current and investigational therapies for aids-associated mycobacterium avium complex disease. | the epidemiology, pathogenesis, clinical manifestations, and treatment of mycobacterium avium complex (mac) infection are reviewed. mac infection is one of the most common infections in aids patients. its pathogenesis is poorly understood, but it is believed to develop by gastrointestinal colonization followed by systemic invasion. the relatively poor response to treatment may be partly accounted for by the tremendous mycobacterial load present by the time patients develop systemic symptoms. cli ... | 1991 | 2032445 |
[phagocytic activity of leukocytes in animals infected with m. avium and m. scrofulaceum]. | the condition of phagocytic activity of peripheric blood neutrophils in the development of tuberculosis and experimental mycobacterioses caused by such "atypical" mycobacteria, as m. avium and m. scrofulaceum was studied. in all the infection processes analysed, undulating nature of the changes in a functional activity of phagocytosing neutrophils (including their absorbing and digestive capacity) was discovered. the pathology of phagocytosis found is equally characteristic of the groups of anim ... | 1991 | 2034626 |
specific antibody responses to mycobacterium bovis in infected cattle analysed with six mycobacterial antigens in enzyme-linked immunosorbent assays. | a total of 23 (15.3 per cent) of 150 cattle infected with mycobacterium bovis and which had never been tuberculin tested showed specific antibody responses to m bovis. their sera may be important keys to the identification of unique m bovis antigens for use in specific serodiagnostic tests. assessment of specific and non-specific responses was done by screening sera in six indirect anti-igg enzyme-linked immunosorbent assays using whole cell sonicates of m bovis and five members of the mycobacte ... | 1991 | 2034894 |
intramacrophage growth of mycobacterium avium during infection of mice. | growth of the virulent mycobacterium avium strain tmc 724 in host tissues during persistent infection of mice was studied. following intravenous infection of c57bl/6 mice, the kinetics of bacterial growth was biphasic in the spleen and liver, with a significant reduction of the multiplication rate after day 21 to 28 of infection. an electron-microscopic study of the liver and spleen of infected mice showed that the bacteria were strictly intracellular. they were observed within inflammatory macr ... | 1991 | 2037382 |
gen-probe rapid diagnostic system for the mycobacterium avium complex does not distinguish between mycobacterium avium and mycobacterium paratuberculosis. | three reference and 16 field strains of mycobacterium paratuberculosis were tested with the gen-probe mycobacterium avium complex dna probe (gen-probe inc., san diego, calif.). all reference strains and 12 of 16 field strains gave positive hybridization results with the probe. this study shows that the m. avium complex probe does not distinguish between m. avium and m. paratuberculosis and indicates heterogeneity in the 16s rrna gene of m. paratuberculosis. | 1991 | 2037681 |
ethanol augments intracellular survival of mycobacterium avium complex and impairs macrophage responses to cytokines. | chronic ethanol ingestion predisposes to tuberculosis and bacterial pneumonia. mycobacterium avium complex (mac) organisms cause bacteremia in patients with aids. cultured human monocyte-derived macrophages and murine kupffer cells were exposed to 10-100 micrograms/dl ethanol; significantly greater intracellular growth of mac strains 100 (serovar 8) and 101 (serovar 1) occurred in ethanol-treated cells than in controls (range, 58% +/- 7%-70% +/- 5%; p less than .05 for 50 and 100 micrograms/dl e ... | 1991 | 2037794 |
mycobacterium avium infection and aids: a therapeutic dilemma in rapid evolution. | note from dr. merle a. sande--the role of mycobacterium avium as a pathogen in the human immunodeficiency virus-infected population has been confusing and controversial to clinicians who care for aids patients. the organism is commonly isolated from respiratory secretions of patients with other infections and often seems part of the resident flora; even when isolated from the bone marrow or bloodstream, its impact on the course of aids and contribution to systemic diseases are unknown. however, ... | 1991 | 2037799 |
mycobacterium avium complex pulmonary disease. incidence, presentation, and response to therapy in a community setting. | the experience with pulmonary disease caused by mycobacterium avium complex (mac-pd) was examined over a 12-yr period in a nonreferral setting. the 29 patients with the disease constituted 30% of all pleuropulmonary mycobacterioses. the mean annual incidence rate was 1/100,000. sixty-two percent of patients were female, the majority of whom had no discernible preexisting pulmonary disorder to account for their susceptibility. a short- and long-term favorable response to therapy was observed in m ... | 1991 | 2048826 |
production of granulocyte-macrophage colony-stimulating factor (gm-csf) by monocytes and large granular lymphocytes stimulated with mycobacterium avium-m. intracellulare: activation of bactericidal activity by gm-csf. | treatment of monocytes with recombinant granulocyte-macrophage colony-stimulating factor (gm-csf) was shown to enhance their antimycobacterial activity in an in vitro assay. furthermore, mycobacterium avium-m. intracellulare was found to induce the production of this hemopoietic growth factor. human peripheral blood mononuclear cells were fractionated by plastic adherence and percoll density centrifugation, and each population of cells was stimulated with mycobacteria. gm-csf was produced by bot ... | 1991 | 2050405 |
insertional mutagenesis and illegitimate recombination in mycobacteria. | mycobacteria, particularly mycobacterium tuberculosis, mycobacterium leprae, and mycobacterium avium, are major pathogens of man. although insertional mutagenesis has been an invaluable genetic tool for analyzing the mechanisms of microbial pathogenesis, it has not yet been possible to apply it to the mycobacteria. to overcome intrinsic difficulties in directly manipulating the genetics of slow-growing mycobacteria, including m. tuberculosis and bacille calmette-guérin (bcg) vaccine strains, we ... | 1991 | 2052623 |
suppurative tissue reaction in a patient with disseminated mycobacterium avium-intracellulare infection. | | 1991 | 2052982 |
[gastrointestinal manifestations of aids. 2: bacterial and vh parasitic infections, malignant tumors]. | bacterial infections of the gastrointestinal tract (gi tract) in patients with aids are characterized by bacteremia and persistence of the pathogen. infections with salmonella typhi murium are common. infections with atypical mycobacteria (mycobacterium avium intracellulare complex) mimic whipple's disease both clinically and histologically; at present no established therapy is available. among the parasitic diseases of the gi tract, cryptosporidial infection in aids patients, predominantly in t ... | 1991 | 2055581 |
prevalence of serum antibody to the type-specific glycopeptidolipid antigens of mycobacterium avium in human immunodeficiency virus-positive and -negative individuals. | an enzyme-linked immunosorbent assay was constructed by using as antigens the type-specific immunodominant glycopeptidolipids of selected serotypes of mycobacterium avium. this assay system was used to determine the prevalence of raised antibody levels to these antigens in groups of controls, human immunodeficiency (hiv)-negative and -positive homosexual men, and hiv-negative patients with active m. avium infections as a possible indicator of potential exposure and/or colonization by m. avium in ... | 1991 | 2056037 |
treatment of mycobacterium avium-intracellulare complex infection in beige mice with free and liposome-encapsulated streptomycin: role of liposome type and duration of treatment. | current treatments for mycobacterium avium-intracellulare complex (mac) infections are generally ineffective. thus, the potential of free or liposome-encapsulated streptomycin to treat acute mac infection was investigated in beige mice. free streptomycin administered intramuscularly 5 days a week (150 mg/kg) was effective in the liver, spleen, and lungs. at 4 weeks, liposome-encapsulated streptomycin, administered intravenously in weekly doses (15 mg/kg), reduced the colony-forming units in the ... | 1991 | 2056201 |
guidelines for the care of children and adolescents with hiv infection. approach to gastrointestinal manifestations in infants and children with hiv infection. | | 1991 | 2061756 |
[avian mycobacteriosis caused by strains not yet identifiable]. | this paper reports on a group of strains of mycobacterium avium-intracellulare recently isolated from various bird species. the strains in question could not be integrated into the known 28 serovars. the host spectrum includes birds of several avian orders. clinical, serological, pathoanatomical, and histopathological results are being discussed. during observations of the clinical course in some infected birds, it could be shown that the excretion of the agent could cease for several months. th ... | 1991 | 2063641 |
individualized therapy versus standard regimens in the treatment of mycobacterium avium infections. | | 1991 | 2064112 |
a plea for clinical trials to resolve the issue of optimal therapy in the treatment of mycobacterium avium infection. | | 1991 | 2064136 |
focal pulmonary lesions in patients with aids: percutaneous transthoracic needle biopsy. | the authors performed percutaneous transthoracic needle biopsy (ptnb) in 13 patients with acquired immunodeficiency syndrome (aids) and previously undiagnosed focal pulmonary lesions. findings with ptnb were diagnostic in 11 of 13 cases. complications included minimal hemoptysis in one case and small pneumothoraxes in two cases, one of which required chest tube drainage. the authors did not experience the high complication rate reported previously by some authors who used this diagnostic procedu ... | 1991 | 2068304 |
clofazimine: a review of its use in leprosy and mycobacterium avium complex infection. | this article reviews the chemistry, pharmacology, spectrum of activity, pharmacokinetics, clinical efficacy in leprosy and mycobacterium avium complex (mac) infection, adverse effects, drug interactions, and special considerations of clofazimine. the drug is active in vivo against m. leprae and in vitro against mac. in addition, it possesses antiinflammatory and immunosuppressive properties. clinical studies support the efficacy of clofazimine as a part of multidrug therapy in treating leprosy. ... | 1991 | 2068838 |
differential handling of bacterial antigens in macrophages infected with mycobacterium leprae as studied by immunogold labeling of ultrathin sections. | mycobacterium leprae were purified from the livers of experimentally infected armadillos, and the purity of the bacterial preparation was established by electron microscopy, immunoelectrophoresis of purified bacilli with rabbit serum raised against liver tissues from a noninfected armadillo, and gas chromatography. such purified and intact bacilli were fixed and embedded by a gelatin-lowicryl method for electron microscopy which preserved the mycobacterial antigens. ultrathin sections were label ... | 1991 | 2071985 |
action of 1-isonicotinyl-2-palmitoyl hydrazine against the mycobacterium avium complex and enhancement of its activity by m-fluorophenylalanine. | in the present work, we investigated whether resistance to isoniazid (inh) of organisms belonging to the mycobacterium avium complex was caused by the bacterial cell envelope, with the cell wall and the outer layer acting as an exclusion barrier. we observed that this exclusion barrier was most efficient in excluding the hydrophilic drug inh, as this drug could not penetrate a wall matrix formed of various polymethylated lipidic or amphipathic substances. two main strategies were proposed for ci ... | 1990 | 2073098 |
[a case of disseminated atypical mycobacteriosis with multiple bronchial polyps]. | a 55-year-old male was admitted with fever, productive cough and dyspnea for a month. chest x-ray revealed infiltration in the right lower lung field and right pleural effusion. cultures of sputum, bone marrow and peripheral blood disclosed mycobacterium avium-intracellulare complex. the specimens of the liver, gallbladder wall and mesenterium obtained on cholecystectomy revealed epithelioid granulomas. fifteen months after the admission, bronchoscopic finding showed a pedunculated polyp in the ... | 1990 | 2077210 |
[drug therapy of intractable mycobacterium infections]. | | 1990 | 2079590 |
disseminated mycobacterium avium complex infection. | | 1990 | 2083176 |
analysis of cellular fatty acids and proteins by capillary gas chromatography and sodium dodecyl sulphate polyacrylamide gel electrophoresis to differentiate mycobacterium avium, mycobacterium intracellulare and mycobacterium scrofulaceum (mais) complex species. | infections due to atypical mycobacteria have increased during the past 30 years. species of mycobacterium avium, mycobacterium intracellulare and mycobacterium scrofulaceum are among the most common non-tuberculous mycobacteria isolated from patients with aids or immunosuppressed. these three organisms are taxonomically closely related and identification, according to cultural characteristics and biochemical tests, is not always evident, so some of these related strains are grouped in a "mais" c ... | 1990 | 2084120 |
in vitro susceptibility of mycobacterium avium complex to the new fluoroquinolone sparfloxacin (ci-978; at-4140) and comparison with ciprofloxacin. | we tested the activity of the new fluoroquinolone sparfloxacin (ci-978; at 4140) against 30 strains of mycobacterium avium complex (mac) isolated from patients with acquired immune deficiency syndrome. mics of sparfloxacin (range, less than or equal to 0.06 to 4 micrograms/ml) were lower than mics of ciprofloxacin for all 30 strains, and mbcs for acid-fast bacteria were lower for 28 of the 30 strains. in synergism experiments using 10 strains of mac, fractional inhibitory concentration indices r ... | 1990 | 2088204 |
microtiter plate assay for selecting "macrophage virulent" strains of mycobacterium avium intracellulare mycobacteria in mouse pulmonary alveolar macrophages. | currently used macrophage-mycobacterial in vitro infection models require substantial numbers of macrophages. we developed a miniaturized version of such a model, using microtiter plates, which is comparable to standardly published methods, is reproducible, and requires fewer macrophages. in addition to its ease of handling and its economy in time, number of animals, and supplies, this method is preferable when limited numbers of macrophages are available. we have used this assay as a means of s ... | 1990 | 2090921 |
peripheral blood and bone marrow findings in patients with acquired immune deficiency syndrome. | in 4 years (1984-1987), 183 bone marrow examinations were performed on 155 human immunodeficiency virus (hiv) antibody positive patients. one hundred and fifty three had category iv aids. one-third of the marrows yielded specific information. this included opportunistic infection, in particular mycobacterium avium intracellulare complex (mai) (24%), malignancy (4%), consistent with itp (9%) and iron deficiency (1%). in the remaining two thirds of the bone marrows the most frequent non-specific a ... | 1990 | 2091004 |
gas chromatographic characterization of the relationship between some mycobacterium avium and mycobacterium paratuberculosis strains. | mycobacterium avium strain p-55 and m. avium strain dent differ from m. avium strain 16909-338 on the basis of their fatty acid spectra (c14:0, c18:0 and tuberculostearic [tbs] acids) studied by multivariate statistical analyses. strains p-55 and dent are closer to m. paratuberculosis strain 5889 than to m. avium strain 16909-338, a finding which is in harmony with earlier immunological observations. the recently isolated m. paratuberculosis strain 385 has proved different from m. paratuberculos ... | 1990 | 2099604 |
[biologic characteristics of mycobacterium strains isolated from cattle from herds with clinical paratuberculosis]. | in the period from 1983 to 1986, bacteriological examination for paratuberculosis was performed in 263 samples of lymph nodes, intestinal mucous membrane and excrements of cattle, kept on a farm where clinical paratuberculosis occurred. seventy-nine strains of mycobacteria were isolated during the culturing. on selective agar medium with mycobactin as the growth stimulator, 71 strains were isolated which had failed to grow on the conventional mycobacterium-culturing media. in the subculture, the ... | 1990 | 2100429 |
[mycobacterium avium-intracellulare infection of the skin in a patient with aids]. | | 1990 | 2103228 |
[the importance of the early diagnosis of the association of tuberculosis and human immunodeficiency virus infection]. | | 1990 | 2103823 |
bone marrow findings in hiv infection: a pathological study. | the histopathologic changes of bone marrow during infection with the human immunodeficiency virus type 1 (hiv-1) are described. bone marrow biopsies from 73 patients at different stages of hiv-1 infection were studied. indications for biopsy included peripheral blood abnormalities, suspicion of lymphoma, or search for specific pathogens. common histopathological features, suggestive of hiv-1 infection but nonpathognomonic were hypercellularity (67%), myelodysplasia (86.1%), plasmacytosis (98.6%) ... | 1990 | 2103865 |
a homogeneous population of lymphokine-activated killer (lak) cells is incapable of killing virus-, bacteria-, or parasite-infected macrophages. | previous reports have suggested a role for natural killer (nk) cells in directly lysing host cells infected with bacteria and other intracellular microorganisms. here, we determined the inability of a highly homogeneous population of lymphokine activated killer (lak) cells to kill macrophages infected with the following intracellular parasites: mycobacterium avium, listeria monocytogenes, legionella pneumophila, toxoplasma gondii, and trypanosoma cruzi. in parallel cytotoxicity assays, lak cells ... | 1990 | 2104576 |
use of gen-probe and bactec for rapid isolation and identification of mycobacteria. correlation of probe results with growth index. | gen-probe culture confirmation tests (gen-probe, san diego, ca) for mycobacterium tuberculosis complex and mycobacterium avium complex were performed on 276 mycobacterial isolates. all 138 m. tuberculosis complex isolates and 79 of 80 m. avium complex isolates were identified correctly. no falsely positive test results were obtained; 58 nontuberculous mycobacteria other than m. avium complex were negative by gen-probe. in a second phase of testing, gen-probe tests were performed using concentrat ... | 1990 | 2106779 |
route-related variation in immunogenicity of mycobacteria. | the route of immunization was observed to play a significant role in deciding the t-cell response to immunization with killed mycobacterial vaccines. slow-growing mycobacteria were found to be immunogenic by both the intraperitoneal (i.p.) and intradermal (i.d.) routes; rapid-growing mycobacteria were immunogenic by the i.d. route only. the nonresponder state following i.p. immunization with mycobacterium vaccae could be corrected by treatment of the mice with poly i:poly c or indomethacin prior ... | 1990 | 2108226 |
polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
quantitative and qualitative studies on the major extracellular antigen of mycobacterium tuberculosis h37rv and mycobacterium bovis bcg. | the mycobacterium tuberculosis antigen 85 is a biologically important antigen. tuberculosis patients may have strong antibodies against it, and their peripheral blood mononuclear cells respond to it with gamma-interferon production and lymphocyte proliferation. antigen 85 is actively secreted into the culture medium during culture in vitro and is known to bind human fibronectin. a double-antibody enzyme-linked immunosorbent assay (elisa) for quantification of antigen 85 is described. a mouse mon ... | 1990 | 2109556 |
antimycobacterial antibody levels in pleural fluid as reflection of passive diffusion from serum. | the objective of this study was the prospective evaluation of the relationship between serum and pleural fluid antibody levels to mycobacterial antigens and their role in the diagnosis of tuberculous pleuritis. the setting was a tertiary care medical center. thirteen patients with tuberculous pleuritis and 53 control subjects with pleural effusion (22 with carcinoma, 17 with cardiac failure, and 14 with empyema or parapneumonic effusion) were studied. the level of igg was measured by elisa. the ... | 1990 | 2110052 |
enzyme immunoassay for identification of heat-killed mycobacteria belonging to the mycobacterium tuberculosis and mycobacterium avium complexes and derived from early cultures. | a simple enzyme-linked immunosorbent assay was developed for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii. six monoclonal antibodies were used: two (f23-49 and f24-2) were specific for the m. tuberculosis complex, two (f85-2 and f85-10) were specific for the identification of the m. avium complex, one (f126-22) was specific for m. kansasii, and one (f141-3) was broadly reactive and dis ... | 1990 | 2110180 |
improved sectioning and ultrastructure of bacteria and animal cells embedded in lowicryl. | lowicryl k4m-embedded gram-positive and gram-negative bacteria have a tendency to separate between the cell surface and the resin. this often leads to distortion of bacteria and more especially of mycobacteria. we describe attempts made to overcome this technical problem. different assays were made on bacillus subtilis, escherichia coli, and mycobacterium avium: 1) modification of the bacterial surface by coating of bacteria with proteinic compounds; 2) treatment of bacteria with metallic salts ... | 1990 | 2110246 |
[species category of mycobacteria isolated from cattle and environmental objects]. | the results of testing the slaughtered cattle material and environment objects for the presence of mycobacteria are presented. during 1984-1988 with a stable excretion of pathogenic mycobacteria, the quantity of the isolated atypical mycobacteria tended to increase. in 1984 the atypical mycobacteria made up 24.1% of the cultures isolated from cattle (pathogenic ones being 75.9%); in 1985, 29.0%; in 1986, 31.4%; in 1987, 46.0% and in 1988, 55.8%. for the above period m. bovis amounted to an avera ... | 1990 | 2111912 |
[production and characteristics of monoclonal antibodies reacting with human-type m. tuberculosis]. | monoclonal antibodies to m. tuberculosis were produced by hybrid technology. they were described via enzyme immunoassay and immunoblotting. it was shown that these antibodies should be included into igg class. besides, they are oriented towards and antigen with a molecular weight of 20 kda, react with h37rv at a concentration of 12 ng/ml and with bcg at a concentration of 50 micrograms/ml and fail to react with m. intracellulare, m. scrofulaceum and e. coli. | 1990 | 2111913 |
killing intracellular mycobacteria in in vitro macrophage systems: what may be the role of known host microbicidal mechanisms? | | 1990 | 2111923 |
intracellular killing of mycobacteria. | | 1990 | 2111924 |
sources of variability in assays of the interaction of mycobacteria with mononuclear phagocytes: of mice and men. | | 1990 | 2111925 |
susceptibility of mycobacteria to fusidic acid. | fusidic acid was shown to be effective in vitro against 30 clinical isolates of mycobacterium tuberculosis at concentrations of 32-64 mg/l, concentrations which are readily achieved in serum. all but one of 17 mycobacterium avium complex strains were resistant to fusidic acid at concentrations up to 64 mg/l. however, synergistic effects were shown for 11 of the 17 strains when fusidic acid was combined with ethambutol. five of the strains were fully susceptible to the combination of fusidic acid ... | 1990 | 2112466 |
t-cellular immune reactions (in macrophage inhibition factor assay) against mycobacterium paratuberculosis, mycobacterium kansasii, mycobacterium tuberculosis, mycobacterium avium in patients with chronic inflammatory bowel disease. | a mycobacterial aetiology has been suggested for crohn's disease. a slow growing mycobacterium, biochemically and genetically identical to m paratuberculosis, the causative agent of enteritis in ruminants (johne's disease), has been isolated from gut specimens of patients affected by crohn's disease. if m paratuberculosis or other mycobacteria play a role in the pathogenesis of crohn's disease, then patients may have been sensitised to these mycobacteria or show an anergy immune reaction. we the ... | 1990 | 2112502 |
recombinant granulocyte-macrophage colony-stimulating factor activates human macrophages to inhibit growth or kill mycobacterium avium complex. | organisms belonging to the mycobacterium avium complex (mac) are associated with life-threatening bacteremia in patients with the acquired immunodeficiency syndrome (aids). as these organisms survive within macrophages, we examined the ability of recombinant human granulocyte-monocyte colony-stimulating factor (gm-csf) to activate human monocyte-derived macrophages to inhibit the intracellular growth or kill the most mouse-virulent mac strain in our collection that belongs to serotype 1. while u ... | 1990 | 2113563 |
the recovery of mycobacterium avium complex and mycobacterium tuberculosis from blood specimens of aids patients using the nonradiometric bactec nr 660 medium. | the ability of the nonradiometric bactec nr 660 aerobic 6a blood culture medium to support mycobacterial growth was investigated. during a 19-month period blood cultures from 140 aids patients were sent to the microbiology laboratory. after the cultures were incubated for seven days, aliquots of medium from the vials were centrifuged, sediments examined microscopically for mycobacteria, and cultured to mycobacterial media. seventy-one aids patients (51%) had at least one blood culture positive f ... | 1990 | 2113765 |
mics and mbcs of win 57273 against mycobacterium avium and m. tuberculosis. | a new quinolone, win 57273 [1-cyclopropyl-7-(2,6-dimethyl-4-pyridinyl)-6-fluoro-1,4-dihydro-4-oxo-3 - quinolonecarboxylic acid], synthesized by sterling research group, was tested in vitro against mycobacterium tuberculosis and mycobacterium avium strains. the broth-determined mics of this agent ranged from 1.0 to 4.0 micrograms/ml for m. tuberculosis strains and from 0.25 to 8.0 micrograms/ml for m. avium strains. a distinctive feature of this agent, in comparison with ofloxacin and ciprofloxac ... | 1990 | 2113793 |
[differentiation of m. tuberculosis and m. avium complex using various monoclonal antibodies]. | m. avium-complex (mac) is the cause of the most bacterial infections in aids patients. because of the high resistance of mac, a rapid differentiation between m. tuberculosis and mac is of great interest. in an enzyme-linked immunosorbent assay (elisa) we tested three monoclonal antibodies bs 103, bs 104, bs 113 and the combination of bs 103/bs 113, which bind selectively to the cell wall of m. tuberculosis. 98 mac isolates from aids patients and 233 m. tuberculosis isolates from patients with lu ... | 1990 | 2114629 |
[clinical aspects and pathology of mycobacterial infections in aids. pulmonary and extrapulmonary manifestations]. | infections with m. tuberculosis and other mycobacteria (atypical mycobacteria) are frequently found in patients with aids. they are almost always disseminated, and are associated with a spectrum of findings that is often unhelpful for the diagnosis. in the case of tuberculosis, typical granulomas are a major finding. the histological correlate of mycobacteriosis is histiocytosis; granulomas are rarely observed, and when they do present, are incompletely developed. | 1990 | 2114635 |
[resistance testing of m. avium-intracellulare and m. tuberculosis of aids patients with new drugs and drug combinations]. | the minimal inhibitory concentration (mic) of rifabutin for m. tuberculosis was 0.006 to 0.06 micrograms/ml, and 0.12 to 0.25 micrograms/l for clofazimine. accordingly, m. tuberculosis is inhibited by concentrations of these two medications that are far lower than the levels normally found in the serum. in the case of m. avium, the mic of the new drugs such as rifabutin and clofazimine are, in contrast to the mics for m. tuberculosis, merely of the order of the achievable serum concentrations. t ... | 1990 | 2114636 |
the role of macrophage activation and of bcg-encoded macrophage function(s) in the control of mycobacterium avium infection in mice. | following the intraperitoneal inoculation of 2.5 x 10(8) colony-forming units of mycobacterium avium strain atcc 25291, there was bacillary growth in the liver, spleen and peritoneal cavity of c57bl/6, c57bl/10, dba/1 and balb/c mice whereas dba/2, c3h/he, cba/ca and cd-1 mice controlled the infection showing constant or slightly decreasing numbers of viable bacteria in the liver and spleen and effective clearance of the bacilli from the peritoneal cavities. the acquisition of non-specific resis ... | 1990 | 2115416 |
passive transfer of immunity of mycobacterium avium in susceptible and resistant strains of mice. | naturally susceptible mice (c57bl/6) infected with m. avium (strain weybridge) developed a population of splenic t cells which, on transfer to syngeneic recipient mice, conferred significant protection against a subsequent challenge inoculum of m. avium. similar t cells from naturally resistant mice (a/j) did not protect syngeneic recipient mice. growth of m. avium in donor mice only occurred in the c57bl/6 strain. replication of m. avium in donor mice was necessary for the development of protec ... | 1990 | 2116245 |
co-infection of macrophages modulates interferon gamma and tumor necrosis factor-induced activation against intracellular pathogens. | co-infection of macrophages (m phi) with toxoplasma gondii and mycobacterium avium-intracellulare complex (mac) has been observed in patients with acquired immunodeficiency syndrome (aids). in this study we have demonstrated that co-infected murine m phi respond differently to cytokine stimulation than m phi infected with either of the microorganisms alone. whereas treatment with interferon gamma (ifn-gamma) activated both single and co-infected groups of m phi to kill t. gondii, treatment with ... | 1990 | 2117640 |
isolation of mycobacterium tuberculosis and m. avium complex from the same skin lesions in aids. | | 1990 | 2118595 |
isolation and characterization of an environmental acid-fast organism producing diphenoloxidase activity in vivo. | water and soil samples were collected from natural habitats of the nine-banded armadillo and tested for the presence of acid-fast organisms by injection into the foot pads of experimental mice. sixteen months post inoculation an acid-fast organism was isolated from the foot pad and spleen of one of the mice. the isolate exhibited diphenoloxidase activity as determined by its ability to convert d-3,4-dihydroxyphenylalanine to the corresponding quinone. the same organisms grown in vitro lacked det ... | 1990 | 2118868 |
a comparative study on the activation of j-774 macrophage-like cells by gamma-interferon, 1,25-dihydroxyvitamin d3 and lipopeptide rp-56142: ability to kill intracellularly multiplying mycobacterium tuberculosis and mycobacterium avium. | the j-774 macrophage-like cell line has been established as a model for intracellular multiplication of pathogenic mycobacteria, permitting assessment of the intracellular bactericidal action of the macrophages after addition of both the drugs and immunomodulators. in this study, the action of immunomodulators was investigated. significant morphological changes were demonstrated under the optical and scanning electron microscope (sem), and the degree of macrophage activation was also measured by ... | 1990 | 2119591 |
recombinant tumour necrosis factor-alpha decreases whereas recombinant interleukin-6 increases growth of a virulent strain of mycobacterium avium in human macrophages. | the ability of a virulent strain of mycobacterium avium to infect and replicate within human monocyte-derived macrophages of normal donors was assessed. moreover, the ability of selected cytokines to modulate the intracellular growth of m. avium was investigated. our virulent strain of m. avium grew progressively in human macrophages. treatment of macrophage monolayers with interferon-gamma (ifn-gamma) did not lead to any significant change in the infection pattern. conversely, treatment with tu ... | 1990 | 2120128 |
in vitro activities against mycobacteria of two long-acting rifamycins, fce22807 and cgp40/469a (spa-s-565). | the in vitro activities of two new long-acting rifamycins, fce22807 a derivative of fce22250, and cgp40/469a (spa-s-565) were studied. when compared with rifampicin, the minimal inhibitory concentrations (mic) against mycobacterium tuberculosis of both were 4 times lower but neither was particularly active against rifampicin-resistant strains of m. tuberculosis nor against m. avium-intracellulare-scrofulaceum complex strains. a drug is likely to be particularly effective in widely spaced intermi ... | 1990 | 2120827 |
cost of treating mycobacterium avium complex infection in aids. | | 1990 | 2122787 |
[purified protein derivatives prepared from mycobacterium tuberculosis (ppds) and m. intracellulare (ppd-b) in differential diagnosis of mycobacteriosis]. | to reveal the possibility of differentiating diseases caused by m. tuberculosis and m. intracellulare, simultaneous tuberculin testing by ppds and ppd-b was carried out among x-ray suspects of tuberculosis and health persons. ppd-b was prepared by dr. tasaka (department of bacteriology, hiroshima university) from m. intracellulare (atcc 13950). for tuberculin testing, 0.05 micrograms of ppds from m. tuberculosis (nihon bcg co.) and 0.1 microgram of ppd-b were used. the study included 61 patients ... | 1990 | 2126050 |
enhanced growth of mycobacteria by culture filtrate of gemella haemolysans. | the culture filtrate of g. haemolysans enhanced the growth of mycobacteria. the enhancing substance seemed to be effectively produced in bhi broth supplemented with human blood. the mycobacterial growth was inhibited by high concentrations of the culture filtrate, but was markedly enhanced at low concentrations such as 1/32 or 1/64 dilutions. the generation time at log phase was 7 to 9 hours compared with 14 hours for the control, leading to rapid detection of mycobacteria in culture. with sputa ... | 1990 | 2126582 |
[cross-resistance relationship between streptomycin and kanamycin resistances in mycobacterium smegmatis (strain jucho)--comparison of the development patterns of resistances to streptomycin and kanamycin among mycobacterium tuberculosis, mycobacterium avium complex, and mycobacterium smegmatis]. | the resistance development pattern of mycobacterium smegmatis strain 17023 (jucho) to streptomycin and kanamycin was studied. the medium used was ogawa egg medium, and the level of resistance was determined for each clone derived from single colony by the 'actual count' method. hence, the resistance level was estimated as the highest concentration of drugs, in which small inocula consisting of 20 to 100 colony-forming units could grow after seven days incubation. only one type of resistance muta ... | 1990 | 2127614 |
[in vitro activities of new rifamycin derivatives against mycobacterium tuberculosis and m. avium complex]. | the in vitro anti-m. tuberculosis and anti-m. avium complex activities of five new rifamycin derivatives, krm1648, krm1657, krm1668, krm1674 and krm2312, provided by kanegafuchi chem. ind. co. japan were evaluated and compared with those of rifampicin (rfp) and rifabutin (rbu). antimycobacterial activity was tested by broth dilution method using kirchner's liquid medium supplemented with 10% bovine serum. the mics 90 (micrograms/ml) of all five krms and rbu for 20 clinical isolates of m. tubercu ... | 1990 | 2127615 |
acid-fast bacilli detected in umbilical codes and skins of human at cases of surgical operation. | acid-fast bacilli were detected in 13 (27%) of 49 skin samples in surgical operation under the procedures of collection of bacilli by centrifuging the filtrate of tissue homogenate through adsorbent cotton. ten specimens (20%) contained cultivable organisms, including m. simiae (9 specimens) and m. gordonae (one specimen). the other 3 specimens did not contain any cultivable organism, although microscopic observation revealed the presence of acid-fast bacilli. eight (17%) of 48 raw umbilical cod ... | 1990 | 2133037 |
isolation and characterization of recombinant lambda gt11 bacteriophages expressing four different mycobacterium intracellulare antigens. | four bacteriophages expressing different immunoreactive recombinant mycobacterium intracellulare antigens were isolated from a lambda gt11 library with monoclonal antibodies to m. intracellulare. these four antibodies reacted with native m. intracellulare proteins of 54, 43, 40/38, and 22 kilodaltons. southern blot hybridizations with dna probes prepared from insert fragments of these bacteriophages confirmed the m. intracellulare derivation of the inserts. the physical maps of the immunoreactiv ... | 1990 | 2136733 |
pathogenesis of route-related variation in t-suppressor response on immunization with mycobacteria. | the route of immunization was observed to play a significant role in deciding the outcome of immunization with killed mycobacterial vaccines. earlier we reported that the slow growers were immunogenic by both the intraperitoneal (i.p.) and intradermal (i.d.) routes. in contrast, the rapid growers were immunogenic by the i.d. route only. both rapid and slow growers generated the classical, antigen-specific lyt-2 positive, t-cell-mediated suppression after i.p. immunization but not after i.d. immu ... | 1990 | 2138659 |
strain- and donor-related differences in the interaction of mycobacterium avium with human monocytes and its modulation by interferon-gamma. | mycobacterium avium is a cause of disseminated infection in aids patients. the pathogenicity of m. avium for human monocytes was examined in an in vitro model. peripheral blood monocytes obtained from 13 healthy donors were precultured for 2 days before infection. monocytes were infected with six aids-associated and three non-aids-associated strains and four strains of m. avium selected on the basis of colonial morphology. uptake of m. avium detected by counting intracellular acid-fast bacilli d ... | 1990 | 2152242 |
bactericidal activity in vitro of various rifamycins against mycobacterium avium and mycobacterium tuberculosis. | minimal inhibitory and bactericidal concentrations (mics and mbcs) of rifampin (rmp), rifabutin (rbt), rifapentine (rpt), cgp-7040, and p-dea, were determined for 50 m. avium strains in 7h12 liquid medium radiometrically under various ph conditions. half were isolated from patients with aids and the other half from patients without aids but with pulmonary disease. the mics and mbcs were also determined in 7h12 broth for m. tuberculosis strains. the mic results obtained with m. tuberculosis strai ... | 1990 | 2155555 |
quadruple-drug therapy for mycobacterium avium-intracellulare bacteremia in aids patients. | the mycobacterial response was evaluated for patients with mycobacterium avium-intracellulare complex (mac) bacteremia treated with a quadruple regimen of rifabutin, clofazimine, isoniazid, and ethambutol. mycobacteremia was cleared in 22 of 25 patients who received this regimen, and 18 patients experienced complete resolution of symptoms associated with mac infection. all of the patients were immunodeficient, with a mean cd4 cell count at the time of diagnosis of mac infection of 54.7 +/- 54.6 ... | 1990 | 2156947 |
opportunistic infections of the testis in the acquired immunodeficiency syndrome. | the testes of an autopsy sample of 56 patients with acquired immunodeficiency syndrome (aids) and systemic opportunistic infections were studied for the presence and type of testicular infection. light-microscopic evidence of opportunistic organisms (cytomegalovirus, mycobacterium avium-intracellulare, and toxoplasma) was present in 22 cases (39%). based on the prevalence and histologic features of the testicular infections and the biological characteristics of the specific organisms, the possib ... | 1990 | 2157146 |
rifabutin (ansamycin lm427) for the treatment of pulmonary mycobacterium avium complex. | during the period october 1983 through january 1988, the centers for disease control (cdc) provided the experimental drug rifabutin (ansamycin lm427) to 406 patients with severe, progressive mycobacterium avium complex pulmonary disease who had been unresponsive to standard therapy. selected patients were randomly assigned to doses of 150, 300, or 450 mg rifabutin. choice of companion drugs was left to the treating physicians. in the analysis of data from this program, we examined the relationsh ... | 1990 | 2158257 |
[aids and gastrointestinal tract: a summary for gastroenterologists and surgeons]. | the majority of patients with aids suffer from diarrhea and weight loss, as well as opportunistic infection and tumors of the gastrointestinal tract; endoscopy is frequently necessary. often, but not always, it is possible to identify an opportunistic tumor or infection which explains the patient's signs and symptoms. in other cases, hiv may itself be pathogenic. the most important opportunistic pathogens are candida albicans (stomatitis and esophagitis), cytomegalovirus and herpes simplex virus ... | 1990 | 2159657 |
interaction of antimycobacterial and anti-pneumocystis drugs with phospholipid membranes. | liposomes can be used as carriers of drugs in the treatment of viral, bacterial and protozoal infections. the potential for liposome-mediated therapy of mycobacterium avium-intracellulare complex infections, one of the most common opportunistic infections in aids, is currently under study. here, we have investigated the effect of the lipid-soluble antimycobacterial drugs ansamycin, clofazimine and cgp7040 on the thermotropic behavior of liposomes composed of dipalmitoylphosphatidylcholine (dppc) ... | 1990 | 2160335 |
characteristics of immunosuppressive macrophages induced in host spleen cells by mycobacterium avium complex and mycobacterium tuberculosis infections in mice. | the profile of generation and characteristics of immunosuppressive macrophages (m phi s), which suppress the cona-mitogenic response of spleen cells (spcs), in host cba/jn mice during the course of mycobacterium avium complex (mac) and m. tuberculosis (mt) infections were investigated. in both infections, a marked reduction in cona mitogenic response of splenic t cells was seen around 2 weeks after infection, and this was accompanied by generation of potent immunosuppressive m phi s in the spcs ... | 1990 | 2161997 |
[activity of azithromycin and roxithromycin alone or in combination against mycobacterium avium and mycobacterium xenopi]. | the effect of two new macrolides, azithromycin and roxithromycin used either alone or in combination with amikacin rifabutine and 1.25 (ho)2 vitamin d3 was examined in vitro. macrophage monolayers infected with m. avium complex or m. xenopi were treated with antibiotics or 1.25 (oh)2 vitamin d3 by using different protocols: antibiotics or 1.25 (oh)2 vitamin d3 was added to the macrophage monolayers immediately after infection and released by washing out after 24 h; antibiotics or 1.25 (oh)2 vita ... | 1990 | 2164181 |
identification of two groups of mycobacterium paratuberculosis strains by restriction endonuclease analysis and dna hybridization. | genomic dna was prepared from four reference strains of mycobacterium paratuberculosis and 46 isolates of this organism from new zealand, australia, canada, and norway and also from two mycobactin-dependent "wood pigeon" strains. the dna was characterized by restriction endonuclease analysis, both with and without dna hybridization, with a probe specific to a repetitive dna sequence in m. paratuberculosis. both techniques differentiated m. paratuberculosis strains into two groups, but dna hybrid ... | 1990 | 2166089 |
molecular biology of crohn's disease mycobacteria. | a glasgow surgeon, t.k. dalziel, published a detailed description of chronic enteritis in humans in 1913. he proposed that the disease was caused by the same organisms as those responsible for chronic enteritis, johne's disease, in animals described a few years earlier (1895). dalziel's dilemma was that he could see acid-fast bacilli in the diseased animal tissues but not in the diseased human tissues. little real progress in the medical understanding of the causes of chronic enteritis in humans ... | 1990 | 2169929 |
activities of clarithromycin, sulfisoxazole, and rifabutin against mycobacterium avium complex multiplication within human macrophages. | the activities of clarithromycin, sulfisoxazole, and rifabutin against three virulent strains of mycobacterium avium complex isolated from patients with acquired immunodeficiency syndrome were evaluated in a model of intracellular infection. human monocyte-derived macrophages were infected at day 6 of culture with m. avium complex. intracellular bacteria were counted 60 min after inoculation. extra- and intracellular bacteria were counted at days 4 and 7 after inoculation. the concentrations use ... | 1990 | 2171421 |
[hepatic involvement in aids. a retrospective clinical study in 71 patients]. | in order to determine the extent of liver abnormalities occurring during acquired immunodeficiency syndrome, the available histological analyses of liver samples (32 biopsies, 52 autopsies) from 71 aids patients, for the period 1982-1986, were studied retrospectively. hepatomegaly was the most common clinical symptom (23 patients, 32.4%), while jaundice was rare, being seen in only 5 cases (7%). progressive anicteric cholestasis was the most frequently observed biological anomaly (29/52, 55.7%). ... | 1990 | 2175155 |
effect of rifabutin on disseminated mycobacterium avium infections in thymectomized, cd4 t-cell-deficient mice. | disseminated mycobacterium avium infection is the major cause of bacteremia in patients with acquired immunodeficiency syndrome. we present here a new animal model of this disease, thymectomized c57bl/6 mice that were intravenously infused with monoclonal antibody to selectively deplete cd4+ t cells. the increased susceptibility of such animals to m. avium infection is comparable to that of c57bl/6 beige mice and thus may provide a viable alternative to the latter model. further, using represent ... | 1990 | 2178333 |
1,25 dihydroxyvitamin d3-dependent inhibition of growth or killing of mycobacterium avium complex in human macrophages is mediated by tnf and gm-csf. | vitamin d3 (d3) has been shown to activate several macrophage functions. to determine whether d3 could activate macrophages to kill or inhibit intracellular growth of mycobacterium avium complex (mac), human monocyte-derived macrophages were treated with d3 (10(-7), 10(-8), and 10(-9) m) 24 hr before or for 48 hr after mac infection. all three concentrations were associated with inhibition of growth or killing of mac in a dose-dependent fashion (28 +/- 4% and 22 +/- 3% of killing and inhibition ... | 1990 | 2183943 |
killing of mycobacterium avium: insights provided by the use of recombinant cytokines. | | 1990 | 2189170 |
protein g-based enzyme-linked immunosorbent assay for anti-mpb70 antibodies in bovine tuberculosis. | mpb70 is a highly species specific protein which is secreted from mycobacterium bovis during culture. to investigate whether antibodies against mpb70 can be used as an indicator of infection with m. bovis, an enzyme-linked immunosorbent assay was developed, based on the use of biotinylated protein g, to provide a common indicator for antibody formation in different species. during experimental infection with m. bovis in cattle, a characteristic pattern of anti-mpb70 antibody production was obser ... | 1990 | 2191012 |
biosynthesis and scavenging of pyrimidines by pathogenic mycobacteria. | mycobacterium microti incorporated a wide range of exogenously supplied pyrimidines into its nucleic acids. m. avium incorporated a relatively narrow range of pyrimidines but both m. avium and m. microti when recovered after growth in vivo incorporated a slightly wider range of pyrimidines than the same strains grown in vitro. m. microti and m. leprae could not take up uridine nucleotides directly but could utilize the pyrimidines by hydrolysing them to uridine and then taking up the uridine. py ... | 1990 | 2191077 |
aspartate metabolism in mycobacterium avium grown in host tissue and axenically and in mycobacterium leprae. | aspartokinase activity was detected in extracts from mycobacterium leprae (recovered from armadillo liver) and in mycobacterium avium grown axenically and in vivo. homoserine dehydrogenase activity was only detected in m. leprae and in m. avium grown axenically. activities, when detected, were 50 to 70% lower in m. leprae or m. avium grown in vivo than in axenically grown m. avium. in these two pathogenic mycobacteria, aspartokinase and homoserine dehydrogenase are subject to feedback inhibition ... | 1990 | 2191078 |
enzymes for biosynthesis de novo and elongation of fatty acids in mycobacteria grown in host cells: is mycobacterium leprae competent in fatty acid biosynthesis? | fatty acid synthetase activity in extracts of mycobacterium leprae was equivalent to 1.7 pmol malonyl-coa incorporated into fatty acid min-1 (mg protein)-1. this activity--if representative of living m. leprae organisms--is insufficient to enable them to synthesize their lipid requirements rapidly enough to support growth. the major activity for scavenging fatty acids in extracts of mycobacterium microti and mycobacterium avium, as well as in extracts of m. leprae, was acetyl-coa-dependent fatty ... | 1990 | 2191079 |
dynamics of the phagocytic cell response within the lungs of parabiotic mice infected with mycobacteria with decreasing virulence for mice. | alveolar macrophages constitute the first line of defense against an aerogenic mycobacterial challenge. the kinetics of the alveolar macrophage response to an infectious stimulus was studied in parabiotic (c57bl/6 x dba/2 [b6d2]f1 hybrid mice pulse-labeled with tritiated thymidine given to one (donor) animal while the other (recipient) received an equivalent amount of "cold" thymidine. lavage fluid collected from uninfected recipients yielded few labeled monocytes. however, after introduction of ... | 1990 | 2194969 |
the avian tubercle bacillus and its relatives. | | 1990 | 2196253 |
the use of paraffin wax metabolism in the speciation of mycobacterium avium-intracellulare. | paraffin-wax utilisation or baiting of mycobacterium avium-intracellulare (mai) complex organisms and other 'atypical mycobacteria' and the inability of mycobacterium tuberculosis to utilise paraffin are known and useful if forgotten facts. strains of possible aids-related mai have been introduced into czapek broth devoid of any carbon source other than paraffin-wax coated slides. replicate slides showing 'in situ' growth were subjected to the following battery of tests: acid alcohol fast staini ... | 1990 | 2196726 |
quantitative aspects of septicemia. | for years, quantitative blood cultures found only limited use as aids in the diagnosis and management of septic patients because the available methods were cumbersome, labor intensive, and practical only for relatively small volumes of blood. the development and subsequent commercial availability of lysis-centrifugation direct plating methods for blood cultures have addressed many of the shortcomings of the older methods. the lysis-centrifugation method has demonstrated good performance relative ... | 1990 | 2200606 |
septicaemia in patients with aids. | during a 5 year period at st stephen's hospital, london, septicaemia was detected in 66 patients with the acquired immune deficiency syndrome (aids) and in 13 other patients with non-aids-associated hiv infections. the most frequent pathogens in patients with aids were mycobacterium avium-intracellulare, streptococcus pneumoniae, pseudomonas aeruginosa, cryptococcus neoformans and staphylococci. a series of hiv-associated septicaemias reported from other centres in different countries has shown ... | 1990 | 2201108 |
missing infections in aids. | in north america and europe, the opportunistic infections from which patients with acquired immune deficiency syndrome (aids) frequently suffer are pneumocystis carinii pneumonia and mycobacterium avium-intracellulare: in central africa these infections are uncommon or non-existent. serious infections with entamoeba histolytica and strongyloides stercoralis would be expected to occur in aids patients: they do not. falciparum malaria might be expected to interact with hiv infection: it does not. ... | 1990 | 2201111 |
cumulative positivity rates of multiple blood cultures for mycobacterium avium-intracellulare and cryptococcus neoformans in patients with the acquired immunodeficiency syndrome. | we examined the occurrence of low-grade mycobacterium avium-intracellulare bacteremia and cryptococcus neoformans fungemia in patients with the acquired immunodeficiency syndrome and the consistency of positive cultures obtained using a sensitive blood culture system (isolator, e. i. du pont de nemours, wilmington, del) for the recovery of these organisms. the blood culture records were reviewed, and the proportion of positive blood cultures yielding less than 1 colony-forming unit per millilite ... | 1990 | 2202274 |
iron-regulated envelope proteins of mycobacteria grown in vitro and their occurrence in mycobacterium avium and mycobacterium leprae grown in vivo. | several iron-regulated envelope proteins (ireps), 11-180 kda, have been detected in preparations of walls and membranes of mycobacterium smegmatis, in an armadillo-derived mycobacterium (adm) and in m. avium. the same sized proteins from m. vacae appeared under both iron-deficient and iron-sufficient growth conditions. two larger proteins, of 240 and 250 kda, appeared in the membranes of m. smegmatis and m. avium only when grown iron-sufficiently but were constitutively present in both adm and m ... | 1990 | 2202378 |
identification of various serovar strains of mycobacterium avium complex by using dna probes specific for mycobacterium avium and mycobacterium intracellulare. | reference strains of the mycobacterium avium complex (mac) belonging to serovars 1 to 28 were examined with dna probes (gen probe rapid diagnostic system for the mac; gen probe inc., san diego, calif.) specific for either m. avium or mycobacterium intracellulare. this study revealed that the earlier designations of the mac serovars, in which serovars 1 to 3 and 4 to 28 were regarded as m. avium and m. intracellular, respectively, should be revised as follows. first m. avium includes serovars, 1 ... | 1990 | 2203807 |