefficient and electron micrographs the genome size of the mitochondrial dna was calculated to be about 3.4x10(7) daltons. a small proportion of the preparations could be isolated as relaxed circular molecules of mean contour length 16.2mum. | 1974 | 4455199 |
| effects of cycloheximide on rna polymerase specific activity and encystment in acanthamoeba castellanii. | | 1973 | 4583092 |
| isolation of a pathogenic strain of acanthamoeba castellani in romania. | | 1973 | 4584317 |
| purification and properties of bacteriolytic enzyme produced by acanthamoeba castellanii. | | 1972 | 4671545 |
| enzymatic mode of action of the bacteriolytic enzyme form acanthamoeba castellanii. | | 1972 | 4671643 |
| rna synthesis and turnover during density-inhibited growth and encystment of acanthamoeba castellanii. | alterations in transcription that precede and accompany encystment (e) of suspension grown a. castellanii have been investigated. comparative studies were performed on cells undergoing spontaneous e in high density stationary phase cultures or after experimental induction of e at low cell densities by deprivation of nutrients in exponential growth. onset of growth deceleration at high cell densities was accompanied by an increase in the cellular rna. the maximum rna content occurred in cells at ... | 1973 | 4696550 |
| dna-dependent rna polymerase from trophozoites and cysts of acanthamoeba castellanii. | | 1973 | 4701078 |
| carbohydrate metabolism in acanthamoeba castellanii. i. the activity of key enzymes and (14c)-glucose metabolism. | | 1973 | 4754748 |
| circular mitochondrial dna from acanthamoeba castellanii (neff-strain). | | 1973 | 4759454 |
| changes in transfer ribonucleic acids accompanying encystment in acanthamoeba castellanii. | transfer ribonucleic acid (trna) from exponentially growing cells (trophozoites) and from precysts of acanthamoeba castellanii were examined by reversed-phase column (rpc-2) chromatography. this system gave excellent resolution of isoaccepting species of trna. the trnas for 12 amino acids were studied. a comparison of trophozoite and precyst trna elution profiles revealed no apparent differences in the number of isoaccepting species of alanyl-, arginyl-, asparaginyl-, glycyl-, leucyl-, lysyl-, m ... | 1974 | 4808904 |
| lipophosphonoglycan of the plasma membrance of acanthamoeba castellanii. isolation from whole amoebae and identification of the water-soluble products of acid hydrolysis. | | 1974 | 4831216 |
| lipophosphonoglycan of the plasma membrane of acanthamoeba castellanii. fatty acid composition. | | 1974 | 4831217 |
| a chemical and autoradiographic study of cellulose synthesis during the encystment of acanthamoeba castellanii. | | 1974 | 4839043 |
| bacteriolytic spectrum of the enzyme produced by acanthamoeba castellanii. | | 1969 | 4905249 |
| acanthamoeba castellanii: specificity of immobilization test. | | 1969 | 4925968 |
| pinocytosis in acanthamoeba castellanii. kinetics and morphology. | the uptake of radioactively labeled albumin, inulin, leucine, and glucose by acanthamoeba castellanii (neff strain) was measured. the uptake is linear with time and appears to be continuous under the conditions of these experiments. uptake is abolished at 0 degrees c. no evidence for saturation of the uptake mechanism was obtained with either albumin or leucine. each of the four tracer molecules enters the ameba at a similar rate when the uptake is calculated as volume of fluid ingested per unit ... | 1972 | 5028259 |
| discontinuity of 26 s rrna in acanthamoeba castellani. | | 1972 | 5038450 |
| a scanning electron microscopic study of the excystment process of acanthamoeba castellanii. | | 1972 | 5054339 |
| [diffusion of anti-acanthamoeba castellani antibodies in subjects from different italian districts]. | | 1971 | 5152943 |
| bacteriolytic enzyme produced by acanthamoeba castellanii. | | 1969 | 5369723 |
| a scanning electron microscopic study of the encystment of acanthamoeba castellanii. | | 1970 | 5424320 |
| photoinhibition of growth in acanthamoeba castellanii cultures. | light from 350 to 680 nm at intensities up to 1.62 x 10(5) ergs per sec per cm(2) slowed exponential growth and lowered the maximum yield in axenic cultures of acanthamoeba castellanii. photoinhibition was a linear function of light intensity up to 1.25 x 10(5) ergs per sec per cm(2). at higher intensities, growth was too slow to be measured accurately. a photochemical change occurring in the growth medium on irradiation was a function of light dosage and not intensity per se. light in dosages w ... | 1970 | 5474886 |
| axenic cultivation of large populations of acanthamoeba castellanii (jbm). | | 1970 | 5504530 |
| the fine structure of acanthamoeba castellanii. i. the trophozoite. | the fine structure of the trophozoite of acanthamoeba castellanii (neff strain) has been studied. locomotor pseudopods, spikelike "acanthopodia," and microprojections from the cell surface are all formed by hyaline cytoplasm, which excludes formed elements of the cell and contains a fine fibrillar material. golgi complex, smooth and rough forms of endoplasmic reticulum, digestive vacuoles, mitochondria, and the water-expulsion vesicle (contractile vacuole) are described. a canicular system openi ... | 1968 | 5678452 |
| the fine structure of acanthamoeba castellanii (neff strain). ii. encystment. | encysting cells of acanthamoeba castellanii, neff strain, have been examined with the electron microscope. the wall structure and cytoplasmic changes during encystment are described. the cyst wall is composed of two major layers: a laminar, fibrous exocyst with a variable amount of matrix material, and an endocyst of fine fibrils in a granular matrix. the two layers are normally separated by a space except where they form opercula in the center of ostioles (exits for excysting amebae). an additi ... | 1969 | 5768875 |
| effect of lytic enzymes of acanthamoeba castellanii on bacterial cell walls. | extracts of acanthamoeba castellanii (neff) contain alpha- and beta-glucosidase, beta-galactosidase, beta-n-acetylglucosaminidase, amylase, and peptidase. all of these activities are optimal between ph 3 and 4. these extracts also were found to clarify suspensions of cell walls from nine different gram-positive bacteria, including micrococcus lysodeikticus. the ph optimum for the lytic activity was between 3 and 4. the extent of lysis of the various cell walls did not correlate with the release ... | 1969 | 5781574 |
| the cell wall of the obligate intracellular bacterial parasite of small free-living amoebae. i. morphology and chemical composition of the rigid layer and peptidoglycan. | the obligate intracellular bacterial parasite "oibp" of small free-living amoebae, discovered by drozański (1956) was propagated in axenic culture of acanthamoeba castellanii. the peptidoglycan prepared by chemical extraction of intact cells of the bacterium was examined in a transmission electron microscope and analysed chemically. electron micrographs of heavy metal shadowed preparations revealed a bag-shaped membraneous structure resembling that of the peptidoglycan sacculi of escherichia col ... | 1984 | 6083704 |
| faithful initiation of ribosomal rna transcription from cloned dna by purified rna polymerase i. | a faithful transcription system for ribosomal rna genes has been developed by using components from the small free-living amoeba acanthamoeba castellanii. the system utilizes protein-free recombinant dna as a template and in addition requires a crude cell-free extract containing rna polymerase i and a transcription initiation factor (tif-i). the transcript is initiated at the same position as the in vivo precursor ribosomal rna: templates truncated at various sites downstream of the transcriptio ... | 1984 | 6091740 |
| in vitro evidence that eukaryotic ribosomal rna transcription is regulated by modification of rna polymerase i. | we have utilized a cell-free transcription system from acanthamoeba castellanii to test the functional activity of rna polymerase i and transcription initiation factor i (tif-i) during developmental down regulation of rrna transcription. the results strongly suggest that rrna transcription is regulated by modification, probably covalent, of rna polymerase i: (1) the level of activity of tif-i in extracts from transcriptionally active and inactive cells is constant. (2) the number of rna polymera ... | 1984 | 6095193 |
| the mitochondrial adenosine triphosphatase of acanthamoeba castellanii. partial characterization and changes in activity during exponential growth. | 1. the mitochondrial adenosine triphosphatase (atpase) of acanthamoeba castellanii is mg2+-requiring (optimum cation: atp ratio of 1.5) and has two ph optima of activity (at ph 6.6 and 8.1). 2. atpase activity of submitochondrial particles is effectively inhibited by twelve different inhibitors of energy conservation suggesting similarities in inhibitor-binding sites to other previously characterized complexes. 3. gel filtration by passage through sephadex g-50 increases atpase activity of submi ... | 1982 | 6121661 |
| myosins from acanthamoeba castellanii. | | 1982 | 6126796 |
| the interaction of f-actin with phosphorylated and unphosphorylated myosins ia and ib from acanthamoeba castellanii. | myosins ia and ib from acanthamoeba castellanii are single-headed molecules which, upon phosphorylation of their heavy chains by a specific kinase, express actin-activated mg2+-atpase activity. these myosins show no tendency to self-associate under assay conditions, a property which allows unambiguous kinetic and actin-binding data to be obtained. both myosin isoenzymes exhibit a complex dependence of actomyosin atpase activity on f-actin concentration. a conventional hyperbolic dependence is ob ... | 1983 | 6136503 |
| amino acid sequence of a segment of the acanthamoeba myosin ii heavy chain containing all three regulatory phosphorylation sites. | the actin-activated mg2+-atpase activity of myosin ii from the soil amoeba acanthamoeba castellanii is regulated by phosphorylation of 3 serine residues on the myosin ii heavy chain. partial chymotryptic digestion of 32p-labeled myosin ii cleaves from the tail end of the myosin ii heavy chain a small peptide which contains all three phosphorylation sites. during purification the phosphorylated peptide is resolved into several different species as a result of heterogeneity both in phosphate conte ... | 1984 | 6149217 |
| control of actin synthesis during the development of acanthamoeba castellanii. | | 1981 | 6164583 |
| application of flow cytometry to studies of pathogenic free-living amoebae. | species of small, free-living amoebae of the genera naegleria and acanthamoeba can cause fatal amoebic meningoencephalitis. previous investigations have shown that pathogenic amoebae are associated with thermally altered water. flow cytometric techniques for identifying species of pathogenic and nonpathogenic amoebae from such water have been developed, using immunofluorescence and fluorescein-bound concanavalin a. flow cytometry is accomplished with a cytofluorograph, in which cells are dispers ... | 1982 | 6186196 |
| growth phase dependent alterations in the surface coat of acanthamoeba castellanii. | application of ruthenium red, cationized ferritin and concanavalin a to exponentially growing trophozoites reveals on their plasma membrane negatively charged surface coat bearing sugar residues. in the coat of trophozoites from advanced stationary growth phase no sugar residues can be visualized. in mature cysts the external layer of their wall is negatively charged, however, on their protoplast surface no terminals reacting with the 2 polycations, or with concanavalin a can be revealed, even t ... | 1982 | 6189354 |
| purification of a high molecular weight actin filament gelation protein from acanthamoeba that shares antigenic determinants with vertebrate spectrins. | i have purified a high molecular weight actin filament gelation protein (gp-260) from acanthamoeba castellanii, and found by immunological cross-reactivity that it is related to vertebrate spectrins, but not to two other high molecular weight actin-binding proteins, filamin or the microtubule-associated protein, map-2. gp-260 was purified by chromatography on deae-cellulose, selective precipitation with actin and myosin-ii, chromatography on hydroxylapatite in 0.6 m kl, and selective precipitati ... | 1984 | 6209283 |
| the mitochondrial adenosine triphosphatase of acanthamoeba castellanii. oscillatory accumulation of enzyme activity, enzyme protein and f1-inhibitor during the cell cycle. | 1. the mitochondrial atpase of acanthamoeba castellanii accumulated discontinuously in synchronous cultures prepared by a minimally perturbing size-selection technique. 2. enzyme activity per ml of culture doubled overall during one cell cycle time of 8 h, but oscillated to give seven maxima during this period. similar oscillations were observed in the specific activities of atpase and of the naturally occurring inhibitor protein. 3. these variations in enzyme activity reflected changes in amoun ... | 1982 | 6212051 |
| atpase-associated oligomycin resistance in acanthamoeba castellanii. | the multiplication rate of "wild-type" (wt) populations of acanthamoeba castellanii was inhibited 50% by approximately 3 microgram oligomycin/ml; olir2, an oligomycin resistant cell line, required approximately 27 microgram/ml for the same inhibition. atpase solubilized from olir2 mitochondrial fractions required 3--10-fold higher concentrations of oligomycin than did identical wt fractions to achieve 50% inhibition of activity. resistance was correlated with altered mitochondrial atpase sensiti ... | 1982 | 6215480 |
| interdependence of factors affecting the actin-activated atpase activity of myosin ii from acanthamoeba castellanii. | acanthamoeba myosin ii can be phosphorylated at three serine residues near the c terminus of each heavy chain. deophosphorylated myosin ii has the highest actin-activated atpase activity. in this paper, we report the interdependent effects of phosphorylation, mg2+, ca2+, temperature, ph, and kcl on the acti-activated atpase activity. with increasing level of phosphorylation, the actin-activated atpase activity decreases and the optimal concentration of mg2+ increases. lowering the temperature of ... | 1984 | 6235224 |
| effects of limited tryptic cleavage on the physical and enzymatic properties of myosin ii from acanthamoeba castellanii. | limited digestion of acanthamoeba myosin ii by trypsin selectively cleaved the 185,000-da heavy chains into a 73,000-da peptide containing the catalytic and actin-binding sites and a 112,000-da peptide containing the regulatory phosphorylatable sites. the light chains were unaffected. the proteolytic products remained associated and formed bipolar filaments that were very similar in appearance to filaments of native myosin by negative staining electron microscopy. filaments of trypsin-cleaved, d ... | 1984 | 6235225 |
| spin label studies of microsomal membranes from acanthamoeba castellanii in different states of differentiation. | | 1980 | 6244789 |
| [role of a free-living amoeba from water, acanthamoaba castellani, in the transport of naked or enveloped animal viruses]. | the trophozoïts of acanthamoeba castellanii are unable to adsorb poliovirus or vesicular stomatitis virus. after encystment in medium containing respectively 5.4 x 10(8) and 3 x 10(9) p.f.u./ml cysts did not contain viruses. these data do not agree with a current hypothesis by which water's free amoeba could carry animal viruses. | 1980 | 6257415 |
| the mitochondrial genomes of ustilago cynodontis and acanthamoeba castellanii. | mitochondrial dna from ustilago cynodontis has been investigated in several of its properties. its dg + dc content is equal to 33.5%; its buoyant density (1.698 g/cm3) is higher, by 5 mg/cm3, and its melting temperature (82.5 degrees c) is lower than expected for a bacterial dna having the same base composition; the first derivative of its melting curve indicates a large compositional heterogeneity, its molarity of elution from hydroxyapatite is high, 0.28 m phosphate, and allows its partial sep ... | 1981 | 6263620 |
| survival of polioviruses and echoviruses in acanthamoeba castellanii cultivated in vitro. | cultures of acanthamoeba castellanii, kept at room temperature in sterile bacto-casitone (difco) medium, were artificially infected with vaccination poliovirus strains type 1 and type 3 and with echovirus type 4 and echovirus type 30. no remarkable virus cumulation was observed on the surface or inside amoeba cells during the observation period of 21 days. amoeba-adsorbed viruses were impossible to remove by repeated washings. virus neutralization with specific antisera showed that enteroviruses ... | 1981 | 6265550 |
| ribosomal ribonucleic acid repeat unit of acanthamoeba castellanii: cloning and restriction endonuclease map. | the repeat unit coding for the precursor to 18s, 5.8s, and 26s ribosomal ribonucleic acids (rrnas) has been cloned from the free-living soil amoeba acanthamoeba castellanii. the cloned deoxyribonucleic acid (dna) was mapped with 11 restriction endonucleases and by r-loop mapping. the entire repeat unit is 12 kbp (kilobase pairs) in length and contains sites for ecori, smai, bglii, ssti, bam-hi, psti, kpni, hindiii, and xbai but not for xhoi or sali. all of the repeat units in the nuclear dna app ... | 1981 | 6268147 |
| the effects of cyanide, azide, carbon monoxide and salicylhydroxamic acid on whole-cell respiration of acanthamoeba castellanii. | | 1982 | 6283014 |
| actin genes and actin messenger rna in acanthamoeba castellanii. nucleotide sequence of the split actin gene i. | | 1982 | 6290670 |
| homology between actin coding and its adjacent sequences in widely divergent species. | eco ri restriction endonuclease dna fragments from several representatives of the kingdoms protista and animalia were electrophoretically separated and transferred to the nitrocellulose filters. these dna's were hybridized with [32p]-labelled actin coding sequence from drosophila melanogaster (dm). the results indicate that the nucleic acid sequences of the genes coding for actin(s) has been highly conserved throughout evolution. similar experiments were performed using the sequence derived from ... | 1983 | 6299292 |
| phosphorylation of microtubule-associated proteins regulates their interaction with actin filaments. | we have determined the absolute phosphate content of microtubule-associated proteins (maps) and established that phosphorylation inhibits the actin filament cross-linking activity of maps and both of the major map components, map-2 and tau. similar results were obtained with actin from rabbit muscle, hog brain, and acanthamoeba castellanii. we used the endogenous phosphatases and kinases in hog brain microtubule protein to modulate map phosphate level before isolating heat-stable maps. maps isol ... | 1983 | 6304075 |
| photochemical action spectra indicate that cytochrome a/a3 is the predominant haemoprotein terminal oxidase in acanthamoeba castellanii. | 1. room-temperature co-reduced minus reduced difference spectra of intact cells of acanthamoeba castellanii show the presence of co-reacting haemoproteins in cells from the early-exponential, late-exponential and stationary phases of growth. 2. the relative rates of reaction with co of the two haemoproteins differ; that of cytochrome a/a3 with co is complete within 1 min of bubbling with co, whereas that of cytochrome b takes longer than 90 min. 3. photochemical action spectra reveal cytochrome ... | 1983 | 6307270 |
| purification and characterization of a myosin i heavy chain kinase from acanthamoeba castellanii. | in previous work from this laboratory, a partially purified protein kinase from the soil amoeba acanthamoeba castellanii was shown to phosphorylate the heavy chain of the two single-headed acanthamoeba myosin isoenzymes, myosin ia and ib, resulting in a 10- to 20-fold increase in their actin-activated mg2+-atpase activities (maruta, h., and korn, e.d. (1977) j. biol. chem. 252, 8329-8332). a myosin i heavy chain kinase has now been purified to near homogeneity from acanthamoeba by chromatography ... | 1983 | 6309772 |
| purification of a protein phosphatase from acanthamoeba that dephosphorylates and activates myosin ii. | the actin-activated atpase activity of myosin ii from acanthamoeba castellanii is inhibited by phosphorylation of 3 serine residues near the carboxyl end of the heavy chain of the molecule. we have purified a protein phosphatase from acanthamoeba using myosin ii as a substrate. this phosphatase has a molecular weight of 39,000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and an isoelectric point in urea of 5.2. the enzyme also is active against other phosphoserine protein substra ... | 1983 | 6315729 |
| regulation of ribosomal rna transcription during differentiation of acanthamoeba castellanii: a review. | during the cellular differentiation induced by starvation of acanthamoeba castellanii, the expression of a number of genes is regulated. evidence is reviewed that at least one of these, the precursor ribosomal rna transcription unit, is regulated at the level of transcription. the structure of the rrna transcription unit and of the rna polymerases responsible for transcription in acanthamoeba are reviewed. utilizing an in vitro transcription system constructed from these components, preliminary ... | 1983 | 6355452 |
| acanthamoeba keratitis possibly acquired from a hot tub. | an irritated left eye followed by a geographic epithelial corneal defect developed in a 42-year-old man. disciform edema developed in the cornea, and the lesion progressed to a ring-shaped abscess. the lesion failed to respond to medical therapy. after two penetrating keratoplasties, histopathologic examination and electron microscopic studies established the diagnosis of acanthamoeba keratitis. subsequent cultures and immunofluorescent studies identified the organism as acanthamoeba castellani. ... | 1984 | 6372764 |
| intracellular growth of legionella pneumophila within acanthamoeba castellanii neff. | acanthamoeba castellanii neff supports the intracellular growth of legionella pneumophila. when acanthamoebae were exposed to l. pneumophila for 1 h and then washed free of unassociated bacteria and placed in liquid culture, levels of viable amoeba-associated legionellae and legionellae free in the culture medium increased by three to four orders of magnitude in 48 to 72 h. however, most of the legionellae remained amoeba-associated and could be cultured only after disruption of the amoebae. fur ... | 1984 | 6376354 |
| amoeboid locomotion of acanthamoeba castellanii with special reference to cell-substratum interactions. | the amoeboid locomotion of acanthamoeba castellanii has been studied by observation of individual cells moving on a planar glass substratum. cell-substratum interactions involved in traction have been observed by reflexion interference microscopy. a variable part of the ventral surface of a. castellanii formed a protean platform, the 'associated contact', from which filopodia were subtended; these established stable, focal adhesions (approximately 0.4 micron diameter) on the substratum beneath. ... | 1984 | 6389765 |
| amino acid sequence of acanthamoeba actin. | by amino acid sequence studies, only one form of cytoplasmic actin was detected in acanthamoeba castellanii. its amino acid sequence is very similar to the sequences of dictyostelium and physarum actins, from which acanthamoeba actin differs in only nine and seven residues, respectively, including the deletion of the first residue. acanthamoeba actin is unique in containing a blocked nh2-terminal neutral amino acid (glycine), while all other actins sequenced thus far have a blocked acidic amino ... | 1984 | 6420574 |
| acanthamoeba castellanii capping protein: properties, mechanism of action, immunologic cross-reactivity, and localization. | we report further characterization of the physical and immunologic properties, mechanism of action, and intracellular localization of acanthamoeba castellanii capping protein, an actin regulatory protein discovered by isenberg (isenberg, g., u. aebi, and t. d. pollard, 1980, nature (lond.) 288:455-459). the native molecular weight calculated from measurements of stokes' radius (3.8 nm by gel filtration chromatography) and sedimentation coefficient (4.8 s by sucrose gradient velocity sedimentatio ... | 1984 | 6429155 |
| effects of inhibitors on mitochondrial adenosine triphosphatase of crithidia fasciculata: an unusual pattern of specificities. | the mitochondrial adenosine triphosphatase of the kinetoplastid protozoon, crithidia fasciculata, is inhibited by oligomycin, venturicidin, triethyltin sulphate, n,n'-dicyclohexylcarbodiimide, leucinostatin, dio-9 and quercetin, but not spegazzinine or by compounds which interact with the beta-subunit of mitochondrial f1-atpase (efrapeptin, aurovertin, citreoviridin or 4-chloro-7-nitrobenzofurazan). these results suggest that the f1 portion of the crithidial enzyme has an unusual type of beta-su ... | 1981 | 6454844 |
| correlation between potassium and phosphorus content and their nonuniform distribution in acanthamoeba castellanii. | biologically important elements: k, na, mg, ca, cl, p, and s were analyzed in acanthamoeba castellanii. a higher potassium content, as compared with other cations, was detected. total content of the cation-forming elements: k, na, mg, and ca was ca. 360 mmoles/kg dry weight of the cells. phosphorus content was estimated as 492 mmoles/kg dry weight. content of chlorine, a basic cellular anion, was 173 mmoles/kg dry weight. the low level of chlorine appears not the be sufficient to balance all the ... | 1984 | 6490406 |
| preparation of an immunotoxin for acanthamoeba castellanii. | acanthamoeba castellanii (neff) is a small free-living amoeba which is closely related to pathogenic organisms that produce almost invariably fatal human infections (1). the f(ab)' fragment of a monoclonal antibody (designated a9) specifically reactive to the a. castellanii cell surface, was covalently linked to the a chain of diphtheria toxin. this immunotoxin inhibited cell division completely, whereas nonspecific mouse igg or nonspecific f(ab)' derivatized with diphtheria toxin a chain (dta), ... | 1984 | 6508797 |
| toxicity of ricin, diphtheria toxin and alpha-amanitin for acanthamoeba castellanii (1983). | selective cytotoxic agents, highly specific antibody coupled to potent toxin molecules, could, theoretically, be useful in the treatment of protozoan infections. to examine this possibility we began to synthesize immunotoxins for a model protozoan system, acanthamoeba castellanii. we report here the selection of a suitable toxic moiety for this system. alpha-amanitin was toxic for the amoeba, effecting a 50% decrease in in vivo protein synthesis at approximately 20 microm. however, the chemical ... | 1984 | 6527187 |
| isolation of a minor species of actin from the nuclei of acanthamoeba castellanii. | actin was extracted from isolated nuclei of acanthamoeba castellanii and purified to homogeneity under nondenaturing conditions by diethylaminoethylcellulose and sephadex g-100 chromatography. the pure protein has the same molecular weight as cytoplasmic acanthamoeba actin and a very similar amino acid composition. isoelectrofocusing shows that nuclear actin is slightly more acidic than the major cytoplasmic species, and comparative analysis of peptides from tryptic and cyanogen bromide digests ... | 1984 | 6529582 |
| plasma membrane biogenesis in eukaryotic cells: translocation of newly synthesized lipid. | we examined the transfer of sterols and phospholipids from their site of synthesis to the plasma membrane of acanthamoeba castellanii. cells were labeled with [3h]acetate, and plasma membrane fractions were isolated under conditions that minimize the nonspecific exchange of lipids between subcellular membrane fractions. sterols and phospholipids were purified from both whole-cell homogenates and isolated plasma membrane. in whole cells, 3h-labeled lipids were formed, with no apparent time lag, i ... | 1984 | 6584886 |
| oxygen affinity of the respiratory chain of acanthamoeba castellanii. | apparent km values for o2 for the soil amoeba acanthamoeba castellanii determined polarographically and by bioluminescence gave similar values (0.37 and 0.41 microm respectively). mitochondria oxidizing succinate or nadh in the presence or absence of adp gave values in the range 0.21-0.36 microm-o2. oxidation of respiratory-chain components to 50% of the aerobic steady states in intact cells was observed at the following o2 concentrations: cytochrome aa3, 0.1-0.25 microm; cytochrome c, 0.3-0.6 m ... | 1983 | 6615472 |
| a survey of pathogenic and free-living amoebae inhabiting swimming pool water in mexico city. | a survey of pathogenic and free-living amoebae in swimming pool waters of mexico city was performed. among the organisms isolated those which have public health importance were naegleria fowleri carter and acanthamoeba castellanii douglas. amoebae of the genera acanthamoeba, naegleria, and vahlkampfia were recovered in their cystic stage while those specimens of the genera amoeba, entamoeba, thecamoeba, and vanella were recovered only in their trophic stage during this study. amoebae were concen ... | 1983 | 6617613 |
| isolation of two strains of acanthamoeba castellanii from human tissue and their pathogenicity and isoenzyme profiles. | two strains of amoebae, one (cdc:0180:1) from the lung tissue of a patient who died of granulomatous amoebic encephalitis and the other (cdc:0179:1) from the debrided tissue of a mandibular autograft, were isolated and identified as acanthamoeba castellanii based on the morphological and immunofluorescent staining characteristics of the trophozoites and cysts. both strains of amoebae caused cytopathic effects in mammalian cell cultures and destroyed the cell sheet. however, only the cdc:0180:1 s ... | 1983 | 6655045 |
| concanavalin a-mediated agglutination and distribution of concanavalin a-binding sites in acanthamoeba following treatment with colchicine and cytochalasin b. | incubation of acanthamoeba castellanii (neff strain) with fitc-cona (15 micrograms/ml) resulted in the appearance of patches of fluorescence on the amoebae within 2 min of incubation. these patches disappeared following treatment of the amoebae with alpha-meman. pretreatment of the amoebae with colchicine or cytochalasin b or with colchicine and cytochalasin b in combination did not significantly alter the distribution pattern of fluorescence in the amoebae. 2,4-dinitrophenol and incubation at 4 ... | 1983 | 6682041 |
| polyamines in acanthamoeba castellanii: presence of an unusually high, osmotically sensitive pool of 1,3-diaminopropane. | high (15-25 mm) concentrations of 1,3-diaminopropane, a normally minor derivative of polyamine metabolism, have been observed in vegetative cells of acanthamoeba castellanii. trace amounts of a putative polyamine, which chromatographically behaved like norspermidine, were also found. the size of the intracellular pool of 1,3-diaminopropane was inversely related to the ambient osmolality and to the free amino acid levels during osmotic shock experiments. due to its high concentration in a. castel ... | 1984 | 6743339 |
| changes in transfer ribonucleic acid population of acanthamoeba castellanii during growth and encystment. | fifteen aminoacyl-transfer ribonucleic acids (trna's) from vegetative cells (trophozoites) and mature cysts of acanthamoeba castellanii were compared by reversed-phase 5 chromatography. little or no differences were detected in reversed-phase 5 chromatography elution profiles of alanyl-, arginyl-, isoleucyl-, phenylalanyl-, prolyl-, seryl-, threonyl-, tryptophanyl- and valyl-trna's. significant differences in the relative proportions of isoaccepting species of leucyl-, lysyl-, methionyl-, aspart ... | 1980 | 6767704 |
| effect of a membrane-stabilizing compound on calcium binding to the plasma membrane of acanthamoeba castellanii. | binding of calcium ions at the plasma membrane was studied in acanthamoeba cells pretreated with zimet 3164, a benzimidazole nitrogen mustard derivative, which is known to show a potent immunosuppressive action combined with a membrane-stabilizing effect in mice. for reference, 2 compounds were applied: zimet 3393 (cytostasan¿), another benzimidazole mustard derivative, which exerts only a moderate membrane effect and acts as a strong cytostatic, and zimet 176/68, a barbituric acid derivative, w ... | 1980 | 6774578 |
| oxygen affinities of the hydrogenosome-containing protozoa tritrichomonas foetus and dasytricha ruminantium, and two aerobic protozoa, determined by bacterial bioluminescence. | oxygen-dependent bioluminescence of photobacterium (vibrio) fischeri was used to measure oxygen affinities of four protozoa. the aerobic organisms acanthamoeba castellanii and tetrahymena pyriformis showed apparent km values for o2 of 0.42 and 2.43 microm respectively. the aerotolerant anaerobe tritrichomonas foetus, and the more strictly anaerobic rumen ciliate dasytricha ruminantium, both of which have hydrogenosomes, respired with apparent km values of 1.08 and 1.70 microm-o2. we conclude tha ... | 1982 | 6809887 |
| restriction of glycolipids to the outer half of a plasma membrane: concanavalin a labeling of membrane halves in acanthamoeba castellanii. | fracture-label, a method that permits the cytochemical characterization of faces produced by freeze-fracture, was used to determine the partition and distribution of a glycolipid on membrane fracture faces of acanthamoeba castellanii cells. after treatment with concanavalin a (con a), the glycolipid (a lipophosphonoglycan, lpg) was labeled with colloidal gold coated with horseradish peroxidase. the label was abundant over exoplasmic fracture faces (face e) of plasma membranes, but absent from pr ... | 1983 | 6872002 |
| temperature-compensated oscillations in respiration and cellular protein content in synchronous cultures of acanthamoeba castellanii. | synchronous cultures of the soil amoeba acanthamoeba castellanii, established by a selection procedure, show significant oscillations of respiration and total cell protein. there was little difference between the period of these oscillations, which averaged 76 min, although the five incubation temperatures used varied between 20 degrees c and 30 degrees c and the cell division time increased from 7.8 to 16 hr. the phase of these oscillations also corresponded approximately at all incubation temp ... | 1982 | 6954521 |
| a case of keratitis due to acanthamoeba in new york, new york, and features of 10 cases. | a man in new york, new york, contracted keratitis caused by acanthamoeba castellanii. the diagnosis was delayed because amoebae were not initially suspected as the infectious organism. the culture isolate and the amoebae in corneal sections were identified as a. castellanii by immunofluorescence using antiserum to plasma membranes of this species. with the rapid agar disk diffusion method, the amoebae were shown to e susceptible to pimaricin (0.5%) and resistant to greater than 1,000-micrograms/ ... | 1981 | 6972421 |
| evidence for differential intracellular localization of the acanthamoeba myosin isoenzymes. | the three myosin isoenzymes of acanthamoeba castellanii coexist within a single cell and the native molecules probably have the same unusual polypeptides composition as the isolated enzymes. the two myosin i isoenzymes seem to be preferentially localized near the plasma membrane while myosin ii seems to be much less concentrated near the plasma membrane than elsewhere in the cytoplasm. | 1980 | 6995856 |
| homologies among ribosomal rna and messenger rna genes in chloroplasts, mitochondria and e. coli. | labelled chloroplast rrnas from spinacia oleracea were hybridized to restriction endonuclease digests of chloroplast dna from oenothera hookeri and euglena gracilis, to mitochondrial dna of acanthamoeba castellanii, and to dna of the e. coli rrn b operon in the transducing phage lambda rifd 18. the degree of homology is greatest for the 16s rrna gene. greater than 90% occurs between the two higher plant genes, 80% homology to the lower plant gene, 60%-70% homology to the bacterial gene, and 20% ... | 1980 | 7003301 |
| osteomyelitis of a bone graft of the mandible with acanthamoeba castellanii infection. | an ameloblastoma of the right side of the mandible was resected in a 32 year old prediabetic female. an iliac crest autograft became infected and a sequestrum was removed seven weeks later. pathologic examination of this tissue demonstrated a mixed infection, including acanthamoeba castellanii. this is the first recorded instance of invasion of bone by a free living ameba. | 1981 | 7024096 |
| nucleotide sequence of an exceptionally long 5.8s ribosomal rna from crithidia fasciculata. | in crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small rna species (e, f, g, i, j) in addition to 5s rrna [gray, m.w. (1981) mol. cell. biol. 1, 347-357]. the complete primary sequence of species i is shown here to be paacgugumcgcgauggaugacuuggcuuccuaucucguuga ... agamacgcaguaaagugcgauaagugguapsicaauugmcagaaucauucaauuaccgaaucuuugaacgaaacgg ... cgcaugggagaagcucuuuugagucauccccgugcaugccauauucuccamgugucgaa(c)oh. this sequence establishes that species i ... | 1982 | 7079176 |
| acanthamoebiasis and immunosuppression. case report. | immunosuppression and debilitating illnesses are occasionally associated with multifocal brain lesions of acanthamoebiasis, an encephalitis distinct from the acute, water-sport related meningoencephalitis caused by naegleria fowler. a 38-year-old man with a renal transplant two and one-half years before his final illness developed pneumonia due to legionella micdadei. candida albicans was isolated from sputum and cytomegalovirus was found in lung and liver biopsies. he had continuous corticoster ... | 1982 | 7108568 |
| [isolation of free-living amoebae from nasal mucosa of healthy individuals]. | in 13 out of 140 recruits examined (9.3%) one or several species of acanthamoeba were identified in smears of the nasal mucosa. from among 20 isolated strains of amoebae the following species were determined: acanthamoeba castellanii (42.2%), a. polyphaga (31.5%), a. palestinensis (26.3%), a. astronyxis (5.3%). the persons contaminated with amoebae were in good health at the time of sampling. it is assumed that an aerogenic contamination of the carriers took place. | 1982 | 7124165 |
| coordinate regulation of synthesis of ribosomal proteins during encystation of acanthamoeba castellanii. | the synthesis of ribosomal proteins has been examined during growth and encystment of acanthamoeba castellanii. cells have been radiolabelled with [35s]methionine and ribosomal proteins have been extracted either from ribosomes or from total cell extracts. the results show that there is less synthesis of ribosomal proteins relative to total cell proteins soon after transfer of growing cells into non-nutrient medium, suggesting that the synthesis of all ribosomal proteins is under coordinate cont ... | 1982 | 7128590 |
| fulminant amebic meningoencephalitis due to acanthamoeba. | a 57-year-old chronically immunosuppressed woman with systemic lupus erythematosus developed fulminant meningoencephalitis due to acanthamoeba castellanii. amebic trophozoites were also found in the lungs, suggesting a primary pulmonary focus of infection. this case illustrates that acanthamoeba can cause a fulminant, rapidly fatal meningoencephalitis, as well as the previously reported chronic granulomatous meningoencephalitis. ... | 1981 | 7193300 |
| acanthamoeba castellanii: methods and perspectives for study of cytoskeleton proteins. | | 1982 | 7202108 |
| heterogenous distribution of potassium and phosphorus in acanthamoeba castellanii. | using x-ray microanalysis technique the distribution of potassium, phosphorus and sulphur was analysed in acanthamoeba castellanii cells. distribution of potassium was nonuniform; the high level of the element was observed in the cortex region of these cells. distribution of phosphorus was shown to be similar to that of potassium, whereas sulphur was rather uniformly distributed. | 1981 | 7214549 |
| developmental changes in the localization of calcium binding sites in acanthamoeba castellanii. | vegetative cells of acanthamoeba castellanii have the ability to bind calcium on the plasma membrane in form of the electron-dense deposits. the appearance of the deposits depends on the age of acanthamoeba culture. in 24-h-old culture the deposits are very small, with diameter of 26 nm. during aging of culture, at both logarithmic and stationary growth phases, the diameter of deposits is larger (70-80 nm), while the deposits are localized only on the plasma membrane. during differentiation of a ... | 1981 | 7228741 |
| oscillations of redox states in synchronously dividing cultures of acanthamoeba castellanii and schizosaccharomyces pombe. | the redox state of the mitochondria of acanthamoeba castellanii and schizosaccharomyces pombe was assessed with a flying-spot fluorometer (chance et al. 1978. am. j. physiol. 235:h 809) that provides excitation appropriate for oxidized flavoprotein or reduced pyridine nucleotide. fluorescence signals could be resolved from the thin films of cultures that were only one cell deep. in both organisms anoxia was associated with an increased pyridine nucleotide and decreased flavoprotein fluorescence. ... | 1980 | 7260241 |