| pituitary regulation of human growth hormone binding sites in rat liver membranes. | we have studied the binding of 125i-human growth hormone (hgh) to crude 100,000 x g membrane preparations from rat liver, and have studied factors which might regulate the capacity and affinity of hgh binding sites. membrane preparations have livers of pregnant rats bound between 8% and 18% of the 125i-hgh initially added, and 70%-80% of that bound was displaced by 1 mug of unlabeled hgh. humans prolactin (hprl) displaced 125 i-hgh in a manner parallel to hgh itself but with about one-third the ... | 1976 | 175242 |
| [complement-dependent immune cytolysis of cells from transplantable myeloid tumor]. | | 1975 | 175643 |
| effects of stress on rat brain adenosine 3',5'-monophosphate in vivo. | | 1975 | 162838 |
| [phosphofructokinase activity of the plague bacterium]. | synthesis of phosphofructokinase was decreased in pestilential microbe if cultivation temperature was increased from 28 degrees to 37 degrees. aeration of cultural fluid effected slightly on the enzyme production. glucose, added to cultural fluid, decreased synthesis of phosphofructokinase in virulent strain and increased it in avirulent one. phosphofructokinase activity from pestilential microbe was inhibited by atp, citrate, 3-phosphoglycerate, by ca2+ and mn2+. amp and lesser adp reduced the ... | 1978 | 149424 |
| electrocardiographic signs of chronic cor pulmonale in 40 376 patients with silicosis. | the records of all patients who were examined for silicosis at the fund of occupational diseases between 1972 and 1976 are reviewed. in 3627 cases the mechanographical record was incomplete leaving 40 376 patients in the study. electrocardiographic signs of chronic cor pulmonale (c.c.p.) were detected in 5.58 per cent. the severity of c.c.p. was evaluated and the prevalence of the different electrocardiographic signs was examined. the presence and severity of c.c.p. was compared to the radiologi ... | 1978 | 152045 |
| inhibition of four human serine proteases by substituted benzamidines. | a series of substituted benzamidines has been examined for their inhibitory activity against the human serine proteases--trypsin, thrombin, plasmin, and c1s, a subunit of the first component of complement. the inhibition constants obtained for each enzyme were correlated with physical-chemical properties of the substituent group using the quantitative structure-activity relationship approach. this analysis indicated that plasmin and c1s are very similar in their interactions with substituted ben ... | 1978 | 152812 |
| disseminated herpesvirus infection. association with primary genital herpes in pregnancy. | a patient with primary herpes simplex virus (hsv) type 2 genital infection had dissemination in the 37th week of her first pregnancy. this was manifested by severe hepatitis, pancreatitis, and genital lesions. temporary improvement followed the delivery of a healthy infant by cesarean section. encephalitis became evident on the third postpartum day, and recovery was complicated by profound bradycardia, possibly due to viral myocarditis. vidarabine was administered for seven days, and the patient ... | 1976 | 178938 |
| [chronic granulomatous disease. clinical symptoms and biochemical background]. | | 1976 | 184401 |
| comparison of interferon action in interferon resistant and sensitive l1210 cells. | translation inhibition, leu-trna aminoacylation and double-stranded rna and atp dependent phosphorylation were examined in interferon-treated and control cell-free lysates of leukaemic mouse l 1210 r and l 1210 s cells. no differences were observed between the respective interferon-treated and control cell-free extracts, except for the presence of an enhanced 67k dalton phosphoprotein fraction in interferon-treated l 1210 s cell-free extracts. in non-responding cell-free lysates, the lack of sti ... | 1978 | 212514 |
| [blood transfusion and viral diseases. recent acquisitions concerning viral hepatitis viruses, cytomegaloviruses and epstein-barr virus]. | in recent years, an increasingly clear picture has been formed of the virus-induced syndromes that may follow a blood transfusion or the use of blood derivatives. up to about 10 years ago, post-infusion infection was predominantly due to serum hepatitis. blumberg's discovery of hbsag (formerly known as australia antigen) has made it possible to check and prevent viral hepatitis, type b, and to recognise such distinct forms as the mononucleosis-like syndrome caused by cytomegalic virus, infectiou ... | 1979 | 219399 |
| transcription of the marek's disease virus genome in a nonproductive chicken lymphoblastoid cell line. | | 1979 | 219594 |
| secretory granules of the duodenal enterochromaffin cells of the cat. | | 1979 | 222959 |
| troponoids. 3. synthesis and antiallergy activity of n-troponyloxamic acid esters. | a number of oxamic acid derivatives of tropones and tropolones were synthesized and their antianaphylactic activity was determined in passive paw anaphylaxis (ppa). several of these esters possessed oral activity. a comparison of the effect on the biological activity of the esters and the corresponding acid and its salt is reported. the experiments suggesting a relationship between the activity and the bioavailability of the ester 19 are also described. a study of the fate of ester 19 in serum o ... | 1979 | 229222 |
| [enzymomorphology of the vaccinal process in connection with formation of immunity to plague]. | the studies conducted showed that the beginning of immunogenesis following the administration of live plague vaccine was preceded by a period of primary toxic action of multiplying microbes when the activity of a number of enzymes in the organs of guinea-pigs was temporarily reduced. subsequently, inductive and productive phases of formation of antibodies started against the background of normalization and growth of the enzymatic activity associated with mobilization of energy. the earliest hype ... | 1976 | 194554 |
| detection of coronavirus-like particles in a spontaneous case of feline infectious peritonitis. | | 1978 | 209236 |
| mitogenic response of mouse spleen cells and gelation of limulus lysate by lipopolysaccharide of yersinia pestis and evidence for neutralization of lipopolysaccharide by polymyxin b. | lipopolysaccharide (lps) extracted with phenol and water from yersinia pestis was compared with lps of escherichia coli for stimulation of deoxyribonucleic acid synthesis in mouse spleen cells (lymphocyte mitogenesis), gelation of limulus lysate, pyrogenicity in the rabbit, and susceptibility to inhibition of these activities by polymyxin b sulfate (pbs). lps of y. pestis stimulated deoxyribonucleic acid synthesis in mouse spleen cell cultures over the same quantitative range as lps of e. coli. ... | 1977 | 200563 |
| [migration of transformed fibroblast-like cells on substrates with patterned relief-work (quantitative study)]. | the quantitative estimation of migration ability of transformed fibroblast-like cells of various epecies (mouse , rat, hamster, man) cultured on the substratum with grooves of various depth (5--40 mcm) was performed. of the majority of 11 cell lines examined, a reduced migration capacity up to its total disappeanance was registered as compared with the homological normal embryonic cells. a more pronounced reduction of migration ability was shown in mouse and rat transformed cells and less in hu ... | 1977 | 201058 |
| functional studies on crosslinked bovine cytochrome c oxidase. | | 1978 | 202495 |
| how do axons control myelin formation? the model of 6-aminonicotinamide neuropathy. | injection of 6-aminonicotinamide into young rats produces a peculiar neuropathy characterized by selective swelling and disruption of the layer of schwann cell cytoplasm lining the inner surface of the myelin sheath. this layer increases greatly in volume, compressing the axon and distending the myelin sheath. morphometry of such swollen fibers discloses that the amount of myelin in the distended sheaths is considerably greater than would correspond to the size of the axons, even if axonal compr ... | 1978 | 204752 |
| [experimental infection of biomphalaria glabrata with schistosoma mansoni in the presence of helisoma duryi]. | | 1979 | 262314 |
| a mitochondrial lesion in experimental spinal cord trauma. | | 1978 | 204754 |
| [brain aging. ultrastructural study of changes in man and laboratory animals]. | the authors present a study on ultrastructural changes observed in aged human and animal brain. these changes are analyzed and compared with those described in classic optic microscopy and with those observed in experimental models of the same lesions. | 1979 | 262351 |
| primary culture of adult rat liver cells. i. preparation of isolated cells from trypsin-perfused liver of adult rat. | isolated hepatic cells from adult rats were prepared by perfusing the livers with trypsin. the highest yield of viable cells was obtained by perfusing the liver with 0.1% trypsin, ph 7.0, at 37 degrees c for 30 min. following this treatment about 70% of cells excluded trypan blue. the isolated cells contained many binucleate cells. between 60 and 70% of dna present originally in the liver was recovered from the isolated hepatic cells, which had higher glucose 6-phosphatase activity than the live ... | 1977 | 205092 |
| studies of the human testis. xi. leydig cell clusters and levels of intratesticular testosterone and 20 alpha-dihydroprogesterone. | testosterone concentration in testes of 23 men, ages 51 to 90, was determined as 490 +/- 172 ng/g tissue (m +/- s.d.) and 20 alpha-dihydroprogesterone concentration as 10.0 +/- 2.3 ng/g tissue (m +/- s.d.) in 18 men of the same patient group. leydig cells were estimated by the number of leydig cell clusters per tubule. there was a high correlation (r = 0.88, p less than .001) of the leydig cell index with intratesticular testosterone. it is proposed that the leydig cell cluster index provides a ... | 1978 | 263345 |
| kinetics of lipid--protein interactions: interaction of apolipoprotein a-i from human plasma high density lipoproteins with phosphatidylcholines. | | 1978 | 207309 |
| the cloning of mouse globin and surrounding gene sequences in bacteriophage lambda. | | 1978 | 277326 |
| differential effects of isolated lipoproteins from normal and hypercholesterolemic rhesus monkeys on cholesterol esterification and accumulation in arterial smooth muscle cells in culture. | whole serum obtained from hypercholesterolemic rhesus monkeys was found to stimulate cholesterol esterification and cholesteryl ester accumulation in rhesus monkey arterial smooth muscle cells in culture to a significantly greater extent than normocholesterolemic serum. this was true even when the cholesterol concentration of the culture medium was equalized. isolation and characterzation of the low density lipoproteins (ldl) from rhesus monkeys indicated that the ldl from hypercholesterolemic a ... | 1978 | 208631 |
| kinetic studies on the reactions catalyzed by chorismate mutase-prephenate dehydrogenase from aerobacter aerogenes. | steady-state kinetic techniques have been used to investigate each of the reactions catalyzed by the bifunctional enzyme, chorismate mutase-prephenate dehydrogenase, from aerobacter aerogenes. the results of steady-state velocity studies in the absence of products, as well as product and dead-end inhibition studies, suggest that the prephenate dehydrogenase reaction conforms to a rapid equilibrium random mechanism which involes the formation of two dead-end complexes, viz, enzyme-nadh-prephenate ... | 1978 | 206281 |
| beta-adrenergic blocking activity of yersinia pestis murine toxin. | yersinia pestis plague murine toxin has been found to inhibit the mobilization of free fatty acids in mice in a manner similar to that of beta-adrenergic blocking agents. the blockage is detectable 75 min after injection of the toxin (1 to 2 mean lethal doses). the degree of inhibition was directly correlated with the toxicity of a given toxin preparation. agents such as cholera toxin or glucagon, with apparently distinct receptors from beta-adrenergic receptors, stimulated adenylate cyclase and ... | 1977 | 198377 |
| altered lethality of murine toxin from yersinia pestis under various metabolic conditions. | | 1977 | 190614 |
| effect of irradiation on enzyme activities of cyclic amp system in the neuro- and adenohypophyses. | the enzyme activities of cyclic amp system in the neuro- and adenohypophyses were studied, immediately after an irradiation by a single whole body exposure of 1600 r, in an attempt to find whether this intervention causes the changes in the responsiveness of the cyclic amp regulatory system. in the irradiated rats the neurohypophyses revealed a reduced activity of adenylate cyclase, moderately increased activity of phosphodiesterase and slightly decreased activity of protein kinase, including th ... | 1978 | 210409 |
| fluorescent probe studies of normal, persistently infected, rous sarcoma virus-transformed, and trypsinized rat cells. | | 1978 | 213301 |
| intracellular forms of epstein-barr virus dna in human tumour cells in vivo. | tumour biopsies from burkitt lymphoma patients, as well as human nasopharyngeal carcinoma cells growing in athymic mice, contain epstein-barr virus dna as covalently closed circular dna. in addition integrated viral dna sequences seem to be present. | 1976 | 176597 |
| estimating adrenal cortical function in dogs with acth. | the peripheral blood response to intramuscular injection of 10 units acth in dogs was investigated because no experimental evidence for the standardization of this procedure for clinical use was available. following the injection of acth in sodium chloride solution, neutrophilia, monocytosis, eosinopenia, and lymphopenia occurred. with the exception of eosinopenia, the greatest change in the concentration of each cell type in peripheral blood occurred between 2 and 4 hours post injection. the ma ... | 1978 | 208814 |
| infectivity of visna virus dna. | | 1976 | 176812 |
| induction in b2/b2 chickens of immunity to transplantable carcinogen-induced fibrosarcomas mediated by t-cell monocyte cooperation: role of delayed hypersensitivity to unrelated antigens. | | 1977 | 303451 |
| [etiology of chronic recurring aphthous stomatitis]. | 46 patients with chronic recurrent aphthae of the oral mucosa were subjected to clinical, virological and serologic examinations to evidence the assumed virus aetiology of this clinical picture. a cytopathogenic organism (classified as herpes virus hominis) could be cultivated from the aphtha sample from only one patient. | 1978 | 209580 |
| characterization of a calcium-activated cytidine triphosphate phosphohydrolase present in dorsal spinal nerve roots. | | 1978 | 210260 |
| mosaic 45,xy,-21/46,xy in a child with g deletion syndrome i. | a mosaic 45,xy,-21/46,xy was found in a boy with g deletion syndrome i who showed microcephaly, downward, antimongoloid slanted eyes, micrognathism, large, low set ears, small penis and bilateral inguinoscrotal hernia. | 1977 | 302684 |
| the cerebellar arteries in the cat and areas supplied by them. | | 1978 | 308899 |
| light and electron microscopic features of a pituitary adenoma in nelson's syndrome. | electron microscopy of an amphophil pituitary adenoma surgically removed from a 51-year-old woman who had nelson's syndrome revealed that the tumor was composed of melanocorticotroph cells. this finding is consistent with the view that in the human pituitary gland one single cell type produces both adrenocorticotropic hormone (acth) and melanocyte-stimulating hormone (msh). in contrast to the ultrastructure of pituitary adenomas associated with cushing's syndrome, no or only very few microfilame ... | 1976 | 176883 |
| investigations on adenosine 3',5'-monophosphate phosphodiesterase in ram semen and initial characterization of a sperm-specific isoenzyme. | phosphodiesterase is shown to occur in ram semen, and its activity to be higher in spermatozoa than in seminal plasma. using similar substrate levels, the rate at which adenosine 3',5'-monophosphate (cyclic amp) is metabolized by phosphodiesterase in spermatozoa is about 100 times higher than that of cyclic amp synthesis by adenylate cyclase. in spermatozoa, phosphodiesterase is present partly in a soluble form, and partly bound; both forms can be extracted by sonication. the soluble enzyme (ph ... | 1976 | 178869 |
| the role of testicular adenylate cyclase in the hypogonadism of renal insufficiency. | | 1978 | 216992 |
| alterations in the expression of the cytomegalovirus-induced cytopathogenic effect in fibroblasts by aflatoxin b1. | aflatoxin b1 has been shown both to promote and to alter the expression of the cytopathogenic effect observed when human fibroblasts are challenged with human cytomegalovirus (cmv). although the cells become round, as is the characteristic effect of this virus on fibroblasts, multinucleate cells are seen to arise from cell fusion within 48 h after virus addition. | 1978 | 218602 |
| [the possibility of predicting the degree of plasmacyte reaction in response to administration of soluble antigen to mice]. | the work is devoted to the mathematical description of the accumulation of plasma cells in the spleen of cba mice immunized intraperitoneally. a dependence between the dynamics of the soluble antigen concentration in the blood and the plasmocytic reaction in the spleen was confirmed under experimental conditions. index a was suggested for detection of a change from the antigenic function to the accumulation of plasma cells. the mean values of index a were used to compare the calculated values of ... | 1975 | 235822 |
| fluorescence quenching of horse liver alcohol dehydrogenase and its complexes by para-chloromercuriphenyl sulfonate. | | 1975 | 235896 |
| aromatic amino acid transport in yersinia pestis. | the uptake and concentration of aromatic amino acids by yersinia pestis tjw was investigated using endogenously metabolizing cells. transport activity did not depend on either protein synthesis or exogenously added energy sources such as glucose. aromatic amino acids remained as the free, unaltered amino acid in the pool fraction. phenylalanine and tryptophan transport obeyed michaelis-menten-like kinetics with apparent km values of 6 x 10(-7) to 7.5 x 10(-7) and 2 x 10(-6) m, respectively. tyro ... | 1975 | 238939 |
| partial duplication 5q syndrome: phenotypic similarity in two sisters with identical karyotype (partial duplication 5q33 leads to 5qter and partial deficiency 8p23 leads to pter). | two sisters with statomotor developmental retardation microcephaly, hydrocephalus internus and externus without signs of pressure, heart defect (ventricular septal defect), early pulmonary resistance and characteristic facial changes were found to have the same unbalanced karyotype with partial trisomy 5q3300 leads to 5qter and partial monosomy 8p2300 leads to 8pter, derived from a balanced reciprocal paternal translocation: 46,xy,t(5;8)(q3300;p2300). the older girl was tested for the erythrocyt ... | 1977 | 305758 |
| the interaction of calcium and magnesium ions with deoxyribonucleic acid. | | 1975 | 240314 |
| [prevention and therapy of viral hepatitis]. | | 1979 | 253774 |
| influence of hyperglycemia on survival after hemorrhagic shock. | terms such as "insulin resistance" and "glucose intolerance" applied to shock-induced hyperglycemia suggest that this state may prejudice survival. however, our data indicate that posthemorrhage hyperglycemia improves short-term survival. rabbits, either fed until the experiment or fasted for 24 hours, were shocked by rapid removal of 25% of their blood volume (bv) measured by 131ihsa. during the next 60 minutes, blood pressure (bp) was recorded, and the following variables were measured every 1 ... | 1978 | 262089 |
| conservation of transfer ribonucleic acid and 5s ribonucleic acid cistrons in enterobacteriaceae. | the genes for tranfer ribonucleic acid (tdna) and 5s ribonucleic acid (5sdna) were isolated from the total deoxyribonucleic acid (dna) of escherichia coli. the relatedness of tdna and 5s from e. coli and other species of enterobacteriaceae was determined by reassociation of the isolated genes labeled with 32po4 to unlabeled, unfractionated dna. double-stranded dna was separated from unreacted dna by hydroxyapatite chromatography. thermal elution profiles were done to determine the amount of unpa ... | 1977 | 321428 |
| [efficacy of various culture media in the preservation of yersinia pestis strains]. | | 1979 | 262317 |
| basal and human chorionic gonadotropin-stimulated 17 alpha-hydroxyprogesterone and testosterone levels in klinefelter's syndrome. | in nine patients with klinefelter's syndrome, mean basal plasma levels of testosterone (302 +/- 145 ng/100 ml) and its major precursor, 17 alpha-hydroxyprogesterone (17-ohp; 86 +/- 46 ng/100 ml), were significantly lower (p less than 0.01 to less 0.05) than in eight eugonadal men (605 +/- 180 and 136 +/- 39 ng/100 ml, respectively). the ratio of 17-ohp to testosterone, however, was comparable in both groups (0.29 +/- 0.09 vs. 0.24 +/- 0.08; p less than 0.10). in the klinefelter patients, basal p ... | 1978 | 263344 |
| decline of maternal antibodies to plague in norway rats. | the decline of maternal antibodies to the fraciton i antigen of yersinia pestis was investigated in newly weaned rattus norvegicus obtained from dams vaccinated with strain ev76(51f) of y. pestis. iha titre decreased by 50% each 7-3 days and cf titre declined 50% each 10-0 days in young rats. an analysis of available data indicated that maternal iha and cf antibodies could persist to 3 months of age. therefore, positive serologic reactions in young r. norvegicus, detected in the course of serolo ... | 1977 | 264498 |
| [biochemical characteristics of yersinia pestis samples isolated in brazil]. | | 1977 | 283471 |
| woodrige memorial lecture. the veterinary profession and an intensive poultry industry. | | 1978 | 213871 |
| [origin of plague moderate phages of serotype 2]. | results of study of the negative colonies morphology, the structure of corpuscles, antigenic properties, specificity, and the action range permitted to refer the phages obtained from 18 e. coli strain, 1 plaque strain, and 1 pseudotoberculosis bacillus strain to the same group and to identify them with plague phages of serological type 2. isolation of the same phage type from different bacterial species permits to regard them as "polyhostal" ones. e. coli should be considered as the main carrier ... | 1977 | 335729 |
| [new methods of laboratory diagnosis of plaque and cholera]. | | 1977 | 339614 |
| acid precipitation of clostridium botulinum type c and d toxins from whole culture by addition of ribonucleic acid as a precipitation aid. | the ratios of ribonucleic acid to protein contents of clostridium botulinum type c, d, and e cultures were lower than those of type a, b, and f cultures. addition of ribonucleic acid at 0.4 mg/ml to culture satisfactorily aided acid precipitation of type c and d toxins, but not that of type e toxin. | 1978 | 344224 |
| eosinophil chemotactic factor (ecf). iii. generation in human peripheral leukocytes. | eosinophil chemotactic factor (ecf) can be released from human peripheral leukocytes by an ige-anti-ige reaction, by the calcium ionophore a 23187 and during phagocytosis. supernatants and sonicates of unstimulated cells contain little or no ecf. on stimulation, however, ecf activity increases in the cells and even more so in the supernatants. this holds for purified neutrophils (pmns) as well as for basophil-containing mononuclear cell preparations. these findings contrast with those in lung ho ... | 1978 | 344230 |
| production and traffic of b lymphocytes in the extracortical central area of the guinea pig thymus. | lymphocytes in the stroma and lymphatics of the extra-cortical central area (ecca) of the guinea pig thymus have been studied with light microscopy, quantitative microscopy, colchicin-induced mitotic arrest, ea (igg) and ea (igm) c adherence, surface immunoglobulins (ig total, igm, igg), alkaline phosphatase activity and the effect of cyclophosphamide administration. the results suggest, that ap-positive, sig-positive eac-negative lymphocytes in the ecca proliferate and maturate into ap-negative ... | 1978 | 344232 |
| [pharmacologic properties of ortho-ethoxy-benzamide]. | | 1977 | 305744 |
| cellular immune response to yersinia pestis modulated by product(s) from thymus-derived lymphocytes. | resistance to infection with yersinia pestis was found to depend on whether the macrophage can inactivate and withstand the cytotoxic effects of phagocytized y. pestis. serum from mice immunized with antigens of y. pestis enhanced the resistance of monolayers of normal cultures to the cytotoxic effects of y. pestis and increased the capacity of peritoneal exudate cells from immune mice to inactivate these bacteria. the enhancing component of the serum was not removed by absorption with heat-kill ... | 1977 | 299867 |
| experimental gingivitis in odu plaque-susceptible rats. iii. toxic activity of the rat dental plaque. | the toxicity tests of the dental plaque from odu plaque-susceptible rats showed strong lethal effect on mice, and abscess forming effect on guinea-pigs. bacterial cells isolated from the rat dental plaque also showed strong toxicity on both animals and capillary permeable activity on rabbits. among these bacterial cells, corynebacterium showed the strongest toxic effects on these animals. these facts suggested an important role of the dental plaque on initiation and development of gingivitis and ... | 1979 | 289757 |
| [ring of the chromosome 4. ii. without facial dysmorphism]. | a r(4) was observed in a 5-year-old female patient, with growth retardation, a near normal psychomotor development and with no major dysmorphism. the break points were in p16 and q33. after comparison with other known observations of r(4) it is suggested that the phenotype of monosomy 4p is due to monosomy for the distal band 4p16. | 1977 | 302682 |
| partial tetrasomy 9(9pter to 9q2101) due to an extra iso-dicentric chromosome. | a 3-year-old boy with partial no. 9 tetrasomy is described. the patient showed markedly retarded physical and mental development as well as multiple congenital anomalies. routine chromosome analysis revealed an extra c-group chromosome. it had a pronounced secondary constriction at the proximal part of its long arm. based on studies by a variety of banding techniques, the extra chromosome was identified to be an iso-dicentric no. 9 chromosome with inactivation of one of the two centromeres, the ... | 1977 | 302683 |
| erythrocyte autoantibodies induced in mice immunized with rat antigens. | antibody reacting against syngeneic mouse erythrocytes could not be elicited (by rat erythrocytes) in athymic nude mice. rat antigen preparations from heart, muscle testes, brain erythrocyte ghosts and foetal material failed to elicit detectable autoantibody reactivity against mouse erythrocytes, even though all these preparations (other than brain and foetal) induced a reduction in half life of syngeneic murine erythrocytes in vivo. we suggest that an unstable rat erythrocyte antigen is respons ... | 1977 | 303095 |
| effect of lisuride and lsd on monoamine synthesis after axotomy or reserpine treatment in rat brain. | | 1978 | 305542 |
| ultrastructural and biochemical changes in newborn rabbit liver after transplacental effect of phenobarbital. | | 1979 | 315341 |
| transmembrane linkage of fibronectin to intracellular actin-containing filaments in cultured human fibroblasts. | | 1978 | 291374 |
| [rotavirus gastroenteritides in infants and toddlers]. | | 1978 | 216499 |
| [phage typing of rough e. coli strains isolated from urine (author's transl)]. | a differentiation of e. coli rough strains is generally not well established in bacteriological urine diagnosis although these strains are relatively often isolated from urine samples of patients with urinary tract infections (see table 2). an exact characterization of rough strains seems to be necessary especially for the distinction between recurrent and reinfection during therapy and follow-up studies. the application of phage typing for characterization of e. coli rough strains isolated from ... | 1978 | 373321 |
| the serological response to yersinia pestis infection. | passive haemagglutination antibody titres to fraction i antigen of yersinia pestis were plotted against day of clinical illness in 82 patients in viet nam. a rise was evident by day 5 with a peak at day 14, after which a plateau occurred. in contrast to all other patients, 2 patients with recurrent infections had elevated titres at the time of admission which decreased significantly during convalescence. | 1977 | 302154 |
| pesticin-dependent generation of somotically stable spheroplast-like structures. | homogenous pesticin, a bacteriocin produced by yersinia pestis, promoted rapid dose-dependent killing of escherichia coli phi but permitted residual generation of cell mass. both growing cells and those blocked in net synthesis of nucleic acids or protein were converted by pesticin to osmotically stable spheroplast-like forms. morphology and viability of cells starved for fermentable carbohydrate were not affected by pesticin. similar spheroplast-like structures were formed from sensitive cells ... | 1978 | 361722 |
| relative importance of high and low density lipoproteins in the regulation of cholesterol synthesis in the adrenal gland, ovary, and testis of the rat. | | 1978 | 214438 |
| [bacteriophagy and bacteriocinogeny of yersinia enterocolitica]. | | 1979 | 375639 |
| analysis of t cell subpopulations by laser doppler spectroscopy and the association of electrophoretic mobility differences with differences in rosette-forming affinity. | | 1979 | 313961 |
| susceptibility to cefazedone and cefazolin and production of beta-lactamase in in bacteroides fragilis and other species of bacteroidaceae. | | 1979 | 314805 |
| third international symposium on transfer factor. | | 1979 | 314845 |
| the requirement of ia-positive accessory cells for the induction of hapten-reactive cytotoxic t lymphocytes in vitro. | | 1979 | 315427 |
| pharmacological investigation on asclepin--a new cardenolide from asclepias curassavica. part ii. comparative studies on the inotropic and toxic effects of asclepin, g-strophantin, digoxin and digitoxin). | the cardiac effects of asclepin, a new glycoside from the plant asclepias curassavica, were studies in vitro (isolated atrium and heart of guineapig) and in vivo (anaesthetized cat) and were compared with g-strophanthin, digoxin, digitoxin, or digitoxigenin, resp. asclepin showed a marked positive inotropic effect as evidenced by the increase in the force of contraction, measured by (dp/dt)max and (formula: see text). it was found to be more active than the other glycosides. | 1978 | 380581 |
| volume and shape of normal human spermatozoa. | an improved apparatus for measuring the electrical size of particles, developed in this laboratory and based on the principle of the coulter counter, is used to size human spermatozoa. the typical size distribution is unimodel, with a skew to the right. the actual quantity determined by the measuring system is electrical size (i.e., shape factor x volume); in order to extract the volume, it is necessary to obtain an independence measure of particle shape. this is done by estimating the relative ... | 1977 | 321264 |
| site-specific recombination leading to the integration of phages p1 and p7. | | 1979 | 385221 |
| expression of human t lymphocyte antigens by killer cells. | k cells, the effectors of antibody-dependent cell-mediated cytotoxicity, were found to express human t but not b lymphocyte antigens detected by rabbit anti-htla and anti-hbla. pretreatment of effector cells with anti-htla+c inhibited adcc by specifically lysing k cells: no inhibition of adcc by anti-htla occurred when deltac was substituted for c. by contrast, pretreatment of effector cells with anti-hbla nonspecifically inhibited adcc, probably for forming antigen-antibody complexes with hbla+ ... | 1978 | 308964 |
| measuring the efficacy of vaccination in affording protection against plague. | the relationship of f1 antibody titre to protection against plague was investigated by subjecting seropositive laboratory rats to virulent challenge and observing for survival. the passive haemagglutination (pha) test in microtitre was employed for serology. rats vaccinated with live vaccine ev76 (51f), killed u.s.p. vaccine, or f1 antigen and challenged by subcutaneous inoculation of 1 x 10(3) to 5 x 10(5)yersinia pestis survived at similar rates that, overall, equalled 6% at titres less than 1 ... | 1979 | 312163 |
| veneral diseases. | | 1979 | 313576 |
| cell-mediated immunity in experimental nocardia asteroides infection. | experimental mycetoma-like lesions developed in guinea pigs after subcutaneous injection of nocardia asteroides. although delayed hypersensitivity appeared earlier, increased macrophage migration inhibition and microbicidal activity appeared after 7 weeks. when the lesions healed, high cell-mediated immunity was present. cell-mediated immunity was transferred to normal recipient guinea pigs from healed donor guinea pigs by spleen cell transfer. recipient guinea pigs showed marked protection agai ... | 1977 | 321348 |
| biological assay of potential trichomonacides in vitro using a counter apparatus. | utilising the accuracy and speed of a coulter counter for cell counting and sizing, a new method of antimicrobial assay has been developed in which the potency of inhibitors is calculated on a mol/cell basis. a total of 72 potential trichomonacides were screened against trichomonas vaginalis and the ed50 value estimated for 27 of the most interesting and potent compounds. the ed50 value for metronidazole was a mean of 5.12 fmol/cell and only 6 compounds were more potent. after the nitroimidazole ... | 1978 | 314804 |
| bacteriophage specificity in the identification of yersinia pestis as compared with other enterobacteria. | bacteriophage typing of yersinia pestis and the specificity of the phage among enterobacteriaceae were investigated. the bacteriophage used for rapid identification of y. pestis reacted with representative strains of all recognized species of shigella as well as with salmonella cholerae-suis. reactive shigella serotypes were sh. dysenteriae 1 and 9, sh. flexneri 2a, sh. boydii 1 and 6, and sh. sonnei. patterns consisting of isolated plaques (two cases) or absence of plaques were observed when th ... | 1978 | 375327 |
| artificial reproduction of arthritis in calves by intubation of a virulent strain of mycoplasma mycoides subsp mycoides. | | 1979 | 377780 |
| [ultrastructural changes in plague microbes, strain ev, and splenic cells of guinea pigs in their interaction in vitro]. | dilatation of the endoplasmic reticulum cavities, an increase in the number of ribosomes near bacteria, deformation of mitochondria and coarsening of cristae were revealed in phagocytosis of past. pestis, strain ev, by reticular cells in the tissue culture of the spleen of intact guinea pigs. lipophanerous "reticular" inclusions were found in the differentiated reticular cells of the infected cultures. in the reticular cell cytoplasma besides the intact bacteria there were revealed past. pestis ... | 1977 | 331769 |
| [neuramininase activity of the representatives of the genus yersinia]. | the authors demonstrated the presence of neuraminidase in past. pestis. optimal conditions for its formation and detection were chosen. extracellular form of neuraminidase was revealed. an increase of cultivation temperature led to the elevation of the neuraminidase activity in past. pestis cells. neuraminidase was revealed in bacteria affiliated to past. pestis (causative agents of pseudotuberculosis and y. enterocolitica). | 1977 | 331768 |
| a simple one-step hemolytic assay for c2 with c2-deficient human serum. | a simple one-step procedure has been developed for the molecular titration of c2 by utilizing the ability of the test material to restore the hemolytic activity of human serum selectively deficient in c2 (c2d serum). in this assay, equal volumes of ea (10(8) cells/ml), c2d serum (1/20), and a suitable dilution of a source of c2 were incubated at 37 degrees c for 60 min and the fraction of cells lysed was used to calculate the effective molecules of c2/ml test material. the assay can be used to t ... | 1977 | 321681 |
| sequence analysis of operator constitutive mutants of the tryptophan operon of escherichia coli. | | 1978 | 351194 |
| salmonellosis in red deer calves (cervus elaphus). | | 1978 | 355957 |
| [allergic reactivity and the hypothalamus]. | | 1978 | 355990 |
| cloning of chemically synthesized lactose operators. ii. ecori-linkered operators. | a 40 base, mainly duplex dna segment, with the following sequence paattccacatgtggaattgtgagcggataacaatttgtt (3') ggtgtacaccttaacactcgcctattgttaaacaccttaap (5') has been synthesized by combination of chemical and enzymatic methods. it consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the ecori restriction endonuclease. this segment has been ligated into the pmb9 plasmid and the resulting operator ... | 1978 | 357249 |
| repression of inducible enzyme synthesis in a mutant of escherichia coli k 12 deleted for the ptsh gene. | the genome of lambda phage with thermosensitive repressor was inserted into the pts region of the escherichia coli chromosome. this lysogenic culture possessed the pts1 phenotype at 30 degrees c. a mutant strain with a deletion covering the ptsh gene was isolated after a prophage curing procedure. the deletion nature of the pts mutation was confirmed in genetical and biochemical experiments. the deletion covered a small fragment of the bacterial genome not extending in the ptsi and lig genes. th ... | 1977 | 329116 |
| [enzymatic inactivation of levomycetin and penicillin by cells of the plague and pseudotuberculosis microbes that contain r plasmid depending on cultivation conditions]. | the activity of enzymes, inactivating levomycetin and penicillin in the cells of plague and pseudotuberculosis microbes bearing extrachromosomal determinants resistant to a number of antibiotics was studied as dependent on some cultivation parameters: population age, aeration rate and temperature. it was shown that the highest capacity for levomycetin acetylation was characteristic of the cells in the late logarithmic and early stationary growth phages. accumulation of levomycetin o-acetothers i ... | 1978 | 350142 |