Publications

TitleAbstractYear
Filter
PMID(sorted ascending)
Filter
the tween opacity test as an aid in classification of mycobacteria.the tween opacity test can be used to differentiate (1) mycobacterium flavescens from mycobacterium gordonae and mycobacterium szulgai, and (2) nonphotochromogenic strains of mycobacterium kansaii from strains of the mycobacterium terrae complex.1977335938
a cluster of mycobacterium gordonae isolates from bronchoscopy specimens.during a 2.5-year period, 52 patients at yale-new haven hospital had mycobacterium gordonae recovered from specimens obtained by suction at bronchoscopy; 2 of them also had smears positive for acid-fast bacilli. almost all of the isolates came from patients bronchoscoped by the same physician, one of 4 who performed the procedure during that period. only this physician added one drop of green dye, stored in a 100-ml bottle, to the cocaine used for topical anesthesia during the procedure; culture ...1979464382
granulomatous synovitis: the role of atypical mycobacteria.clinical data on 25 patients with granulomatous synovitis and bursitis observed from 1970 through 1977 are reviewed. the lesions occurred about the extremities, the wrists and hands being involved most often. with three exceptions, the patients had no significant underlying disease. the lesions were chronic and often followed minor trauma. many patients had had prior surgery, steriod injections, or both. at the time of surgery for the synovitis, the gross appearance proved to be relatively chara ...1979542760
mycobacterium gordonae infection of a prosthetic aortic valve.a patient prviously suspected of having a mycobacterial infection was found to have a mycobacterium gordonae infection of his prosthetic aortic valve. following replacement of his infected prosthesis and systemic therapy for two years, the patient has apparently been cured.1978633563
simple procedure for detection of mycobacterium gordonae in water causing false-positive acid-fast smears.a simple procedure for detecting a few cells of mycobacterium gordonae in laboratory water that yielded spurious smear results is described.1976767363
hydrogenase and ribulose diphosphate carboxylase during autotrophic, heterotrophic, and mixotrophic growth of scotochromogenic mycobacteria.two key autotrophic enzyme systems, hydrogenase and ribulose diphosphate carboxylase, were examined in mycobacterium gordonae and two other chemolithotrophic, scotochromogenic mycobacteria under different cultural conditions. in all three organisms both enzymes were inducible and were produced in significant levels only in the presence of the specific substrate, hydrogen or carbon dioxide. m. gordonae exhibited increased growth rates and yields, indicating mixotrophic growth, in the presence of ...1976956116
water as a source of potentially pathogenic mycobacteria.the mycobacterial flora of 321 water samples was explored to evaluate the role of this part of the environment as a possible source of human mycobacterial disease. the samples included natural waters, waters treated to make them suitable for drinking, and waters in contact with animals. water from the city aquarium contained the greatest abundance of mycobacteria, with an average of 3.5 strains per sample. the highest yield of positive cultures came from samples in contact with zoo animals and w ...19761259237
characterization of a major polymorphic tandem repeat in mycobacterium tuberculosis and its potential use in the epidemiology of mycobacterium kansasii and mycobacterium gordonae.in this study, the occurrence of repeated dna sequences in the chromosome of mycobacterium tuberculosis was investigated systematically. by screening a m. tuberculosis lambda gt-11 gene library with labeled total chromosomal dna, five strongly hybridizing recombinants were selected, and these contained dna sequences that were present in multiple copies in the chromosome of m. tuberculosis. these recombinants all contained repeated sequences belonging to a single family of repetitive dna, which s ...19921350781
microheterogeneity within rrna of mycobacterium gordonae. 19921374075
identification of mycobacterium avium complex strains and some similar species by high-performance liquid chromatography.strains of mycobacterium avium, mycobacterium intracellulare, mycobacterium scrofulaceum, mycobacterium xenopi, and mycobacterium gordonae were identified by high-performance liquid chromatography (hplc) analysis of mycolic acids as bromophenacyl esters. hplc criteria were used to develop a flow chart identification scheme, which was evaluated in our laboratory with a set of 234 strains representing five species and a hitherto undescribed species. correct identifications of m. gordonae and m. xe ...19921400970
high-performance liquid chromatography patterns of mycobacterium gordonae mycolic acids.an important class of fatty acids contained in the cell envelopes of mycobacterium organisms is the group of high-molecular-weight, long-chain, alpha-branched, beta-hydroxylated mycolic acids. by using standard saponification techniques and derivatization of the acids to their p-bromophenacyl esters, it is possible to differentiate them by high-performance liquid chromatography. mycolic acid chromatograms of 63 clinical isolates of mycobacterium gordonae were compared with conventional biochemic ...19921401006
activities of clarithromycin against eight slowly growing species of nontuberculous mycobacteria, determined by using a broth microdilution mic system.mics of clarithromycin against 324 clinical isolates belonging to eight species of slowly growing nontuberculous mycobacteria were determined by using a broth microdilution system. isolates were inoculated into twofold drug dilutions in middlebrook 7h9 broth (ph corrected to 7.4) and then incubated at 30 degrees c for 7 days for mycobacterium marinum and for 14 days for all other species. the mic for 90% of the strains (mic90) was less than or equal to 0.5 micrograms/ml for isolates of mycobacte ...19921416891
disseminated infection as a result of mycobacterium gordonae in an aids patient. 19921466857
mycobacterium gordonae genitourinary disease.mycobacterium gordonae is frequently isolated from urine, but m gordonae genitourinary disease is rare; the majority of the isolates are commensals. we describe a 40 year old housewife who presented with loin pain, dysuria and frequency. urine contained excessive pus cells, was sterile on culture and she did not respond to broad spectrum antibiotics. there was repeated isolation of m gordonae from the urine and she responded to a standard antituberculosis regimen. she was irregular and non-compl ...19921548012
mycobacterium gordonae keratitis.a 20-year-old man was evaluated for an indolent corneal ulcer. tissue and cultures from a penetrating keratoplasty indicated that the causative agent was mycobacterium gordonae. this is the third patient reported with m. gordonae keratitis, although there have been numerous reports of nontuberculous mycobacterial keratitis. nontuberculous mycobacterial keratitis is typically associated with previous trauma. the patient reported here had no known predisposing factor.19921559351
[pulmonary infection caused by mycobacterium gordonae (m. gordonae) in a healthy middle-aged male].a 51-year-old man was admitted to our hospital in july 1989 because of an abnormality in his chest radiograph. on his yearly health check-up, an abnormality of his chest radiography was first noted in june 1988. at that time, examinations including bronchoscopy were performed but no specific diagnosis was made. on admission, his chest radiograph revealed new infiltrates at the apex of the right lung which were not present in june 1988. three out of 5 consecutive sputum specimens after admission ...19921602666
mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids.between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ...19921617056
disseminated infection with mycobacterium gordonae: report of a case and critical review of the literature.mycobacterium gordonae is only rarely a cause of infection despite its ubiquity in the environment. we describe an 11-year-old girl with disseminated infection due to m. gordonae whose course was complicated by renal failure requiring hemodialysis but who recovered after 15 months of chemotherapy. in a literature search we identified 23 additional cases of infection attributed to m. gordonae, with involvement of the lungs (eight), soft tissue (seven), the peritoneal cavity (three), the cornea (o ...19921623079
fourth report of the cooperative, open-ended study of slowly growing mycobacteria by the international working group on mycobacterial taxonomy.the open-ended study of the international working group on mycobacterial taxonomy is an ongoing project to characterize slowly growing strains of mycobacteria that do not belong to well-established or thoroughly characterized species. in this fourth report we describe two numerical taxonomic clusters that represent subspecies or biovars of mycobacterium simiae, one cluster that encompasses the erstwhile type strain of the presently invalid species "mycobacterium paraffinicum," one cluster that i ...19911742195
[use of dna probes labelled with radioisotopes in the mycobacteria laboratory].we have studied 540 mycobacterial strains isolated in lowestein-jensen medium and 133 samples of different pathologic products against commercialized 125i-dna mycobacterium tuberculosis complex, mycobacterium avitum-intracellulare and mycobacterium gordonae. the sensitivity, specificity and positive and negative predictive values against isolated strains was 100% for the 3 studied probes. the 125i-dna probe specific for m. tuberculosis complex is studied in samples with positive bacciloscopy; st ...19911745802
occurrence of mycobacteria in drinking water samples.33 ground water samples from three drinking water treatment plants and 72 samples from domestic drinking water distribution systems were studied for the occurrence of mycobacteria. 86 out of these samples tested positive for mycobacteria with concentrations generally ranging between 10(2) and 10(3) cfu/l. in one distribution system up to 4.5 x 10(5) cfu/l were found. species identified by biochemical reactions and by thin layer chromatography of mycolic acids included: mycobacterium gordonae (mo ...19911750968
case report: disseminated mycobacterium gordonae infection in a nonimmunocompromised host.mycobacterium gordonae is considered the least pathogenic of the runyon group ii mycobacteria, although there are now well-documented reports of infection varying from localized soft tissue infection to disseminated life threatening diseases. we report a 40-year-old pakistani housewife, treated in childhood for tuberculosis, who presented with severe systemic illness, fever, ascites, hepatomegaly, persistent dysuria with sterile pyuria, pulmonary disease, and anorexia with weight loss. liver bio ...19911772125
identification of mycobacterium gordonae from culture by the gen-probe rapid diagnostic system: evaluation of 218 isolates and potential sources of false-negative results.the mycobacterium gordonae rapid diagnostic system (gen-probe, inc., san diego, calif.) was evaluated for sensitivity and specificity as well as for its application in the mycobacteriology laboratory. an 125i-labeled cdna probe complementary to rrna was employed. hybridization of greater than or equal to 10% was considered positive. a total of 218 mycobacterial isolates, including 159 isolates of m. gordonae, were tested. under optimum conditions, the specificity and sensitivity of the probe wer ...19911774307
mycobacterium gordonae keratitis after penetrating keratoplasty. 19911867541
mycobacterium gordonae: a possible opportunistic respiratory tract pathogen in patients with advanced human immunodeficiency virus, type 1 infection.to determine if mycobacterium gordonae is an opportunistic respiratory tract pathogen in patients infected with human immunodeficiency virus, type 1 (hiv-1).19911889262
[pulmonary infection caused by mycobacterium gordonae and pneumocystis carinii pneumonia in a patient with acquired immunodeficiency syndrome]. 19912051800
polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis.a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ...19902109022
[acid-fast bacilli isolated from foot pads of nude mice infected with leprosy bacilli].when leprosy bacilli grown in nude mouse foot pad were used for culture experiments, cultivable acid-fast bacillus was sometimes isolated as a contaminant. whenever bacilli were inoculated to nude mice, the same leprosy bacilli were killed by autoclaving and were inoculated in to foot pads of 5 nude mice for examination of this cause of the contamination. acid-fast bacillus was cultivated on 3% ogawa egg medium at 33 degrees c from homogenates of foot pads of nude mice infected with m. leprae af ...19902133033
mycobacterium gordonae pseudoinfection associated with a contaminated antimicrobial solution.at yale-new haven hospital, 46 specimens submitted for mycobacterial culture during an 8-week period in 1989 were positive for mycobacterium gordonae, a nontuberculous acid-fast bacterium (afb) of low pathogenicity. the specimens were submitted from 34 patients who came from various inpatient and outpatient services. four patients were begun on antimycobacterial therapy on the basis of an afb isolate which was later identified as m. gordonae. isolation of m. gordonae was associated with use of t ...19902280008
a solitary pulmonary nodule due to mycobacterium gordonae.mycobacterium gordonae is rarely pathogenic in humans. in this case it was cultured from the tissue of a resected pulmonary nodule in an immunocompetent patient. one year after completing 12 months of chemotherapy, the patient remains disease free. atypical mycobacterium should be considered in the differential diagnosis of solitary pulmonary nodules.19902284512
purification of the 65 kd protein from mycobacterium gordonae and use in skin test response to mycobacterium leprae.the cell wall-associated protein of mycobacterium gordonae (mr = 65,000) was purified by affinity chromatography using a murine monoclonal antibody produced in response to the crossreactive 65 kd protein of m. leprae. the affinity-purified material was analyzed for purity by protein and carbohydrate analyses, sds-page, and immunoblotting. the final preparation contained a major protein band on sds-page analysis (mr = 65,000) with no detectable carbohydrates. the affinity fraction was prepared at ...19872435825
pulmonary disease caused by mycobacterium gordonae.a case of pulmonary disease caused by mycobacterium gordonae is described. the micro-organism showed atypical biochemical characteristics.19892617687
[peritonitis caused by mycobacterium gordonae in a male patient infected by the human immunodeficiency syndrome virus]. 19892622269
granulomatous pulmonary reactions after instillation of mycobacterium gordonae. light and electron microscopic investigations on the rat model.pathogenicity of mycobacterium gordonae in humans has so far been reported in the literature in the form of case reports only. systematic experimental investigations have not been published. for this reason, the pathogenicity of two mycobacterium gordonae strains isolated from human ivestigation material were tested in animal experiments. measured amounts of in some cases live and in some cases heat-killed m. gordonae were instilled into the right lower lobe of the lung of anesthetized wistar ra ...19892747588
[hospital pseudo-infections caused by mycobacterium gordonae].sputum specimens from 15 patients with respiratory disease were reported to have positive cultures for mycobacterium gordonae, an organism generally considered to be non-pathogenic for man. none showed typical radiological changes for mycobacteriosis. mycobacterium gordonae was also isolated from some components of the aerosol therapy instrument. because aerosol therapy was used for 4 patients only, we were not able to establish whether the mycobacterium gordonae was only a colonizer. we suggest ...19892762653
mycobacterium other than tubercle bacilli in various environments in bangkok.this research was designed to isolate mycobacterium other than tubercle bacilli in various environments in the bangkok area, in 1987. the results were as follows, one hundred samples of soil yielded 1 mycobacterium gordonae, 2 m. chelonei, 57 m. fortuitum, 1 nocardia asteroides, one hundred samples of natural water from the chao phraya river and the canals of chao phraya river yielded 2 m. chelonei, 18 m. fortuitum, 1 n. asteroides and 1 n. brasiliensis, thirty samples of tap water yielded 3 m. ...19892778420
cutaneous infection with mycobacterium gordonae.a case of cutaneous infection with mycobacterium gordonae and other reports of extrapulmonary infection due to this organism are reviewed. this case confirms the pathogenic potential of m. gordonae which must now be included among the scotochromogens capable of causing cutaneous disease. isolates of this organism should be tested against a full range of antimicrobial agents since traditional antituberculous therapy may be of limited efficacy. pending the results of in vitro susceptibility testin ...19872880916
pulmonary infection with mycobacterium gordonae in the presence of bronchial carcinoma. 19852984815
whole chromosomal dna probes for rapid identification of mycobacterium tuberculosis and mycobacterium avium complex.whole chromosomal dna probes were used to identify clinical isolates of mycobacterium tuberculosis, mycobacterium avium complex, and mycobacterium gordonae. the probe for m. tuberculosis was prepared from mycobacterium bovis bcg, which has been shown to be closely related to m. tuberculosis. a probe for the m. avium complex was prepared from three strains representing each of the three dna homology groups in the m. avium complex. the probes were used in dot blot assays to identify clinical isola ...19873112180
identification of major slowly growing pathogenic mycobacteria and mycobacterium gordonae by high-performance liquid chromatography of their mycolic acids.a rapid, reverse-phase high-performance liquid chromatography method was used to detect rho-bromophenacyl mycolic acid ester patterns for strains of four major pathogenic mycobacterium species and for the most commonly encountered saprophytic species, mycobacterium gordonae. mycobacteria in low numbers (2.5 x 10(6) cfu) were detected and identified to the species level. standard chromatographic patterns characteristic of each species were established. simple pattern recognition enabled rapid ide ...19883125214
mycobacterium gordonae: an unusual peritoneal pathogen in a patient undergoing continuous ambulatory peritoneal dialysis. 19883189373
[a case of mycobacterium kansasii lung infection developed after treatment of mycobacterium gordonae lung infection]. 19883226033
differentiation of mycobacterium gordonae from mycobacterium scrofulaceum and mycobacterium szulgai by susceptibility to enoxacin (antimycobacterial activity of enoxacin). 19863467156
skin granulomas due to mycobacterium gordonae.a 38-year-old woman presented with small, ulcerated, red or bluish nodules on the right hand, clinically resembling mycobacterial granulomas; these appeared a few months after a bite by a rat, while the patient was collecting frogs in a pond in the belgian ardennes. the histopathologic picture was compatible with a diagnosis of mycobacterial infection and rare acid-fast bacilli could be found. repeated bacteriologic investigations were performed and these led to the identification of a strain di ...19873570593
a pseudoepidemic due to atypical mycobacteria in a hospital water supply.we describe a pseudoepidemic due to atypical mycobacteria contaminating the water used by a pathology laboratory and bronchoscopy suite on two floors of the same hospital building. inspection of laboratory procedures revealed that contamination occurred during specimen processing in pathology and while obtaining the bronchoscopic specimens. mycobacterium gordonae, mycobacterium avium complex, and mycobacterium scrofulaceum were identified. during an eight-month period, a total of 22 (31%) of 70 ...19873613009
nosocomial mycobacterium gordonae pseudoinfection from contaminated ice machines.thirty-two clinical specimens submitted to the laboratory during a 12-month period from july 1980 to june 1981 were reported to be culture-positive for mycobacterium gordonae, an organism generally considered to be a slow-growing saprophyte with natural habitats which include soil and water. only seven similar isolates had been recovered in the preceding 4 1/2 year period. the discordance between clinical findings and the mycobacterial cultures suggested extrinsic contamination of the specimens. ...19863633881
biochemical characteristics and fatty acid compositions of some armadillo-derived mycobacteria and their relation to mycobacterium gordonae.the long-chain components of 75 strains of mycobacteria, cultivated from mycobacterium leprae-infected or non-infected armadillos, and of eight clinical and 15 environmental isolates of m. gordonae, were compared. four major groups could be distinguished based on the presence of 10-methyloctadecanoic (tuberculostearic) and 2-methyl 3-hydroxyeicosanoic acids and secondary alcohols (2-octadecanol and 2-eicosanol). some heterogeneity was found in strains assigned to m. gordonae: the characteristic ...19873655731
pulmonary infection by mycobacterium gordonae in an immunocompromised patient.mycobacterium gordonae, a scotochromogenic organism, is considered a saprophyte and isolation of this organism in sputum cultures is not generally considered clinically significant. we report the case of 70-yr-old man with hodgkin's disease and pulmonary infection caused by mycobacterium gordonae. the clinical and radiographic findings in this case and the course are outlined. mycobacterium gordonae isolated from patients with debilitating diseases should not automatically be rejected as a conta ...19873677577
progressive pulmonary disease caused by mycobacterium gordonae.mycobacterium gordonae has been considered a true saprophyte of the respiratory tract, unable to produce pulmonary disease. we have reported a case of progressive pulmonary disease due to mycobacterium gordonae which has failed to improve with multiple combinations of antituberculous drugs over a period of eight years.19863704712
mycobacterium gordonae: a new pathogen?mycobacterium gordonae is a slow growing scotochromogenic acid fast bacillus (runyon group ii) with specific cultural and biochemical characteristics. it is a contaminant of water, soil, and raw milk and is usually considered to be saprophytic and non-pathogenic in man. we have recently seen two cases of pulmonary disease that may have been due to m gordonae, and we now report these and review our recent experience of this organism.19863704982
chronic keratitis caused by mycobacterium gordonae.we treated a patient with chronic keratitis caused by mycobacterium gordonae, a slow-growing, atypical mycobacterium not previously reported as a cause of corneal infection. the patient was a 34-year-old man who was hit in the eye with some vegetable matter while gardening. initially, the patient was treated for a presumptive diagnosis of herpes simplex keratitis. because of progression of the keratitis, a lamellar corneal biopsy was performed 3 1/2 years later and the definitive diagnosis was m ...19863766669
quantitative comparison of the mycolic and fatty acid compositions of mycobacterium leprae and mycobacterium gordonae.the mycolic and fatty acids of three samples each of mycobacterium leprae and mycobacterium gordonae were compared. acids released by whole-organism alkaline hydrolysis were converted to 4-nitrobenzyl esters and mycolic acids were further derivatized to t-butyldimethylsilyl ethers. thin-layer chromatography of the derivatized long-chain extracts showed that all three m. leprae preparations contained so-called alpha-mycolates and ketomycolates but that the m. gordonae samples had a methoxymycolat ...19853903040
disseminated mycobacterium gordonae infection associated with glomerulonephritis. 19853993015
identification of mycobacteria by specific precipitation of catalase with absorbed sera.cross-absorbed antisera have been prepared against catalase from reference strains of mycobacterium asiaticum, mycobacterium gordonae, mycobacterium scrofulaceum, mycobacterium simiae, and mycobacterium szulgai. a total of 61 strains of mycobacteria were grown in small volumes of liquid medium and disrupted in sealed tubes in a cup horn sonicator, and the extracts were tested by a seroprecipitation technique against each of the reference antibody preparations. all 35 strains that belonged to one ...19853998101
mycobacteria in semi-public swimming-pools and whirlpools.the presence, densities and species distribution of atypical mycobacteria were assayed in samples from swimming-pools in semi-public areas (hotels, recreational parks and camping grounds) and from whirlpools (in sauna institutes, fitness clubs and recreational parks). tap water used to supply these pools was also investigated. mycobacteria were frequently detected in all types of samples, the numbers in whirlpools on the average being about ten times higher than those in swimming-pools and tap w ...19854024777
differentiation between mycobacterium scrofulaceum and mycobacterium gordonae by susceptibility to pyronine. 19724602512
a preliminary study of delayed hypersensitivity to mycobacterium chelonei, mycobacterium fortuitum (ranae) and mycobacterium gordonae in cattle from two areas in uganda. 19744611462
a study of mycobacterium gordonae and mycobacterium marianum (scrofulaceum). 19724630412
mycobacterium gordonae in the acquired immunodeficiency syndrome. 19846465711
mycobacterium gordonae infection of the hand.a 70-year-old woman was seen for two chronic nodules on the dorsum of her left hand. they had a uniquely mamillated surface, but histopathologically showed nonspecific granulomatous changes with no organisms seen. laboratory studies disclosed the lesions were due to mycobacterium gordonae, an organism commonly ignored as a pathogen. the histopathologic changes were reproduced by intradermal testing with tuberculin. the lesions, unaffected by ketoconazole, as well as by a variety of antibiotics, ...19846465913
mycolic acid patterns of some species of mycobacterium.representative strains of some species of mycobacterium were degraded by both acid and alkaline methanolysis. two-dimensional thin-layer chromatography was used to determine the patterns of mycolic acids and other long-chain components in these methanolysates. patterns composed of alpha-, methoxy- and ketomycolates were found in mycobacterium asiaticum, mycobacterium bovis, mycobacterium gastri, mycobacterium gordonae, mycobacterium kansasii, mycobacterium marinum and mycobacterium tuberculosis; ...19846517656
infection of synovial tissue by mycobacterium gordonae. 19836627163
an improved reagent for mycobacterial nitrate reductase tests.a new crystalline reagent for nitrate reductase tests was compared with standard liquid reagents on 437 strains of mycobacteria. the results for isolates of mycobacterium avium complex, mycobacterium kansasii, mycobacterium gordonae, mycobacterium scrofulaceum, mycobacterium fortuitum, and mycobacterium chelonei agreed 100% with the expected results. of the 177 mycobacterium tuberculosis isolates, 4 were negative by the conventional method. two of these four isolates were positive with the new r ...19836685134
the value of bronchoscopy in the diagnosis of mycobacterial disease. a five-year experience.during five years, 6,879 patients underwent bronchoscopic study at the mayo clinic. mycobacterial cultures were obtained from 4,120 (60 percent). mycobacterial organisms (typical or atypical) other than mycobacterium gordonae were isolated in 70/4,120 (1.7 percent) patients. during the same period, 209 patients had culture-proved m tuberculosis from various sources. bronchoscopy was performed on 34/209 (16 percent) patients. washings or secretions from bronchoscopy grew m tuberculosis in 32/34 ( ...19816794991
mycobacterium gordonae as a human hepato-peritoneal pathogen, with a review of the literature.mycobacterium gordonae was cultured from the liver of a 39-year-old woman who presented with ascites, weight loss, and fever. laparoscopic examination revealed white nodules studding the peritoneum and liver surface, and histopathology revealed caseating granulomas. she was successfully treated with rifampin, ethambutol, and isoniazid. a review of the literature on m. gordonae as a human pathogen in presented. our patient represents the third reported case of disseminated disease due to this org ...19836824016
determination of fatty acids and carbohydrate monomers in micro-organisms by means of glass capillary gas chromatography: analysis of mycobacterium gordonae and mycobacterium scrofulaceum.trifluoroacetylated whole-cell methanolysates of four strains each of mycobacterium gordonae and mycobacterium scrofulaceum were analysed by gas chromatography, using a glass capillary column. the major chromatographic peaks were identified by mass spectrometry as derivatives of fatty acids and carbohydrates. in addition, two predominant peaks, present in chromatograms representing m. scrofulaceum, were identified as 2-octadecanol and 2-eicosanol. these secondary alcohols were not found in any o ...19836842180
[studies on the lipids of "mycobacterium gordonae" in comparison with those of "m. leprae" and of some other scotochromogenic mycobacteria (author's transl)].the mycolic acids were isolated from mycobacterium gordonae (strain atcc 14470), and purified by thin layer chromatography. three species were studied by mass spectrometry. the analogy between m. gordonae and m. leprae, based on the lack of tuberculostearic acid, was supported by the comparison of the structures of their mycolic acids. succinct analyses of the lipids of three other scotochromogenic strains of mycobacteria, using thin layer chromatography and gas-liquid chromatography, were perfo ...19817030172
mycobacterium thermoresistibile: a new pathogen for humans.the first evidence of the potential pathogenicity of mycobacterium thermoresistibile is presented. this mycobacterium, initially identified as mycobacterium gordonae, was isolated repeatedly from sputum, a bronchoscopy specimen. and later, an open lung biopsy. the distinctive characteristics are described, including the unique ability of the organism to grow at 52 degrees c.19817309855
pulmonary infection caused by atypical mycobacteria: a report of 24 cases in thailand.from 1969 to 1978, 24 patients were suspected of having pulmonary disease caused by atypical mycobacteria. seven were infected with mycobacterium avium-intracellulare, six with mycobacterium avium, six with mycobacterium scrofulaceum, two with mycobacterium fortuitum, and one with mycobacterium gordonae. one patient had a strain of scotochromogens antigenically related to mycobacterium simiae. mycobacterium kansasii was found in only one patient. retrospective analysis revealed that 20 of the pa ...19817339809
high-catalase strains of mycobacterium kansasii isolated from water in texas.isolation techniques with membrane-filtered potable water samples resulted in the isolation of potentially pathogenic high-catalase strains of mycobacterium kansasii from 8 of 19 representative outlets in a small central texas town. mycobacterium gordonae was isolated from all samples, and mycobacterium fortuitum was isolated from two samples. data on chlorine levels are presented along with a possible explanation for the unusually high numbers of mycobacteria in these potable water samples. fin ...19807381016
pulmonary infection caused by mycobacterium gordonae.mycobacterium gordonae, a scotochromogenic organism, is considered a saprophyte. in sputum cultures the isolation of this organism or other species belonging to the scotochromogen group is not generally considered clinically significant since they are known to appear as commensals. we report the case of a 50-year-old man with pulmonary infection caused by m. gordonae. the clinical and radiographic findings in this case and the course was outlined. diagnostic criteria of atypical mycobacterial in ...19807426358
cross-reactivity of anti-mycobacterium gordonae antibodies with the major mitochondrial autoantigens in primary biliary cirrhosis.primary biliary cirrhosis is a chronic cholestatic liver disease associated with autoimmune disorders. antimitochondrial autoantibodies and granulomatous portal lesions are characteristic in primary biliary cirrhosis. since granuloma may be induced by mycobacteria, and there is evidence implicating mycobacteria as infectious agents capable of initiating autoimmunity, a study was performed to determine the presence of antibodies against 10 atypical mycobacteria in 19 patients with primary biliary ...19947529275
detection of mycobacterium tuberculosis directly from spiked human sputum by q-beta replicase-amplified assay.we report on a rapid, sensitive, q-beta replicase-amplified nucleic acid hybridization assay for the detection of mycobacterium tuberculosis directly from spiked human sputum. specimens were processed by either an n-acetyl-l-cysteine-naoh or a 2% naoh digestion-decontamination method and then washed to neutralize the ph of the cell pellet. the washed sputum pellets were heated at 100 degrees c to inactivate the m. tuberculosis organisms. the heat-inactivated samples were mechanically lysed at 5, ...19957536213
[mycobacterium gordonae infections in human immunodeficiency virus infection].non-tuberculous mycobacteria infections are frequent in patients infected with the human immunodeficiency virus (hiv). mycobacterium avium intracellulare is the most frequent organism isolated but several other mycobacteria are also seen. mycobacterium gordonae is a saprophytic mycobacteria which is rarely pathogenic. it was observed in 9% (7 patients) of the mycobacterial infections observed in our unit over a period of 3 years.19957567831
dental units: an environmental study of sources of potentially pathogenic mycobacteria.infections caused by non-tuberculous mycobacteria (ntm) are generally thought to be acquired from environmental sources. however, little is known about the situations in which transmission occurs.19957579313
comparative in-vitro activities of the new quinolone, bay y 3118, and ciprofloxacin, sparfloxacin, tosufloxacin, ci-960 and ci-990.the in-vitro activity of the new quinolone, bay y 3118, was compared with that of ciprofloxacin, tosufloxacin, sparfloxacin, ci-960 and ci-990 against 1640 isolates belonging to 117 bacterial species. against members of the enterobacteriaceae, bay y 3118 was as active as ci-960 and ci-990, up to four-fold more active than ciprofloxacin and tosufloxacin and up to 16-fold more active than sparfloxacin. the majority of enterobacteriaceae which were resistant to ciprofloxacin (mics > or = 2 mg/l) we ...19937605398
liquid chemical sterilization using peracetic acid. an alternative approach to endoscope processing.recurrent episodes of endoscope contamination with nontuberculous mycobacterium and pseudomonas species, coupled with employee concerns about exposure to 2% glutaraldehyde and the requirement for rapid scope turnover time, led to the investigation of an alternative method for endoscope processing. a prospective evaluation of 220 bronchoscopy procedures was carried out. endoscope culture surveillance was performed twice a month for a 12 month period on all endoscopes. in addition, the deliberate ...19957640418
use of gen-probe accuprobes to identify mycobacterium avium complex, mycobacterium tuberculosis complex, mycobacterium kansasii, and mycobacterium gordonae directly from bactec tb broth cultures.to evaluate the utility of gen-probe accuprobes for the identification of mycobacteria directly from bactec tb 12b vials containing acid-fast bacilli, culture results for 11,375 clinical specimens other than blood received from 1 january 1992 to 30 september 1993 were reviewed retrospectively. during this period, a total of 359 of 11,375 bactec vials were positive for acid-fast bacilli and were evaluated for mycobacteria with one or more probes: 224 were probed for mycobacterium tuberculosis com ...19947883888
antibodies to atypical mycobacteria in primary biliary cirrhosis.recent work has shown that there is antigenic similarity between common bacterial proteins and epitopes on biliary epithelial cells. following evidence that the sera of all of a series of patients with primary biliary cirrhosis contained antibodies to an extract of mycobacterium gordonae (a ubiquitous environmental organism) and that these antibodies cross-reacted with the major mitochondrial m2 epitopes, the study below has been performed to investigate this phenomenon further. using western bl ...19947890908
a simple identification system for slowly growing mycobacteria. ii. identification of 25 strains isolated from surface water in valencia (spain).based on a twenty-year experience, a simple identification system for slowly growing mycobacteria has been presented for clinical laboratories not specialized in this work. with this system (12 tests: tolerance to 0.02% picric acid, colony pigmentation in the dark, nitrate reduction, resistance to ethambutol, tween hydrolysis at 7 and 14 days, resistance to hydroxylamine, pas degradation, tolerance to p-nitrobenzoic acid, production of nicotinic acid and colony morphology) we have identified 15 ...19937976210
chronic destructive lung disease associated with a novel mycobacterium.a woman born in 1920 has suffered from a chronic destructive lung disease since 1972, with development of a severe combined restrictive and obstructive ventilatory defect. large quantities of acid-fast microorganisms have been repeatedly observed in her sputum. multiple courses of antimycobacterial treatment did not stop the progression of the disease. the mycobacterium involved was first identified as mycobacterium gordonae, and later as mycobacterium scrofulaceum. analysis of part of the ampli ...19948025761
multiple pneumonias in a man infected with hiv.there are many pathogens responsible for pneumonia in persons infected with hiv. this case report describes a patient with pneumonias diagnosed sequentially and caused by pneumocystis carinii, mycobacterium gordonae, and coccidioides immitis. it demonstrates the importance of pursuing a definitive or additional diagnosis in hiv-related pulmonary disease when the response to empiric therapy or to treatment of an identified pathogen is suboptimal.19938245813
trehalose-containing lipooligosaccharides of mycobacterium gordonae: presence of a mono-o-methyltetra-o-acyltrehalose "core" and branching in the oligosaccharide backbone.past evidence has indicated that mycobacterium gordonae, as isolated from soil and as an occasional opportunistic pathogen, exists as a serocomplex. we now demonstrate that the basis of seroreactivity and diversity is a novel series of alkali-labile, trehalose-containing lipooligosaccharides (los). the structures from two strains were established by per-o-methylation, partial acid hydrolysis, infrared and high-field nmr spectroscopy, electron-impact ms, and fast atom bombardment/mass spectrometr ...19938251490
mycobacterium gordonae: a treatable disease in hiv-positive patients.to evaluate the pathogenicity of mycobacterium gordonae in patients with and without human immunodeficiency virus (hiv) infection.19938252963
bactericidal, virucidal, and mycobactericidal activities of reused alkaline glutaraldehyde in an endoscopy unit.baths with 2% alkaline glutaraldehyde are often reused for 14 days to decontaminate flexible fiberoptic endoscopes (ffes) between patients, but the effect of such reuse on the disinfectant's activity has not been known. many busy endoscopy units also disinfect ffes with contact times shorter than those recommended by the disinfectant manufacturer. we therefore collected samples of the disinfectant over the 14-day reuse period from two manual and one automatic bath used for bronchoscopes and gast ...19938263184
chronic cutaneous infection caused by mycobacterium gordonae.we report on a patient with a chronic nodular cutaneous infection histologically presenting with tuberculoid granulomas and growing mycobacterium gordonae in culture from a biopsy. the lesions were treated surgically. m. gordonae is a potentially pathogenic environmental mycobacterium only rarely causing skin infections.19938274796
cutaneous spindle-cell pseudotumors due to mycobacterium gordonae and leishmania infantum. an immunophenotypic study.we report two patients with aids who had cutaneous spindle-cell pseudotumors caused by leishmania infantum in one instance and by an atypical mycobacterium in the other. the lesions mimicked neoplasms with predominantly spindled macrophages, similar to those seen in the histoid variant of leprosy. this histoid reaction is known to be related to mycobacteria. to our knowledge, this is the first case of histoid reaction due to leishmania. in both cases, the histiocytic cells were positive for vime ...19938311186
purification and characterization of restriction endonuclease mgoi from mycobacterium gordonae.a restriction endonuclease, mgoi, an isoschizomer of sau3ai, was purified from mycobacterium gordonae trc1318. as compared to sau3ai, the yield of mgoi was seven-eightfold higher, the enzyme was four times more stable at 37 degrees c, and in addition, had optimal activity over a much broader range of salt concentrations.19938370536
rifabutin in the treatment of cavitary lung disease due to mycobacterium gordonae.we have described a case of progressive pulmonary disease caused by m gordonae that failed to show any improvement in disease status after 9 months of intensive therapy with a conventional four-drug regimen. when rifabutin became available and was included in the regimen, the disease was cured. although considered a saprophyte of the respiratory tract, m gordonae can cause clinically significant disease in rare instances. initiation of appropriate therapy with rifabutin and other antituberculous ...19938391724
differentiation of mycobacteria on the basis of chemotype profiles by using matrix solid-phase dispersion and thin-layer chromatography.because of the rising incidence of clinical mycobacterial infections and the difficulty in identification and characterization of mycobacteria at the subspecies and serovar levels, a technique for differentiation that could be performed quickly and with relatively little equipment and expense was developed. lysis and fractionation of mycobacteria by matrix solid-phase dispersion followed by thin-layer chromatography were used to produce chemotype profiles of the lipid and glycolipid components o ...19938458954
[mycobacterium gordonae isolation in samples from bronchial aspirates and its practical implications]. 19938479223
isolation of atypical mycobacteria from tap water in hospitals and homes: is this a possible source of disseminated mac infection in aids patients?infections caused by mycobacteria other than tuberculosis (mott), especially mycobacterium avium complex (mac), are common in aids patients, but rare in immunocompetent persons. the route of transmission is unknown, but tap water could provide a possible source of infection: mac was isolated from tap water in the u.s.a. but this has not been reported in germany. we therefore investigated tap water in berlin for the presence of mycobacteria and compared radiometric (bactec) and standard plate cul ...19958522830
semantide- and chemotaxonomy-based analyses of some problematic phenotypic clusters of slowly growing mycobacteria, a cooperative study of the international working group on mycobacterial taxonomy.during previous cooperative numerical taxonomic studies of slowly growing mycobacteria, the international working group on mycobacterial taxonomy described a number of strains whose taxonomic status was ambiguous. a new study of dna, rna, and proteins from 66 of these organisms was performed to correlate their properties with phenotypic clustering behavior; the results of this study permitted 51 of the strains studied to be assigned to known species. the methods used to characterize the semantid ...19968573508
homing events in the gyra gene of some mycobacteria.the a subunit of dna gyrase in mycobacterium leprae, unlike its counterpart in mycobacterium tuberculosis, is produced by protein splicing as its gene, gyra, harbors a 1260-bp in-frame insertion encoding an intein, a putative homing endonuclease. analysis of the gyra locus from different mycobacterial species revealed the presence of inteins in mycobacterium flavescens, mycobacterium gordonae and mycobacterium kansasii but not in 10 other pathogenic or saprophytic mycobacteria. in all four cases ...19968622949
mycobacterium gordonae in fiberoptic bronchoscopes.failure of high-level disinfection of bronchoscopes has caused several outbreaks of nosocomial infection or pseudoinfection involving mycobacteria.19968651516
pulmonary mycobacterium gordonae infection in a two-year-old child: case report. 19968783736
[antimicrobial activity and interaction with dna of medicinal plants from the peruvian amazon region].decoctions of four plants used for the treatment of different infections by indigenous groups of the peruvian amazon, i.e. abuta grandifolia, cyperus articulatus, gnaphalium spicatum and pothomorphe peltata were evaluated for antimicrobial activity by the "stroke method" in agar plates. tested organisms included staphylococcus aureus, escherichia coli, salmonella gallinarum, klebsiella pneumoniae, candida albicans, pseudomonas aeruginosa and mycobacterium gordonae. all decoctions showed antimicr ...19958850132
characterization of an isolate of the newly described species mycobacterium interjectum.the phenotypic features of a clinical isolate of the new species mycobacterium interjectum, identified on the basis of its 16s rrna gene sequence, are compared with those of the type strain. the differentiation of m. interjectum from mycobacterium gordonae or mycobacterium scrofulaceum is not achievable on the basis of phenotypic traits usually tested for mycobacterial speciation, but it can be reached by 16s rrna gene sequencing or by high performance liquid chromatography (hplc) of cell wall m ...19968861866
comparison of mycobacteria growth indicator tube with bactec 460 for detection and recovery of mycobacteria from clinical specimens.we compared the mycobacteria growth indicator tube (mgit) system with the bactec 460 (b460) and lowenstein jensen (lj) systems for the recovery of mycobacteria (acid-fast bacteria [afb]) from 1,441 clinical specimens. excluding 13 isolates of mycobacterium gordonae, 178 significant afb isolates were recovered from 113 patients. isolates (119) of the mycobacterium avium complex (mac) accounted for 67% of all isolates, while isolates (30) of the mycobacterium tuberculosis complex (mtb) accounted f ...19968862591
disseminated mycobacterium gordonae infection in a patient infected with human immunodeficiency virus. 19968879799
Displaying items 1 - 100 of 286