mycobacteria as a possible cause of inflammatory bowel disease. | mesenteric lymph-nodes from 27 patients with crohn's disease, 13 with ulcerative colitis, and 11 without inflammatory bowel disease were cultured for mycobacteria. a node from a patient with crohn's disease yielded a strain of mycobacterium kansasii. cultures from 22 other patients with crohn's disease, 7 with ulcerative colitis, and 1 control subject yielded pleomorphic organisms with the electron-microscopic appearances of cell-wall-deficient organisms. further culture and characterisation of ... | 1978 | 80630 |
search by immunofluorescence for antigens of rotavirus, pseudomonas maltophilia, and mycobacterium kansasii in crohn's disease. | crohn's-disease tissue was tested by indirect immunofluorescence for antigens of rotavirus, pseudomonas maltophilia, and mycobacterium kansasii. no reactions were obtained with anti-serum to p. maltophilia and m. kansasii, and a granular fluorescence seen with rotavirus antibody was probably non-specific. | 1978 | 80631 |
cellular immunity in patients with tuberculosis caused by mycobacterium kansasii and mycobacterium tuberculosis. | | 1979 | 94081 |
radiographic manifestations of pulmonary mycobacterium kansasii infections. | the radiographic characteristics of 187 pristine cases of pulmonary mycobacterium kansasii infection are reviewed. the cases were selected from a total of 309 patients with two positive sputum cultures. all but three of the 187 patients had pulmonary disease. the progenitive focus of disease almost always involved the upper lobes, the right side (72%) more often than the left (50%). upper lobe disease began posterior to the trachea in every case. only one patient had disease that originated in a ... | 1978 | 104602 |
lymph node activation by a factor released from lymphocytes of normal mice in reaction with mycobacterium kansasii. | substances which have the same properties as the previously described lymph node activating factor are released from the 4-h culture of 10 x 10(6) lymph node cells from normal non-sensitized mice and 2.5--5 x 10(6) mycobacterium kansasii cells. they increase the number of lymphocytes with nucleoli synthesizing ribonucleic acid in the popliteal lymph nodes of intact mice and give the precipitation lines with the beta- to alpha-globulin electrophoretic mobility, which are specific for the lymph no ... | 1979 | 156656 |
[a comparison of some lipid components of the mycobacterium kansasii strains isolated from patients and sources of supply water (author's transl)]. | | 1979 | 161516 |
[effect of cultivation conditions on some lipid components of mycobacterium kansasii (author's transl)]. | | 1979 | 161868 |
immunotherapy of cancer with nonliving mycobacteria and cord factor (trehalose-6,6'-dimycolate) in aqueous medium. | heat-killed bcg, cord factor (trehalose-6,6'-dimycolate), or killed bcg plus cord factor in aqueous medium, admixed with tumor cells and injected into the skin of guinea pigs, inhibited the growth of a hepatocellular carcinoma. intralesional administration of killed bcg or mycobacterium kansasii coated with cord factor, in the same medium, caused regression of established tumors in 48 and 45% of the treated animals, respectively. | 1976 | 187785 |
liver disease in renal transplant recipients. | significant liver disease developed in 14 patients after renal transplantation. nine patients had morphologic and functional evidence of chronic active hepatitis. in general, these patients had few symptoms of liver disease, even though the course of chronic active hepatitis was progressive. despite large doses of prednisone, cirrhosis ultimately developed in five patients. the cause of chronic active hepatitis could not be related to azathioprine or methyldopa therapy because there was no perce ... | 1977 | 188393 |
tuberculosis due to mycobacterium kansasii. | eighteen cases of tuberculosis due to mycobacterium kansasii have been described. eleven were from western australia and seven from queensland. the symptoms, x-rays and histology of the disease were indistinguishable from those due to mycobacterium tuberculosis, but the organisms were resistant to streptomycin, para-amino-salicylic (pas) and isoniazid, but sensitive to ethionamide and cycloserine, and in most cases sensitive to rifampicin and ethambutol. all 18 cases were treated with some form ... | 1977 | 266899 |
abnormal chemotaxis in patients with cutaneous anergy. | chemotaxis of polymorphonuclear leukocytes and mononuclear leukocytes was studied in six patients who had persistent cutaneous anergy. four had previous infections (three fungal and one caused by mycobacterium kansasii), one had sarcoidosis, and one had late-onset immunoglobulin deficiency. our data indicate that some patients with persistent cutaneous anergy have a combined defect of leukocyte function. lymphocytes incubated in vitro with mitogen failed to elaborate active lymphocyte-derived ch ... | 1977 | 300135 |
the action of dapsone on a susceptible strain of mycobacterium kansasii. | | 1978 | 307103 |
[rapid microanalysis of phtiocerol dimycocerosate, mycosides and glycerides in the petroleum ether extracts of mycobacterium kansasii and bcg tye pasteur]. | | 1977 | 329895 |
the tween opacity test as an aid in classification of mycobacteria. | the tween opacity test can be used to differentiate (1) mycobacterium flavescens from mycobacterium gordonae and mycobacterium szulgai, and (2) nonphotochromogenic strains of mycobacterium kansaii from strains of the mycobacterium terrae complex. | 1977 | 335938 |
[effect of ozone on the phospholipid composition of escherichia coli and mycobacterium kansasii]. | | 1977 | 339965 |
a demographic study of disease due to mycobacterium kansasii or m intracellulare-avium in texas. | the number of patients reported th have disease due to mycobacterium kansasii or m intracellulare-avium has increased in texas from january 1967 to december 1976, in contrast to a decrease in tuberculosis. presented is an analysis of 1,409 patients infected with m kansasii and 706 patients infected with m intracellulare-avium. the former group clustered in urban areas with more than twice the incidence compared to nonurban areas (p less than 0.001). the latter group was more diffusely distribute ... | 1979 | 421546 |
[endemic occurrence of diseases caused by mycobacterium kansasii in the karviná industrial agglomeration]. | | 1979 | 445536 |
water: the natural habitat of mycobacterium kansasii? | it has been demonstrated that, after inoculation, mycobacterium kansasii will survive in water up to 12 months without any change in cultural or lipid characteristics. the organism failed to survive in soil. it is suggested that the natural habitat of m. kansasii is water. | 1979 | 473380 |
a sporotrichoid-like mycobacterium kansasii infection of the skin treated with minocycline hydrochloride. | a sporotrichoid-like mycobacterium kansasii infection of the skin is reported. this is the fifth reported case in the english literature of dermatological manifestations of a m. kansasii infection and the first reported case of a response to minocycline hydrochloride therapy. | 1979 | 475991 |
mycobacterium kansasii infection of the elbow joint. a case report. | | 1979 | 489656 |
granulomatous synovitis: the role of atypical mycobacteria. | clinical data on 25 patients with granulomatous synovitis and bursitis observed from 1970 through 1977 are reviewed. the lesions occurred about the extremities, the wrists and hands being involved most often. with three exceptions, the patients had no significant underlying disease. the lesions were chronic and often followed minor trauma. many patients had had prior surgery, steriod injections, or both. at the time of surgery for the synovitis, the gross appearance proved to be relatively chara ... | 1979 | 542760 |
photochromogenic and scotochromogenic mycobacteria: their clinical significance. | in the period 1973--1977, mycobacterium tuberculosis was isolated by cultivation in 4408 cases from the clinical specimens of patients with positive x-ray findings. on the basis of atypical colony morphology or pigment formation, 263 other mycobacterial strains were identified: of these 23 were photochromogenic and belonged to mycobacterium kansasii. the strains were cultured on several occasions from the specimens of 4 patients with broncho-pulmonary mycobacteriosis. the strains were resistant ... | 1979 | 543456 |
the disease due to mycobacterium kansasii in japan (author's transl)]. | | 1977 | 599778 |
a comparative study of tuberculous and other mycobacterial infections and their associations with malignancy. | we reviewed 162 cases of bacteriologically proved mycobacterial disease. nontuberculous acid-fast bacilli were responsible for 27 per cent of the infections, a higher frequency than has previously been reported, and mycobacterium kansasii and mycobacterium avium-intracellulare were isolated with equal frequency. this indicates that mycobacterium avium-intracellulare may be a significant agent of disease in the midwest as well as the southeast. there are no useful clinical, radiographic, or labor ... | 1978 | 619723 |
[stefansky's serodiagnosis and ulcerative and mutilating acropathy (author's transl)]. | systematic stefansky's serodiagnostic test in the course of ulcero-mutilating acropathia reveals a frequent positivity (25/30 patients). superinfection by atypical mycobacterium of telluric extraction is considered. a delayed hypersensibility to several mycobacterium antigens is proved to mycobacterium kansasii, johnei, balnei. perhaps, the same type of infection might exist in the course of chronic leg ulcers. | 1978 | 686616 |
musculoskeletal infections due to mycobacterium kansasii. | mycobacterium kansasii musculoskeletal infections are unusual. the infection presents as either a tenosynovitis, monoarticular arthritis or generalized systemic spread. in 2 patients, vigorous surgical and antimycobacterial medical regimens controlled the infection and produced full return of function. | 1978 | 729292 |
[studies on atypical mycobacteriosis with special emphasis on the disease due to mycobacterium kansasii (author's transl)]. | | 1978 | 748666 |
a new heat-stable acid phosphatase test for mycobacteria. | the heat-stable (70degrees c) acid phosphatase test performed by the method of kind and king is a simple method for differentiating mycobacterium kansasii, m. marinum, m. gastri, m. nonchromogenicum, and m. triviale from other slowly growing mycobacteria, and m. fortuitum from other rapidly growing acid-fast bacilli. | 1976 | 788568 |
pulmonary disease associated with mycobacteria other than tubercle bacilli in miners. | five patients with lung disease caused by mycobacteria other than tubercle (mott) bacilli are described. mycobacterium kansasii was the causative organism in 4 patients and m. scrofulaceum in 1 patient. the species were repeatedly isolated from sputum specimens cultured on löwenstein-jensen medium. the clinical features, mycobacterial isolations, bacteriological properties of the pathogens and the therapeutic problems encountered are discussed. | 1977 | 877805 |
pleuropulmonary manifestations of ankylosing spondylitis. | in published reports, the incidence of pleuropulmonary involvement in ankylosing spondylitis varies from 0 to 30%. a review of the records of 2,080 patients with ankylosing spondylitis disclosed 28 who had pleuropulmonary manifestations that we believe are typical of those associated with ankylosing spondylitis (an incidence of 1.3%). among these 28 patients, the most common abnormality was upper lobe fibrobullous lesions. five had aspergillomas and two had infections-one caused by mycobacterium ... | 1977 | 909316 |
spleno-hepatic tuberculosis due to mycobacterium kansasii. | a case of tuberculosis of the spleen and liver is described. the organism involved was mycobacterium kansasii, one of the atypical mycobacteria. the lack of evidence in the literature of primary splenic or hepatic involvement by this organism suggests that it is rare. in this instance it complicated a case of myeloproliferative disease, megakaryocytic myelosis with extra-medullary haemopoiesis, and was not diagnosed until autopsy. | 1976 | 979821 |
disseminated mycobacterium kansasii infection complicating hairy cell leukemia. | mycobacterium kansasii was isolated from the spleen of a patient with ""hairy cell leukemia'' (hcl) who had caseating necrosis in the spleen and in the liver. the disseminated infection in this patient suggests a cellular immunity deficit. despite intensive investigations, the nature of the cell of origin in hcl remains unknown. | 1976 | 989541 |
growth and immunogenicity of photochromogenic strains of mycobacteria in the footpads of normal mice. | specific pathogen-free cd-1 mice were infected subcutaneously in the footpad with mycobacterium kansasii, three strains of m. marinum, and two strains of m. simiae-habana, and the growth of the organisms in the footpad, the draining popliteal lymph node, and the lung and spleen was followed quantitatively for up to 60 days. the ability of a footpad inoculum of m. marinum to spread to the lungs and spleen correlated with the ability of the organism to survive and multiple at 37 c in vitro culture ... | 1975 | 1123253 |
mycobacterium kansasii tendinitis and fasciitis. report of a case treated successfully with drug therapy alone. | | 1975 | 1141273 |
disseminated myycobacterium kansasii infection with pancytopenia and interstitial nephritis. | disseminated mycobacterium kansasii infection associated with pancytopenia was diagnosed in a 40-year-old man found to have granulomata in kidney and liver biopsy specimens. the m. kansasii was isolated from the urine and tissue obtained by renal biopsy. serial renal biopsies and renal tissue obtained at autopsy showed severe interstitial fibrosis which was thought to represent a tissue response to the m. kansasii infection. the periportal and parenchymal fibrosis found in the liver at autopsy w ... | 1975 | 1147441 |
medical grand rounds from touro infirmary. mycobacterium kansasii, aortic stenosis and antimicrobial related hepatitis. | | 1975 | 1151130 |
mycobacteriosis in patients with malignant disease. | mycobacteriosis was found in 59 patients with malignant disease in a five-year period from 1968 to 1973. thirty patients (51%) had mycobacteriosis that was caused by atypical mycobacteria. the most frequent organisms were mycobacterium kansasii and m fortuitum. the most frequent tumors associated with mycobacteriosis were squamous cell carcinoma of the head and neck, testicular carcinoma, and lung carcinoma. the only predisposing factor was treatment with cancer chemotherapy. mortality due to my ... | 1976 | 1247337 |
mycobacterium kansasii infection in the deep structures of the hand. report of two cases. | | 1976 | 1249105 |
ventilatory defects in atypical mycobacteriosis. a comparison study with tuberculosis. | two hundred thirty-two patients infected with mycobacterium kansasii and 120 patients infected with m. intracellulare who were admitted to the east texas chest hospital between 1965 and 1974 were individually matched according to age (+/- 5 years), sex, and extent of disease with an equal number of patients infected with m. tuberculosis. the ventilatory function in these patients was compared. the frequency of obstructive ventilatory defect, defined as forced expiratory volume in 1 sec less than ... | 1976 | 1259236 |
mycobacterium kansasii from an environmental source. | | 1976 | 1260624 |
identification of a genetically distinct subspecies of mycobacterium kansasii. | to assess the usefulness of a specific dna probe for mycobacterium kansasii, 105 isolates from australia, belgium, japan, south africa, and switzerland were collected and analyzed. twenty of these isolates were probe negative, of which 18 were from belgium and switzerland. analysis of all isolates by southern blot hybridization indicated a lack of variability among probe-positive isolates, while probe-negative isolates were clearly distinct and showed greater diversity. sequence analysis of the ... | 1992 | 1280644 |
effects of in vivo t lymphocyte subset depletion on mycobacterial infections in mice. | the relative importance of cd4+ and cd8+ t cell subsets in the expression of acquired resistance to systemic infection by mycobacterium kansasii was determined. t cell subsets were depleted in thymectomized c57bl/6 mice by the intravenous administration of monoclonal antibodies directed against the relevant t cell determinants. depletion of the cd4+ subset exacerbated the severity of the infection in intravenously challenged mice. this effect was apparent in the first 2 weeks of the infection an ... | 1992 | 1347311 |
typing by dna probe of mycobacterial species isolated from patients with aids. | restriction fragment length polymorphism (rflp) types of mycobacterium avium intracellulare and mycobacterium kansasii isolated from patients with aids were examined. we demonstrate that one rflp type is much more common than others which confirms previous findings. carriage of individual rflp types is constant over long periods of time. in addition, we document a disseminated infection in a patient with m. avium intracellulare of three rflp types. | 1992 | 1361938 |
bacteriostatic and bactericidal activity of antituberculosis drugs against mycobacterium tuberculosis, mycobacterium avium-mycobacterium intracellulare complex and mycobacterium kansasii in different growth phases. | bacteriostatic and bactericidal activities of rifampicin, isoniazid, streptomycin, enviomycin and ethambutol against mycobacterium tuberculosis, mycobacterium avium--m. intracellulare complex and mycobacterium kansasii were studied in different growth phases. bacteriostatic activities of the drugs were similar in different growth phases, except isoniazid. m. tuberculosis was much less susceptible to isoniazid in the lag phase than in the log and the stationary phases. in contrast, bactericidal a ... | 1992 | 1406364 |
activities of clarithromycin against eight slowly growing species of nontuberculous mycobacteria, determined by using a broth microdilution mic system. | mics of clarithromycin against 324 clinical isolates belonging to eight species of slowly growing nontuberculous mycobacteria were determined by using a broth microdilution system. isolates were inoculated into twofold drug dilutions in middlebrook 7h9 broth (ph corrected to 7.4) and then incubated at 30 degrees c for 7 days for mycobacterium marinum and for 14 days for all other species. the mic for 90% of the strains (mic90) was less than or equal to 0.5 micrograms/ml for isolates of mycobacte ... | 1992 | 1416891 |
in vitro susceptibility of mycobacterium kansasii to clarithromycin. | the mics of the macrolide clarithromycin for 31 clinical isolates of mycobacterium kansasii were determined by three different methods. the methods employed were the proportion resistance method on 7h10 agar, the radiometric (bactec) method, and the t100 method of datum analysis. all methods gave similar results. the mics were in a narrow range from 0.16 to 0.50 microgram/ml, with the mics for 90% of isolates tested of 0.50 microgram/ml for the agar dilution and radiometric methods and 0.37 micr ... | 1992 | 1416897 |
mycobacterium kansasii osteitis of the ischium. | | 1992 | 1417152 |
mycobacterium kansasii infection following primary pulmonary malignancy. | the purpose of this study was to determine whether any of the mycobacterium kansasii cases were the consequences of primary lung malignancy. the records and chest x-ray films of 295 patients with m kansasii pulmonary infection were reviewed. the infection was found to complicate the primary lung neoplasm in four cases. three patients had had treatment for malignancy: one patient with small cell carcinoma received chemotherapy, steroids and radiation; one with adenocarcinoma underwent a lobectomy ... | 1992 | 1424867 |
[disseminated infection caused by mycobacterium kansasii in acquired immunodeficiency syndrome]. | | 1992 | 1450270 |
evaluation of new anti-infective drugs for the treatment of disease caused by mycobacterium kansasii and other mycobacteria. infectious diseases society of america and the food and drug administration. | mycobacterium kansasii is a photochromogenic nontuberculous mycobacterium that usually causes infections of the respiratory tract in humans. although spontaneous resolution of infection has been reported, most patients require antimycobacterial therapy. a three- or four-drug combination--isoniazid, rifampin, and ethambutol and/or streptomycin--usually is prescribed. for evaluation of a new drug, a randomized, double-blind or evaluator-blinded, active-control comparative study design is recommend ... | 1992 | 1477246 |
disseminated coinfection with mycobacterium avium complex and mycobacterium kansasii in a patient with aids and liver abscess. | | 1992 | 1554855 |
antimycobacterial activity of a series of pyrazinoic acid esters. | a series of pyrazinoic acid esters has been prepared and evaluated for in vitro antimycobacterial activity. several of the pyrazinoate esters have substantially better activity than the first-line antituberculous agent pyrazinamide against susceptible isolates of mycobacterium turberculosis as well as activity against pyrazinamide-resistant isolates. the minimal inhibitory concentrations (mics) were lower for each organism and at each ph than the mics for pyrazinamide. the esters have activity a ... | 1992 | 1560435 |
mycobacterium kansasii brain abscess in a patient with aids. | | 1992 | 1562675 |
niacin-positive mycobacterium kansasii isolated from immunocompromised patients. | niacin-positive mycobacterium kansasii was isolated from three patients, two with respiratory infections and one with a perirectal abscess. the isolates were phenotypically similar to other strains of m. kansasii, differing only in their ability to produce niacin. this phenotype has been reported only twice in the literature, during the 1960s. | 1992 | 1583146 |
modulation of expression of delayed hypersensitivity by mycobacterial antigen 85 fibronectin-binding proteins. | although demonstration of delayed hypersensitivity to purified protein derivative of tuberculin (ppd) is an important element in the diagnosis of infection with mycobacterium tuberculosis, many patients with tuberculosis are anergic. several possible mechanisms for this specific lack of response have been described. we have now uncovered an additional one. t-cell fibronectin (fn), a lymphokine secreted by activated t cells, is closely associated with the initiation of delayed hypersensitivity re ... | 1992 | 1534074 |
[investigation of the cases due to mycobacterium kansasii in our hospital]. | a clinical study of 23 patients with mycobacterium kansasii infection of the lung encountered at national chiba higashi hospital from 1988 to 1990 was carried out. all 23 cases were male, aged from 25 to 81 years-old. diagnoses were confirmed by sputum culture. the cases consisted of 15 primary infections and 8 secondary infections. out of the 23 cases, 11 were detected by mass screening with chest x-ray findings, 10 cases were discovered when visiting the hospital because of chest complications ... | 1992 | 1597935 |
usefulness of skin testing with mycobacterial antigens in children with cervical lymphadenopathy. | one hundred twenty-three children with chronic cervical lymphadenopathy were skin-tested with purified protein derivative (ppd)-b (mycobacterium intracellulare), ppd-y (mycobacterium kansasii), ppd-g (mycobacterium scrofulaceum) (nontuberculous mycobacterial antigens (ntmags)) and ppd-t (mycobacterium tuberculosis). children with culture-confirmed mycobacterial disease had significantly larger reactions to ntmags and were 6 times more likely to have ppd-b responses of greater than or equal to 10 ... | 1992 | 1608681 |
mycobacterial diseases other than tuberculosis. | the incidence of tuberculosis in the united states declined steadily until 1985, while at the same time, for at least the past 15 years, the frequency of disease attributable to other mycobacteria increased both in actual numbers and in the proportion of the total burden of mycobacterioses. chronic pulmonary disease, lymphadenitis in children, skin and soft-tissue involvement, and infections of the skeletal system were predominant, and the principal etiologic agents were mycobacterium avium/myco ... | 1992 | 1617048 |
mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids. | between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ... | 1992 | 1617056 |
mycobacterium kansasii presenting as an unusual type of rhinophyma. | | 1992 | 1470459 |
pyogenic abscess caused by mycobacterium kansasii in advanced aids. | | 1992 | 1391065 |
characterization of a major polymorphic tandem repeat in mycobacterium tuberculosis and its potential use in the epidemiology of mycobacterium kansasii and mycobacterium gordonae. | in this study, the occurrence of repeated dna sequences in the chromosome of mycobacterium tuberculosis was investigated systematically. by screening a m. tuberculosis lambda gt-11 gene library with labeled total chromosomal dna, five strongly hybridizing recombinants were selected, and these contained dna sequences that were present in multiple copies in the chromosome of m. tuberculosis. these recombinants all contained repeated sequences belonging to a single family of repetitive dna, which s ... | 1992 | 1350781 |
mycobacterium kansasii infection with dermatologic manifestations. | a patient with cutaneous lesions as a manifestation of systemic infection with mycobacterium kansasii is described. to our knowledge, this is the fourth reported case of a patient with dermatologic lesions secondary to m kansasii infection. a brief review of the classification and clinical presentations of atypical mycobacteria is given. | 1976 | 1275527 |
response to chemotherapy of pulmonary infection due to mycobacterium kansasii. | chemotherapy of pulmonary disease due to mycobacterium kansaii has not always been successful, and resectional surgery has been used frequently in the treatment of this infection. to ascertain the impact of new antimicrobial agents on the treatment of m. kansaii infection, we reviewed the clinical courses of 59 patients treated between 1971 and 1974. over-all, 92 per cent of patients converted their sputum cultures while receiving drugs, with only one patient undergoing surgical resection. regim ... | 1975 | 1147382 |
disseminated mycobacterium kansasii infection presenting as cellulitis in a recipient of a renal homograft. | a recipient of a renal homograft developed disseminated infection caused by mycobacterium kansaii. he initially presented with cellulitis and abscesses in one foot, and was thought to have a pyogenic bacterial infection. the daily administration of prednisone and azathioprine appears to have prevented the typical cell-mediated granulomatous reaction to mycobacterial infection and to have contributed to the patient's atypical inflammatory response. a switch to alternate-day prednisone combined wi ... | 1975 | 1096693 |
response to chemotherapy of pulmonary infection due to mycobacterium kansasii. | | 1976 | 1030296 |
acquired resistance to rifampicin by mycobacterium kansasii. | two patients with mycobacterium kansasii infection of the lung had organisms sensitive to rifampicin. following treatment, essentially with rifampicin alone, the patients began to excrete organisms completely resistant to rifampicin. the ability of m. kansasii to acquire resistance to rifampicin during treatment has been clearly demonstrated. this reinforces the need to treat this infection with an adequate multiple drug regimen. | 1976 | 1014109 |
pulmonary tuberculosis following successful treatment of pulmonary infection with mycobacterium kansasii. | a case of pulmonary tuberculosis following successful treatment of pulmonary infection with mycobacterium kansasii is presented. the immunizing effect of an infection with m kansasii and and other nonspecific immune factors are discussed. | 1976 | 1001062 |
temperature relationships in mycobacterium kansasii: correlation between heat inactivation of protein synthesis and thermal death. | the temperature relationships of mycobacterium kansasii were investigated. the optimal temperature of growth of these bacteria was between 37 and 38 degrees c, and their thermal death point was about 70 degrees. the temperature characteristic of growth of m. kansasii was about 23,400 cal.mole-1. experiments on the effect of temperature on protein synthesis showed that the temperature and time relationships required to complete and irreversibly inactivate protein synthesis correlated with thermal ... | 1976 | 952439 |
mycobacterium kansasii infection. | | 1991 | 1872499 |
mycobacterium kansasii arthritis of the knee joint. | mycobacterium kansasii infection of the knee joint was diagnosed in an 11-year-old boy on the basis of skin testing to atypical mycobacteria, and a positive culture from a synovial tissur biopsy. appropriate antituberculose drugs shoud be institute as sole treatment if no bony destruction is present. ifthere is no response to chemtherapy, synovectomy should be performed. | 1977 | 855843 |
cutaneous histoplasma capsulatum in a nonimmunocompromised patient with previously treated cutaneous mycobacterium kansasii. | this report describes a black woman with a history of cutaneous mycobacterium kansasii responsive to antituberculous drugs. a culture several years later of cutaneous lesions was also positive for histoplasma capsulatum. both cutaneous diseases are rare and most often occur in immunocompromised hosts. there is no known association between these two diseases. this patient may have an as-yet unidentified immunodeficiency that predisposes her to these rare infections. her case emphasizes the import ... | 1991 | 1894784 |
enzyme-linked immunosorbent assay using monoclonal antibodies for identification of mycobacteria from early cultures. | a simple enzyme-linked immunosorbent assay (elisa) for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii has been developed (r. schöningh, c. p. h. j. verstijnen, s. kuijper, and a. h. j. kolk. j. clin. microbiol. 28:708-713, 1990). the test for the routine identification of cultured mycobacteria was introduced in five clinical laboratories located in tanzania, thailand, vietnam, and the ne ... | 1991 | 1909344 |
a co-operative numerical analysis of mycobacterium gastri, mycobacterium kansasii and mycobacterium marinum. | a co-operative taxonomic study has been performed on slowly growing photochromogenic mycobacteria (runyon group i) and closely related organisms. phenetic data on 54 strains, studied in seven laboratories, were collected and analysed by numerical taxonomic methods. immunological properties and phage susceptibility patterns were analysed independently to establish correlation with numerical classification. mycobacterium gastri, m. kansasii and m. marinum appeared as distinct well-defined clusters ... | 1978 | 745004 |
[studies on the nontuberculous lung mycobacteriosis in japan. (report of the study in the year 1987 and 1988 of the mycobacteriosis research group of the japanese national chest hospitals)--pulmonary infection caused by mycobacterium kansasii has begun to appear in all over japan including north japan hokkaido]. | in this study, the mycobacteriosis research group of the japanese national chest hospitals (mrg) presents the reports of study years 1987 and 1988. as reported previously**, pulmonary infection caused by mycobacterium kansasii occurred principally in south-west japan (prefectures south-west of tokyo) and did not appear in north japan. however, this disease appeared in 1987 and 1988 in hokkaido (sapporo hospital). accordingly, we may say the disease occurs all over japan. this is a noteworthy fin ... | 1991 | 1960913 |
lymphatic tissues of nude mice during early stages of mycobacterium kansasii infection. | | 1978 | 729872 |
the spectrum of mycobacterium kansasii disease associated with hiv-1 infected patients. | louisiana is known to be an area endemic for mycobacterium kansasii (mk). since mk tends to disseminate in immunocompromised patients, one might, therefore, expect to observe an increasing number of mk infections associated with human immunodeficiency virus (hiv-1). a systematic 60-month review of clinical, microbiologic, and radiographic data associated with mk was performed from two major referral centers in new orleans. from june 30, 1983 through june 30, 1988, mk was isolated from 72 patient ... | 1991 | 2016689 |
combined vs. single-drug studies of susceptibilities of mycobacterium kansasii to isoniazid, streptomycin, and ethambutol. | the effects of combined drugs were compared uith the effects of single drugs in vitro against mycobacterium kansasii. the single drugs isoniazid 1.0 microgram/ml, streptomycin 2.0 microgram/ml, and ethambutol 5.0 microgram/ml and the combinations of 1.0 microgram/ml isoniazid and 2.0 microgram/ml streptomycin, 1.0 microgram/ml isoniazid and 5.0 ethambutal and 1.0 microgram/ml isoniazid, 2.0 microgram/ml streptomycin and 5.0 microgram/ml ethambutol were evaluated as to their effects on m. kansasi ... | 1978 | 717288 |
[the stratified tuberculoma caused by mycobacterium kansasii with cavitation (author's transl)]. | report on a 39 years old female textile worker with an acute cavity. m. kansasii was repeatedly isolated by cultivation from the sputum. the patient became negative by treatment with inh, sm, pas, ethionamide, but the cavity persisted. therefore seven months after the onset of the disease the left upper lobe was resected. a colliquative stratified tuberculoma and some lesions of caseated bronchitis and peribronchitis were found in the neigh bourhood. clusters and microcolonies of m. kansasii cou ... | 1977 | 613551 |
polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
quantitative and qualitative studies on the major extracellular antigen of mycobacterium tuberculosis h37rv and mycobacterium bovis bcg. | the mycobacterium tuberculosis antigen 85 is a biologically important antigen. tuberculosis patients may have strong antibodies against it, and their peripheral blood mononuclear cells respond to it with gamma-interferon production and lymphocyte proliferation. antigen 85 is actively secreted into the culture medium during culture in vitro and is known to bind human fibronectin. a double-antibody enzyme-linked immunosorbent assay (elisa) for quantification of antigen 85 is described. a mouse mon ... | 1990 | 2109556 |
enzyme immunoassay for identification of heat-killed mycobacteria belonging to the mycobacterium tuberculosis and mycobacterium avium complexes and derived from early cultures. | a simple enzyme-linked immunosorbent assay was developed for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii. six monoclonal antibodies were used: two (f23-49 and f24-2) were specific for the m. tuberculosis complex, two (f85-2 and f85-10) were specific for the identification of the m. avium complex, one (f126-22) was specific for m. kansasii, and one (f141-3) was broadly reactive and dis ... | 1990 | 2110180 |
t-cellular immune reactions (in macrophage inhibition factor assay) against mycobacterium paratuberculosis, mycobacterium kansasii, mycobacterium tuberculosis, mycobacterium avium in patients with chronic inflammatory bowel disease. | a mycobacterial aetiology has been suggested for crohn's disease. a slow growing mycobacterium, biochemically and genetically identical to m paratuberculosis, the causative agent of enteritis in ruminants (johne's disease), has been isolated from gut specimens of patients affected by crohn's disease. if m paratuberculosis or other mycobacteria play a role in the pathogenesis of crohn's disease, then patients may have been sensitised to these mycobacteria or show an anergy immune reaction. we the ... | 1990 | 2112502 |
the mycobacteriology of pulmonary tuberculosis in south african gold miners. | two bacteriological surveys of gold miners with pulmonary tuberculosis diagnosed for the first time, have shown a stable level of primary drug resistance which is substantially lower than that reported for the home areas of these men. initial drug resistance was detected in 12.7% of the 205 cultures of mycobacterium tuberculosis in 1983-1984 and in 10.7% of 253 cultures in 1988-1989. resistance to isoniazid was detected in 5.4% and 5.5% of the strains tested, to streptomycin in 6.8% and 5.1% and ... | 1990 | 2115216 |
granulomatous prostatitis. association with isolation of mycobacterium kansasii and mycobacterium fortuitum. | | 1977 | 576944 |
skin sensitivity of adults on the isthmus of panama to mycobacterium xenopi sensitin. | a group of 106 adult panamanian men were skin tested with a standard human tuberculin (rt 23) and three sensitins prepared from atypical mycobacteria. two of the sensitins (prepared from mycobacterium kansasii and battey organism) are commonly used to detect atypical mycobacterial infections. the third (prepared from m. xenopi) had not been used in panama previously. skin sensitivity proved to be significantly higher to the m. xenopi sensitin than to the others. the known epidemiology of m. xeno ... | 1979 | 434302 |
mycobacterium kansasii infection in the wrist and hand. | mycobacterium kansasii infection of the deep structures of the wrist and hand can cause progressive damage which may eventually lead to permanent loss of hand function. this report describes three cases followed by a review of the literature. the important principles of management in this unusual infection are discussed. | 1990 | 2182172 |
[sensivity of mycobacterium kansaii and mycobacterium marinum to different antituberculous drugs (author's transl)]. | mycobacteriosis includes clinical manifestations caused by especies of the genus mycobacterium other than m. tuberculosis and m. bovis. therapy for these conditions has not been clearly sistematized as it has for tuberculosis, particularly because of the natural resistance that the etiologic agents present to a large number of antituberculous drugs. the sensitivity of m. kansasii and m. marinum to eleven tuberculostatic agents was studied in order to determine which one were best suited for trea ... | 1979 | 431178 |
subclinical infection with mycobacteria in southern iran. | in 50 non-tuberculous adult patients hospitalized in the pahlavi university medical center skin testing with 5 tuberculin units of purified protein derivative of mammalian mycobacterium tuberculosis (ppd-m) and equivalent amounts of antigen from mycobacterium kansasii (ppd-y) and mycobacterium gause (ppd-g), as well as 0.1 ml mumps antigen was carried out. thirty four per cent, 26 per cent and 12 per cent of the patients had induration greater than 10 mm in diameter to ppd-m, ppd-y and ppd-g res ... | 1977 | 412163 |
lysogeny associated with mucoid variation in mycobacterium kansasii. | ten of 200 strains of mycobacterium kansasii were found to produce very mucoid growth on löwenstein-jensen medium. by electronmicroscopy these 10 strains were found to be lysogenic, whereas no phage was observed in cultures of 30 non-mucoid strains. the cultural and biochemical properties of the lysogenic strains are compared with those of non-lysogenic strains, and the morphology of the phages is described. | 1978 | 401434 |
[hemolytic activity of mycobacterium kansasii]. | mycobacterium kansasii has a strong virulence as compared with those of "mycobacteria other than tubercle bacilli". in this study, hemolytic activities of several strains of m. kansasii were investigated. secretion of hemolytic factor from these strains was not observed, since no hemolytic zone was found around the colonies grown on the 7h11 agar plate when 5% rabbit blood agar was overlayed. on the other hand, weak hemolytic activities were detected after treatment of sonication and trypsin-dig ... | 1990 | 2214512 |
skin reactivity to atypical mycobacteria in cystic fibrosis. | atypical mycobacterial disease has been described in a small number of patients with cystic fibrosis. apart from one uncontrolled study, there is little information regarding atypical mycobacterial skin reactivity in this group of patients. we evaluated delayed cutaneous hypersensitivity to purified extracts of mycobacterium avium, mycobacterium intracellular, mycobacterium kansasii and mycobacterium bovis in 23 healthy controls and 43 adult and adolescent patients with cystic fibrosis. fifteen ... | 1990 | 2236753 |
pulmonary and disseminated infection due to mycobacterium kansasii: a decade of experience. | fifty-five patients with mycobacterium kansasii isolates (47 pulmonary and eight disseminated) were identified at a large texas hospital from 1975 to 1985. the mean age of patients was 60 years, and there was a slight male predominance. isolation of m. kansasii usually represented disease. the great majority of patients with pulmonary infection due to m. kansasii had underlying pulmonary diseases, and 70% had nonpulmonary predisposing factors. m. kansasii pulmonary disease clinically and radiogr ... | 1990 | 2237115 |
susceptibility of mycobacterium kansasii to ethambutol and its combination with rifamycins, ciprofloxacin and isoniazid. | the susceptibility of mycobacterium kansasii to antibacterial agents alone and in combination was studied. widespread resistance to ethambutol, ciprofloxacin and isoniazid was found when these drugs were tested separately. however, pronounced antibacterial effects were seen when ethambutol was tested in combination with ciprofloxacin, rifampicin or rifabutin, which corresponded to significantly decreased resistance to these drugs in combination. | 1992 | 1563386 |
atypical mycobacterial infections. | atypical mycobacterial infections play an important role in human pathogenicity. mycobacterium avium complex has been reported to occur in 17% to 50% of individuals infected with human immunodeficiency virus. in the southwestern united states, mycobacterium kansasii is reported to be a predominate mycobacterial infection in middle-aged men. the epidemiology of the pathological species is discussed along with current recommendations for chemotherapeutic regimens. | 1990 | 2262742 |
[bactericidal activity of ofloxacin against mycobacterium kansasii]. | bactericidal activity of ofloxacin against mycobacterium kansasii was observed in in-vitro experiment. tested bacteria were suspended to a concentration of one mg wet weight per ml in 10 ml of dubos liquid medium containing no drug or containing 1 or 3 micrograms/ml ofloxacin and incubated at 37 degrees c. the number of colony-forming units contained in a 0.02 ml-sample of the dubos liquid medium was counted after incubation for 0, 1, 3 and 7 days. the number of colonies was counted in ogawa egg ... | 1990 | 2277465 |
peritonitis caused by mycobacterium kansasii in a patient undergoing continuous ambulatory peritoneal dialysis. | mycobacterium kansasii was isolated from the peritoneal fluid, peritoneal biopsy, and the tenckhoff catheter of a 62-year-old woman undergoing continuous ambulatory peritoneal dialysis (capd) who presented with the clinical picture of peritonitis. to the best of our knowledge, this is the first case of capd-associated peritonitis caused by m kansasii. routine susceptibility tests using standard concentrations of isoniazid indicated isoniazid resistance; however, the organism was inhibited in vit ... | 1992 | 1595710 |
cloning and expression of the gene for the cross-reactive alpha antigen of mycobacterium kansasii. | the gene for the extracellular alpha antigen of mycobacterium kansasii was cloned by using the alpha-antigen gene fragments of m. bovis bcg as probes. gene analysis revealed that this gene encodes 325 amino acid residues, including 40 amino acids for the signal peptide, followed by 285 amino acids for the mature protein. a comparison of the nucleotide sequences of the genes isolated from these two mycobacterial species showed that the levels of dna and amino acid homology were 84.8 and 89.1%, re ... | 1990 | 2404875 |
[mycobacterium kansasii seroma of the skin in hiv infection]. | we report on an hiv-infected patient with aids in whom a smoothly demarcated area of resistance in the size of a fist was found on the inside of the thigh. investigation by sonography for clinical differential diagnosis confirmed that a haematoma, a seroma or an abscess might be present. upon puncture of the cavity, serous exudate was obtained. the microbiological investigation resulted in the growth of mycobacterium kansasii. the detection of this agent in throat and sputum samples from the pat ... | 1992 | 1628969 |
selective enzyme staining procedures for characterization of mycobacterial immunoprecipitates. | selective staining procedures for four different enzymes (malate dehydrogenase, glutamic oxaloacetic transaminase, leucine aminopeptidase and glucose phosphate isomerase) in combination with two-dimensional immunoelectrophoresis were successfully applied to the analysis of antigen preparations from mycobacteria. thus, a precipitate corresponding to malate dehydrogenase could e.g. be demonstrated in multi-linear precipitation patterns of mycobacterium avium, mycobacterium bovis bcg, mycobacterium ... | 1986 | 2417958 |