Publications

TitleAbstractYear
Filter
PMID
Filter
characterization of bacteriocins from two strains of bacillus thermoleovorans, a thermophilic hydrocarbon-utilizing species.bacillus thermoleovorans s-ii and b. thermoleovorans nr-9 produce bacteriocins, and these bacteriocins are designated thermoleovorin-s2 and thermoleovorin-n9, respectively. the bacteriocins are effective against all but the producing strain of b. thermoleovorans, as well as being effective against salmonella typhimurium, branhamella catarrhalis, streptococcus faecalis, and thermus aquaticus. thermoleovorins are produced during log-phase growth and are inhibitory to actively growing cells. the ba ...19921514786
improved method for the routine identification of toxigenic escherichia coli by dna amplification of a conserved region of the heat-labile toxin a subunit.this report describes a dna amplification procedure for routine identification of heat-labile-toxin-producing escherichia coli. two oligonucleotide primers were used in a polymerase chain reaction procedure to amplify a highly conserved region of the a subunit of the heat-labile enterotoxin gene. amplifications were done directly on e. coli colonies from plates when salmonella, shigella, or parasite infections were excluded as agents of the severe diarrhea in the patients. the conditions for the ...19911993750
reverse transcription of mrna by thermus aquaticus dna polymerase. 19892478963
nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene from thermus aquaticus yt1. 19892602126
detection of enterotoxigenic escherichia coli after polymerase chain reaction amplification with a thermostable dna polymerase.the direct identification of enterotoxigenic escherichia coli from clinical specimens was examined by using the polymerase chain reaction (pcr) for amplifying the heat-labile toxin (lt) gene. two synthetic primers, each of which was 20 bases in length, were used with the thermostable dna polymerase from thermus aquaticus to amplify the lt gene. the amplified pcr products were detected by either gel electrophoresis or hybridization to a 24-base synthetic oligonucleotide probe conjugated to alkali ...19892644292
prenatal diagnosis of beta thalassaemia based on restriction endonuclease analysis of amplified fetal dna.in the mediterranean area, 50% of the beta thalassaemia mutations abolish or create a restriction endonuclease site in the beta globin gene. this study describes a new procedure for prenatal detection of these beta thalassaemia defects based on the direct visualisation, on an ethidium bromide stained polyacrylamide gel, of the discrete dna fragments produced by restriction endonuclease digestion of fetal dna, enzymatically amplified using the dna polymerase from the thermophilus bacterium thermu ...19892738898
nucleotide sequence of the succinyl-coa synthetase alpha-subunit from thermus aquaticus b. 19883186449
a second type ii restriction endonuclease from thermus aquaticus with an unusual sequence specificity.a type ii restriction endonuclease activity free of taqi was prepared from thermus aquaticus yt. the fraction contains two endonucleolytic components with apparently different specificities, however the major activity is sufficiently dominant to allow partial digestion analysis of the position of recognition sites. a precise determination of the location of cleavage sites in pbr322 dna and a computer-aided search for regions of homology in the vicinity of the cut sites indicate that this enzyme ...19846087291
purification and characterization of two new modification methylases: mclai from caryophanon latum l and mtaqi from thermus aquaticus yti.a method for detecting type ii modification methylases and determining their methylation site by assaying the ability of methylated dna to be cleaved by heterologous restriction enzymes is described and applied to the isolation of the restriction modification methylases from thermus thermophilus hb8, thermus aquaticus yti and caryophanon latum l. m.taqi is shown to have a methylation specificity identical to m.thi (tcgmea). m.clai methylates at adenine and protects a subset of tthi sites indicat ...19816278447
a soluble nadh dehydrogenase (nadh: ferricyanide oxidoreductase) from thermus aquaticus strain t351.a soluble nadh dehydrogenase (nadh:ferricyanide oxidoreductase) has been obtained by simple disruption of cells of thermus aquaticus strain t351, and purified. the enzyme is of low molecular mass, 50 000 da, and displays many of the properties of the membrane-bound enzyme, including inhibition by both nadh and ferricyanide, and the same km for ferricyanide. the enzyme contains 0.05 mol of fmn, 0.16 mol of labile sulphur and 2.2 mol of iron per mol of protein. the enzyme is inhibited by nad and c ...19836847628
sequences of the 5s rrnas of the thermo-acidophilic archaebacterium sulfolobus solfataricus (caldariella acidophila) and the thermophilic eubacteria bacillus acidocaldarius and thermus aquaticus.we have determined the nucleotide sequences of the 5 s rrnas of three thermophilic bacteria: the archaebacterium sulfolobus solfataricus, also named caldariella acidophila, and the eubacteria bacillus acidocaldarius and thermus aquaticus. a 5 s rna sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 s rna sequences and its base-pairing pattern. the corrected sequence aligns much better and fits in the universal five helix s ...19836878035
glycolipids from some extreme thermophilic bacteria belonging to the genus thermus.the lipids of thermus aquaticus yt1, thermus thermophilus hb8, thermus sp. strains h and j (from icelandic hot springs), and thermus sp. strain nh (from domestic hot water) have been investigated. each strain contained two major components, a glycolipid and a glycophospholipid, which have been isolated and analyzed. all of the strains contained as the principal component (41 to 57% of total lipid) a diacyldiglycosyl-(n-acyl)glycosaminylglucosylglycerol, but the five glycolipids differed in carbo ...19827054151
phylogenetic tree derived from bacterial, cytosol and organelle 5s rrna sequences.a phylogenetic tree was constructed by computer analysis of 47 completely determined 5s rrna sequences. the wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic gram-negative bacterium thermus aquaticus is comparable to the affinity between anacystis nidulans and chloroplastic sequences. this strongly supports the idea of an endosymbiotic origin of plant mitochondria. a comparison of the plant cytosol ...19816785727
the nucleotide sequence of 5s ribosomal rna from micrococcus lysodeikticus.the nucleotide sequence of ribosomal 5s rna from micrococcus lysodeikticus is pguuacggcggcuauagcgugggggaaacgcccggccguauaucgaacccggaagcuaagccccauagcgccgaugguuacuguaaccgggagguugugggagaguaggucgccgccgugaoh. when compared to other 5s rnas, the sequence homology is greatest with thermus aquaticus, and these two 5s rnas reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.19806780979
interactions of calcium and other metal ions with caldolysin, the thermostable proteinase from thermus aquaticus strain t351.caldolysin, the extracellular proteinase from the extreme thermophile thermus aquaticus strain t351, is stabilized by ca2+. a variety of metal ions were able to substitute for ca2+. most were unable to confer as much stability as ca2+, with the exception of the lanthanide ions, which increased the half-life at 95 degrees c from 1 h to more than 4 h. results from a variety of separation methods indicated that caldolysin binds 6 ca2+ ions/molecule of enzyme. the presence of non-linear ca2+ titrati ...19846383347
dna sequencing with thermus aquaticus dna polymerase and direct sequencing of polymerase chain reaction-amplified dna.the highly thermostable dna polymerase from thermus aquaticus (taq) is ideal for both manual and automated dna sequencing because it is fast, highly processive, has little or no 3'-exonuclease activity, and is active over a broad range of temperatures. sequencing protocols are presented that produce readable extension products greater than 1000 bases having uniform band intensities. a combination of high reaction temperatures and the base analog 7-deaza-2'-deoxyguanosine was used to sequence thr ...19883200828
purification and characterization of an inorganic pyrophosphatase from the extreme thermophile thermus aquaticus.an inorganic pyrophosphatase was purified over 600-fold to homogeneity as judged by polyacrylamide gel electrophoresis. the enzyme is a tetramer of mr = 84,000, has a sedimentation coefficient of 5.8s, a stokes radius of 3.5 nm, and an isoelectric point of 5.7. like the enzyme of escherichia coli, the pyrophosphatase appears to be made constitutively. the ph and temperature optima are 8.3 and 80 degrees c, respectively. the km for ppi is 0.6 mm. a divalent cation is essential, with mg2+ preferre ...19863020000
effects of oxygen and methyl viologen on thermus aquaticus.under increased oxygen tensions, thermus aquaticus exhibited a lag period in growth of 80 min, during which the specific activities of catalase, peroxidase, and superoxide dismutase increased. methyl viologen increased the lag period, decreased the maximum population density, increased cell lysis, and induced catalase and superoxide dismutase. methyl viologen, in conjunction with chloramphenicol, decreased cell viability.19882844735
genomic footprinting in mammalian cells with ultraviolet light.a simple and accurate genomic primer extension method has been developed to detect ultraviolet footprinting patterns of regulatory protein-dna interactions in mammalian genomic dna. the technique can also detect footprinting or sequencing patterns introduced into genomic dna by other methods. purified genomic dna, containing either damaged bases or strand breaks introduced by footprinting or sequencing reactions, is first cut with a convenient restriction enzyme to reduce its molecular weight. a ...19892748587
fidelity of dna polymerases in dna amplification.denaturing gradient gel electrophoresis (dgge) was used to separate and isolate the products of dna amplification by polymerase chain reaction (pcr). the strategy permitted direct enumeration and identification of point mutations created by t4, modified t7, klenow fragment of polymerase i, and thermus aquaticus (taq) dna polymerases. incorrectly synthesized sequences were separated from the wild type by dgge as mutant/wild-type heteroduplexes and the heteroduplex fraction was used to calculate t ...19892594764
novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic dna polymerases.dna polymerases catalyze the addition of deoxyribonucleotides onto dna primers in a template-directed manner. the requirement for template instruction distinguishes these enzymes from other nucleotidyl transferases, such as terminal deoxynucleotidyl transferase, that do not utilize a template. an oligonucleotide substrate was used to characterize a novel, non-templated nucleotide addition reaction carried out by dna polymerases from a variety of procaryotic and eucaryotic sources. the products o ...19882460825
high fidelity dna synthesis by the thermus aquaticus dna polymerase.we demonstrate that despite lacking a 3'----5' proofreading exonuclease, the thermus aquaticus (taq) dna polymerase can catalyze highly accurate dna synthesis in vitro. under defined reaction conditions, the error rate per nucleotide polymerized at 70 degrees c can be as low as 10(-5) for base substitution errors and 10(-6) for frameshift errors. the frequency of mutations produced during a single round of dna synthesis of the lac z alpha gene by taq polymerase responds to changes in dntp concen ...19902374708
the reca protein as a model molecule for molecular systematic studies of bacteria: comparison of trees of recas and 16s rrnas from the same species.the evolution of the reca protein was analyzed using molecular phylogenetic techniques. phylogenetic trees of all currently available complete reca proteins were inferred using multiple maximum parsimony and distance matrix methods. comparison and analysis of the trees reveal that the inferred relationships among these proteins are highly robust. the reca trees show consistent subdivisions corresponding to many of the major bacterial groups found in trees of other molecules including the alpha, ...19958587109
a nonsense mutation causing decreased levels of insulin receptor mrna: detection by a simplified technique for direct sequencing of genomic dna amplified by the polymerase chain reaction.mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. we have studied a patient with leprechaunism (leprechaun/minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. genomic dna from the patient was amplified by the polymerase chain reaction catalyzed by thermus aquaticus (taq) dna polymerase, and the amplified dna was directly sequenced. a nonsense mutation was identified at codon 897 in exo ...19902300553
characterization of the 5' to 3' exonuclease associated with thermus aquaticus dna polymerase.thermus aquaticus dna polymerase was shown to contain an associated 5' to 3' exonuclease activity. both polymerase and exonuclease activities cosedimented with a molecular weight of 72,000 during sucrose gradient centrifugation. using a novel in situ activity gel procedure to simultaneously detect these two activities, we observed both dna polymerase and exonuclease in a single band following either nondenaturing or denaturing polyacrylamide gel electrophoresis: therefore, dna polymerase and exo ...19902175431
random mutagenesis of thermus aquaticus dna polymerase i: concordance of immutable sites in vivo with the crystal structure.expression of thermus aquaticus (taq) dna polymerase i (pol i) in escherichia, coli complements the growth defect caused by a temperature-sensitive mutation in the host pol i. we replaced the nucleotide sequence encoding amino acids 659-671 of the o-helix of taq dna pol i, corresponding to the substrate binding site, with an oligonucleotide containing random nucleotides. functional taq pol i mutants were selected based on colony formation at the nonpermissive temperature. by using a library with ...19968790389
measurement of the sequence specificity of covalent dna modification by antineoplastic agents using taq dna polymerase.a polymerase stop assay has been developed to determine the dna nucleotide sequence specificity of covalent modification by antineoplastic agents using the thermostable dna polymerase from thermus aquaticus and synthetic labelled primers. the products of linear amplification are run on sequencing gels to reveal the sites of covalent drug binding. the method has been studied in detail for a number of agents including nitrogen mustards, platinum analogues and mitomycin c, and the sequence specific ...19912057351
formation of dna triplexes accounts for arrests of dna synthesis at d(tc)n and d(ga)n tracts.to study the mechanism of arrest of dna synthesis at d(tc)n and d(ga)n sequences, single-stranded dna molecules including d(tc)27 or d(tc)31 tracts or a d(ga)27 tract were used as templates for in vitro assays of complementary dna synthesis performed by extension of a primer with the klenow polymerase or the taq polymerase (thermus aquaticus dna polymerase). electrophoresis of the products revealed that arrests occurred around the middle of these tracts. the arrests in the d(tc)n sequences were ...19911988950
detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of thermus aquaticus dna polymerase.the 5'----3' exonuclease activity of the thermostable enzyme thermus aquaticus dna polymerase may be employed in a polymerase chain reaction product detection system to generate a specific detectable signal concomitantly with amplification. an oligonucleotide probe, nonextendable at the 3' end, labeled at the 5' end, and designed to hybridize within the target sequence, is introduced into the polymerase chain reaction assay. annealing of probe to one of the polymerase chain reaction product stra ...19911871133
determination of the structure of a novel glycolipid from thermus aquaticus 15004 and demonstration that hydroxy fatty acids are amide linked to glycolipids in thermus spp.the compositions of the major glycolipids (gl-1) of five strains of thermus aquaticus, the type strain of t. filiformis, t. oshimai sps-11, and thermnus sp. strain cg-2 were examined by gas chromatography, gas chromatography-mass spectroscopy, fast atom bombardment-mass spectroscopy, and chemical methods. the results showed that, with the exception of t. aquaticus 15004, the organisms each have a major glycolipid whose structure was established as diglycosyl-(n-acyl)glycosaminyl-glycosyl diacylg ...19968932304
isocitrate dehydrogenase from thermus aquaticus yt1: purification of the enzyme and cloning, sequencing, and expression of the gene.isocitrate dehydrogenase from an extremely thermophilic bacterium, thermus aquaticus yt1, was purified to homogeneity, and the gene was cloned by using a degenerate oligonucleotide probe based on the n-terminal sequence. the gene consisted of a single open reading frame of 1,278 bp preceded by a shine-dalgarno ribosome binding site, and a terminator-like sequence was detected downstream of the open reading frame. the g+c content of the coding region was 65%, and that of the third nucleotide of t ...19968953733
fidelity of thermococcus litoralis dna polymerase (vent) in pcr determined by denaturing gradient gel electrophoresis.dna synthesis fidelities of two thermostable dna polymerases, thermus aquaticus (taq) and thermococcus litoralis (tli, also known as vent), and a non-thermostable enzyme, a modified t7 dna polymerase (sequenase), were determined by analyzing polymerase chain reaction (pcr) products using denaturing gradient gel electrophoresis (dgge). the error rates were 4.4, 8.9, and 2.4 x 10(-5) errors/bp for modified t7, taq, and tli polymerase, respectively. reducing the nucleotide triphosphate concentratio ...19911870973
effects of different dna polymerases in ligation-mediated pcr: enhanced genomic sequencing and in vivo footprinting.we have developed a simplified procedure for the ligation-mediated polymerase chain reaction (lmpcr) using thermococcus litoralis dna polymerase (vent dna polymerase). we show that vent dna polymerase produces correct, blunt-ended primer extension products with substantially higher efficiency than thermus aquaticus (taq) dna polymerase or modified t7 dna polymerase (sequenase). this difference leads to significantly improved genomic sequencing, methylation analysis, and in vivo footprinting with ...19921736283
monofunctional dna-platinum(ii) adducts block frequently dna polymerases.the question of whether monofunctional dna platinum(ii) adducts block synthesis of dna by purified dna polymerases of different types and origin has been investigated by comparing the time dependence of synthesis arrest and of dna adduct formation. activated salmon testis dna is used as a suitable substrate for dna synthesis allowing to probe inhibition by platinum(ii) monoadducts for the variety of inherent template-primers. reaction amplitudes are related to defined mixtures of dichloro and ch ...19921594449
streptococcus pneumoniae dna polymerase i lacks 3'-to-5' exonuclease activity: localization of the 5'-to-3' exonucleolytic domain.the streptococcus pneumoniae pola gene was altered at various positions by deletions and insertions. the polypeptides encoded by these mutant pola genes were identified in s. pneumoniae. three of them were enzymatically active. one was a fused protein containing the first 11 amino acid residues of gene 10 from coliphage t7 and the carboxyl-terminal two-thirds of pneumococcal dna polymerase i; it possessed only polymerase activity. the other two enzymatically active proteins, which contained 620 ...19921548239
protein engineering reveals ancient adaptive replacements in isocitrate dehydrogenase.evolutionary analysis indicates that eubacterial nadp-dependent isocitrate dehydrogenases (ec 1.1.1.42) first evolved from an nad-dependent precursor about 3.5 billion years ago. selection in favor of utilizing nadp was probably a result of niche expansion during growth on acetate, where isocitrate dehydrogenase provides 90% of the nadph necessary for biosynthesis. amino acids responsible for differing coenzyme specificities were identified from x-ray crystallographic structures of escherichia c ...19979096353
extension of base mispairs by taq dna polymerase: implications for single nucleotide discrimination in pcr.thermus aquaticus (taq) dna polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. the transition mispairs, a(primer).c, c.a, g.t, and t.g were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for t.c and t.t, about 10(-6) for a.a, and less than 10(-6) for g.a, a.g, g.g and c.c. the tra ...19921408758
development of thermus-escherichia shuttle vectors and their use for expression of the clostridium thermocellum cela gene in thermus thermophilus.we describe the self-selection of replication origins of undescribed cryptic plasmids from thermus aquaticus y-vii-51b (atcc 25105) and a thermus sp. strain (atcc 27737) by random insertion of a thermostable kanamycin adenyltransferase cartridge. once selected, these autonomous replication origins were cloned into the escherichia coli vector puc9 or puc19. the bifunctional plasmids were analyzed for their sizes, relationships, and properties as shuttle vectors for thermus-escherichia cloning. se ...19921400194
dna synthesis blocking lesions induced by singlet oxygen are targeted to deoxyguanosines.in vitro dna synthesis on single stranded templates damaged by singlet oxygen was investigated in the supf trna gene sequence, using several dna polymerases. singlet oxygen was generated by the thermal decomposition of the water soluble with the endoperoxide of disodium 3,3'-(1,4-naphthylidene) dipropionate (ndpo2). the data demonstrated that damage at deoxyguanosine residues interrupts dna polymerization. modified t7 phage and thermus aquaticus dna polymerases were found to synthesize dna fragm ...19921375992
2',5'-bis-o-(tert-butyldimethylsilyl)-3'-spiro-5''-(4''-amino-1'',2''- oxathiole-2'',2'-dioxide)pyrimidine (tsao) nucleoside analogues: highlyselective inhibitors of human immunodeficiency virus type 1 that are targeted at the viral reverse transcriptase.a series of pyrimidine nucleoside analogues containing [2',5'-bis-o-(tert-butyldimethylsilyl)-3'-spiro-5''-(4''-amino- 1'',2''-oxathiole-2'',2''-dioxide)]-beta-d-ribofuranose as the pentose were found to inhibit human immunodeficiency virus type 1 [hiv-1(iiib)] replication at a concentration of 0.06-0.8 microm but were not cytotoxic at a 1000- to 10,000-fold higher concentration. these nucleoside derivatives were also effective against various other hiv-1 strains, including those resistant to 3' ...19921374900
the purification and some properties of a stereospecific d-asparaginase from an extremely thermophilic bacterium, thermus aquaticus.a specific d-asparaginase was isolated and crystallized from thermus aquaticus strain t351. it is present in larger amounts than the l-asparaginase. the enzyme has a molecular weight of 60 000, an isoelectric point of 4.8 and a km of 2 mm. it has 6 disulphide bonds/molecule, and a histidine residue at the active site. it is inhibited by keto acids and by high salt concentrations.19827115316
is wheat mitochondrial 5s ribosomal rna prokaryotic in nature?küntzel et al. (1981) (nucleic acids res. 9, 1451-1461) recently concluded that the sequence of wheat mitochondrial 5s rrna is significantly more related to prokaryotic than to eukaryotic 5s rrna sequences, and displays an especially high affinity to that of the thermophilic gram-negative bacterium, thermus aquaticus. however, the sequence on which this conclusion was based, although attributed to us, differs in several places from the one determined by us. we show here that the correct sequence ...19817024917
fidelity of dna synthesis catalyzed by human dna polymerase alpha and hiv-1 reverse transcriptase: effect of reaction ph.the accuracy of dna synthesis catalyzed by the thermus aquaticus dna polymerase and the 3'-->5' exonuclease-deficient klenow fragment of escherichia coli dna polymerase i varies as a function of reaction ph (eckert, k.a. and kunkel, t.a. (1990) nucleic acids res. 18, 3739-3744; eckert, k.a. and kunkel, t.a. (1993) j. biol. chem. 268, 13462-13471). in the current study, we demonstrate that the fidelity of human dna polymerase alpha increases 10-fold when the ph of the in vitro synthesis reaction ...19937504813
crystal structure of the large fragment of thermus aquaticus dna polymerase i at 2.5-a resolution: structural basis for thermostability.the crystal structure of the large fragment of the thermus aquaticus dna polymerase (klentaq1), determined at 2.5-a resolution, demonstrates a compact two-domain architecture. the c-terminal domain is identical in fold to the equivalent region of the klenow fragment of escherichia coli dna polymerase i (klenow pol i). although the n-terminal domain of klentaq1 differs greatly in sequence from its counterpart in klenow pol i, it has clearly evolved from a common ancestor. the structure of klentaq ...19957568114
template-switching during dna synthesis by thermus aquaticus dna polymerase i.recombinant dna molecules are often generated during the polymerase chain reaction (pcr) when partially homologous templates are available [e.g., see pääbo et al. (1990) j. biol. chem. 265, 4718-4721]. it has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent pcr cycles. however, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of ...19957596836
a single residue in dna polymerases of the escherichia coli dna polymerase i family is critical for distinguishing between deoxy- and dideoxyribonucleotides.bacteriophage t7 dna polymerase efficiently incorporates a chain-terminating dideoxynucleotide into dna, in contrast to the dna polymerases from escherichia coli and thermus aquaticus. the molecular basis for this difference has been determined by constructing active site hybrids of these polymerases. a single hydroxyl group on the polypeptide chain is critical for selectivity. replacing tyrosine-526 of t7 dna polymerase with phenylalanine increases discrimination against the four dideoxynucleot ...19957603992
characterization of ribonuclease p rnas from thermophilic bacteria.the catalytic rna component of bacterial rnase p is responsible for the removal of 5' leader sequences from precursor trnas. as part of an on-going phylogenetic comparative characterization of bacterial rnase p, the genes encoding rnase p rna from the thermophiles thermotoga maritima, thermotoga neapolitana, thermus aquaticus, and a mesophilic relative of the latter, deinococcus radiodurans, have been cloned and sequenced. rnas transcribed from these genes in vitro are catalytically active in th ...19937680125
catalytic-rate improvement of a thermostable malate dehydrogenase by a subtle alteration in cofactor binding.the nucleotide-binding fold of many nad(+)-dependent dehydrogenases contains a conserved acidic amino acid residue which hydrogen-bonds with the 2'- and 3'-hydroxy groups of the adenine-ribose of the cofactor. this residue is highly conserved as aspartate in malate dehydrogenases, except in the thermophilic enzyme from thermus aquaticus b (taqmdh), which has glutamic acid-41 in the equivalent position. the catalytic mechanism was dissected to investigate the functional significance of this diffe ...19957832772
a cold-adapted lipase of an alaskan psychrotroph, pseudomonas sp. strain b11-1: gene cloning and enzyme purification and characterization.a psychrotrophic bacterium producing a cold-adapted lipase upon growth at low temperatures was isolated from alaskan soil and identified as a pseudomonas strain. the lipase gene (lipp) was cloned from the strain and sequenced. the amino acid sequence deduced from the nucleotide sequence of the gene (924 bp) corresponded to a protein of 308 amino acid residues with a molecular weight of 33,714. lipp also has consensus motifs conserved in other cold-adapted lipases, i.e., lipase 2 from antarctic m ...19989464382
reverse transcriptase (rt) inhibition of pcr at low concentrations of template and its implications for quantitative rt-pcr.numerous instances of reverse transcriptase (rt) inhibition of the pcr were observed while developing nonquantitative uncoupled rt-pcr techniques for detecting nitrogenase and ammonia monooxygenase gene expression in situ. the inhibitory effect of rt on the pcr was removed with increasing template concentrations beyond 10(5) to 10(6) copies. including t4 gene 32 protein during the reverse transcription phase of the rt-pcr reaction increased the rt-pcr product yield by as much as 483%; if gene 32 ...19989464406
amplification of full-length hepatitis b virus genomes from samples from patients with low levels of viremia: frequency and functional consequences of pcr-introduced mutations.to facilitate the investigation of hepatitis b virus (hbv) sequence variation, we recently established a method for functional analysis of pcr-amplified full-length hbv genomes. this study aimed at estimating the number of mutations introduced during amplification of genomes from samples from patients with low levels of viremia and their influence on replication and antigen expression. wild-type hbv dna template molecules in concentrations like those present in samples from patients with very lo ...19989466771
three-dimensional structure of the adenine-specific dna methyltransferase m.taq i in complex with the cofactor s-adenosylmethionine.the thermus aquaticus dna methyltransferase m.taq i (ec 2.1.1.72) methylates n6 of adenine in the specific double-helical dna sequence tcga by transfer of --ch3 from the cofactor s-adenosyl-l-methionine. the x-ray crystal structure at 2.4-a resolution of this enzyme in complex with s-adenosylmethionine shows alpha/beta folding of the polypeptide into two domains of about equal size. they are arranged in the form of a c with a wide cleft suitable to accommodate the dna substrate. the n-terminal d ...19947971991
cloning and characterization of transcription of the xylab operon in thermoanaerobacter ethanolicus.the genes encoding xylose isomerase (xyla) and xylulose kinase (xylb) from the thermophilic anaerobe thermoanaerobacter ethanolicus were found to constitute an operon with the transcription initiation site 169 nucleotides upstream from the previously assigned (k. dekker, h. yamagata, k. sakaguchi, and s. udaka, agric. biol. chem. 55:221-227, 1991) promoter region. the bicistronic xylab mrna was processed by cleavage within the 5'-terminal portion of the xylb-coding sequence. transcription of xyl ...19989495747
identification and elimination of dna sequences in taq dna polymerase.this study confirms that different preparations of taq dna polymerase are contaminated with eubacterial dna. the contaminants appeared to represent more than one strain or species but were not identified as thermus aquaticus or escherichia coli. differences in microcentrifuge tube composition appeared to affect elimination of the contaminants.19947989558
cloning and sequencing of a 2,5-dichlorohydroquinone reductive dehalogenase gene whose product is involved in degradation of gamma-hexachlorocyclohexane by sphingomonas paucimobilis.sphingomonas (formerly pseudomonas) paucimobilis ut26 utilizes gamma-hexachlorocyclohexane (gamma-hch), a halogenated organic insecticide, as a sole carbon and energy source. in a previous study, we showed that gamma-hch is degraded to 2,5-dichlorohydroquinone (2,5-dchq) (y. nagata, r. ohtomo, k. miyauchi, m. fukuda, k. yano, and m. takagi, j. bacteriol. 176:3117-3125, 1994). in the present study, we cloned and characterized a gene, designated lind, directly involved in the degradation of 2,5-dc ...19989515900
endogenous pacemaker activity of rat tumour somatotrophs.1. cells derived from a rat pituitary tumour (gc cell line) that continuously release growth hormone behave as endogenous pacemakers. in simultaneous patch clamp recordings and cytosolic ca2+ concentration ([ca2+]i) imaging, they displayed rhythmic action potentials (44.7 +/- 2.7 mv, 178 +/- 40 ms, 0.30 +/- 0.04 hz) and concomitant [ca2+]i transients (374 +/- 57 nm, 1.0 +/- 0.2 s, 0.27 +/- 0.03 hz). 2. action potentials and [ca2+]i transients were reversibly blocked by removal of external ca2+, ...19989518740
the reca gene from the thermophile thermus aquaticus yt-1: cloning, expression, and characterization.we have cloned, expressed, and purified the reca analog from the thermophilic eubacterium thermus aquaticus yt-1. analysis of the deduced amino acid sequence indicates that the t. aquaticus reca is structurally similar to the escherichia coli reca and suggests that reca-like function has been conserved in thermophilic organisms. preliminary biochemical analysis indicates that the protein has an atp-dependent single-stranded dna binding activity and can pair and carry out strand exchange to form ...19948113181
structural polymorphism of the reca protein from the thermophilic bacterium thermus aquaticus.the escherichia coli reca protein has served as a model for understanding protein-catalyzed homologous recombination, both in vitro and in vivo. although reca proteins have now been sequenced from over 60 different bacteria, almost all of our structural knowledge about reca has come from studies of the e. coli protein. we have used electron microscopy and image analysis to examine three different structures formed by the reca protein from the thermophilic bacterium thermus aquaticus. this protei ...19958599679
rada protein is an archaeal reca protein homolog that catalyzes dna strand exchange.with the discovery that the saccharomyces cerevisiae rad51 protein is both structurally and functionally similar to the escherichia coli reca protein, the reca paradigm for homologous recombination was extended to the eucarya. the ubiquitous presence of reca and rad51 protein homologs raises the question of whether this archetypal protein exists within the third domain of life, the archaea. here we present the isolation of a rad51/reca protein homolog from the archaeon sulfolobus solfataricus, a ...19989573041
mutational analysis of the chlamydia trachomatis rrna p1 promoter defines four regions important for transcription in vitro.we have characterized the chlamydia trachomatis ribosomal promoter, rrna p1, by measuring the effect of substitutions and deletions on in vitro transcription with partially purified c. trachomatis rna polymerase. our analyses indicate that rrna p1 contains potential -10 and -35 elements, analogous to escherichia coli promoters recognized by e-sigma70. we identified a novel at-rich region immediately downstream of the -35 region. the effect of this region was specific for c. trachomatis rna polym ...19989573186
heterogeneity of primer extension products in asymmetric pcr is due both to cleavage by a structure-specific exo/endonuclease activity of dna polymerases and to premature stops.in pcr, dna polymerases from thermophilic bacteria catalyze the extension of primers annealed to templates as well as the structure-specific cleavage of the products of primer extension. here we show that cleavage by thermus aquaticus and thermus thermophilus dna polymerases can be precise and substantial: it occurs at the base of the stem-loop structure assumed by the single strand products of primer extension using as template a common genetic element, the promoter-operator of the escherichia ...19968610108
cloning, expression in escherichia coli, and characterization of arabidopsis thaliana ump/cmp kinase.a cdna encoding the arabidopsis thaliana uridine 5'-monophosphate (ump)/cytidine 5'-monophosphate (cmp) kinase was isolated by complementation of a saccharomyces cerevisiae ura6 mutant. the deduced amino acid sequence of the plant ump/cmp kinase has 50% identity with other eukaryotic ump/cmp kinase proteins. the cdna was subcloned into pgex-4t-3 and expressed as a glutathione s-transferase fusion protein in escherichia coli. following proteolytic digestion, the plant ump/cmp kinase was purified ...19989576794
peptide rescue of an n-terminal truncation of the stoffel fragment of taq dna polymerase.deletion of the first 289 amino acids of the dna polymerase from thermus aquaticus (taq polymerase) removes the 5' to 3' exonuclease domain to yield the thermostable stoffel polymerase fragment (lawyer et al., 1989). preliminary n-terminal truncation studies of the stoffel fragment suggested that removal of an additional 12 amino acids (the stof delta 12 mutant) had no significant effect on activity or stability, but that the further truncation of the protein (the stof delta 47, in which 47 amin ...19968880902
fluorescence correlation analysis of probe diffusion simplifies quantitative pathogen detection by pcr.a sensitive, labor-saving, and easily automatable nonradioactive procedure named apex-fcs (amplified probe extension detected by fluorescence correlation spectroscopy) has been established to detect specific in vitro amplification of pathogen genomic sequences. as an example, mycobacterium tuberculosis genomic dna was subjected to pcr amplification with the stoffel fragment of thermus aquaticus dna polymerase in the presence of nanomolar concentrations of a rhodamine-labeled probe (third primer) ...19968917500
a pcr-based assay for the detection of escherichia coli shiga-like toxin genes in ground beef.a detection system based on the pcr has been developed for escherichia coli strains which harbor the shiga-like toxin genes. this quantitative detection system involves the 5'-->3' nuclease activity of thermus aquaticus dna polymerase, which cleaves an internal oligonucleotide probe that has been labeled with both a fluorescent reporter dye (6-carboxy-fluorescein [fam]) and a quencher dye (6-carboxytetramethyl-rhodamine [tamra]). parameters which affected the performance of the assay included pr ...19968919796
the b12-dependent ribonucleotide reductase from the archaebacterium thermoplasma acidophila: an evolutionary solution to the ribonucleotide reductase conundrum.a coenzyme b12-dependent ribonucleotide reductase was purified from the archaebacterium thermoplasma acidophila and partially sequenced. using probes derived from the sequence, the corresponding gene was cloned, completely sequenced, and expressed in escherichia coli. the deduced amino acid sequence shows that the catalytic domain of the b12-dependent enzyme from t. acidophila, some 400 amino acids, is related by common ancestry to the diferric tyrosine radical iron(iii)-dependent ribonucleotide ...19978990160
stabilized, freeze-dried pcr mix for detection of mycobacteria.we report here the development of a freeze-drying procedure allowing stabilization at ambient temperature of preoptimized, premixed, and predispensed pcr mixes aimed at the detection of mycobacteria in clinical materials. the freeze-dried mixes retained activity at 4 degrees c and at 20 degrees c for 1 year and for 3 months at 37 degrees c, as judged by their performance with 50 and 500 fg of purified mycobacterium bovis bcg target dna.19989620427
sequencing of heat shock protein 70 (dnak) homologs from deinococcus proteolyticus and thermomicrobium roseum and their integration in a protein-based phylogeny of prokaryotes.the 70-kda heat shock protein (hsp70) sequences define one of the most conserved proteins known to date. the hsp70 genes from deinococcus proteolyticus and thermomicrobium roseum, which were chosen as representatives of two of the most deeply branching divisions in the 16s rrna trees, were cloned and sequenced. hsp70 from both these species as well as thermus aquaticus contained a large insert in the n-terminal quadrant, which has been observed before as a unique characteristic of gram-negative ...19978990285
the thioredoxin binding domain of bacteriophage t7 dna polymerase confers processivity on escherichia coli dna polymerase i.bacteriophage t7 dna polymerase shares extensive sequence homology with escherichia coli dna polymerase i. however, in vivo, e. coli dna polymerase i is involved primarily in the repair of dna whereas t7 dna polymerase is responsible for the replication of the viral genome. in accord with these roles, t7 dna polymerase is highly processive while e. coli dna polymerase i has low processivity. the high processivity of t7 dna polymerase is achieved through tight binding to its processivity factor, ...19979012809
thermotoga neapolitana homotetrameric xylose isomerase is expressed as a catalytically active and thermostable dimer in escherichia coli.the xyla gene from thermotoga neapolitana 5068 was expressed in escherichia coli. gel filtration chromatography showed that the recombinant enzyme was both a homodimer and a homotetramer, with the dimer being the more abundant form. the purified native enzyme, however, has been shown to be exclusively tetrameric. the two enzyme forms had comparable stabilities when they were thermoinactivated at 95 degrees c. differential scanning calorimetry revealed thermal transitions at 99 and 109.5 degrees ...19989647799
a highly selective pcr protocol for detecting 16s rrna genes of the genus pseudomonas (sensu stricto) in environmental samples.pseudomonas species are plant, animal, and human pathogens; exhibit plant pathogen-suppressing properties useful in biological control; or express metabolic versatilities valued in biotechnology and bioremediation. specific detection of pseudomonas species in the environment may help us gain a more complete understanding of the ecological significance of these microorganisms. the objective of this study was to develop a pcr protocol for selective detection of pseudomonas (sensu stricto) in envir ...19989647828
comparison of the abi 7700 system (taqman) and competitive pcr for quantification of is6110 dna in sputum during treatment of tuberculosis.mycobacterium tuberculosis can persist in sputum for long periods of time after the initiation of antituberculosis chemotherapy. the purpose of this study was to determine whether quantitative estimates of m. tuberculosis dna in sputum correlate with the numbers of viable bacilli and thus measure the therapeutic response of patients during treatment. two methods of m. tuberculosis dna quantification were examined by using dna isolated from sputum specimens serially collected during the course of ...19989650945
highly purified cd25- resting t cells cannot be infected de novo with hiv-1.previous studies have demonstrated that the expression of cd25 can distinguish cd25- latently infected cells from cd25+ cells actively producing virus. our studies were designed to characterize the nature and stability of the viral genome in cd25- quiescent hiv-1-infected cells and to determine whether these cells could be infected de novo with hiv-1. our results show that: (i) when unfractionated peripheral blood mononuclear cells are first infected with hiv-1 and the cd25- cells then isolated, ...19979037058
tumor necrosis factor alpha and interleukin 1beta enhance the cortisone/cortisol shuttle.endogenously released or exogenously administered glucocorticosteroids are relevant hormones for controlling inflammation. only 11beta-hydroxy glucocorticosteroids, but not 11-keto glucocorticosteroids, activate glucocorticoid receptors. since we found that glomerular mesangial cells (gmc) express 11beta-hydroxysteroid dehydrogenase 1 (11beta-ohsd1), which interconverts 11-keto glucocorticosteroids into 11beta-hydroxy glucocorticosteroids (cortisone/cortisol shuttle), we explored whether 11beta- ...19979221748
retention of replication fidelity by a dna polymerase functioning in a distantly related environment.the primary structures of the replicative dna polymerases (gp43s) of bacteriophage t4 and its distant phylogenetic relative rb69 are diverged, retaining only 61% identity and 74% similarity. nevertheless, rb69 gp43 substitutes effectively for t4 gp43 in t4 dna replication in vivo. we show here that rb69 gp43 replicates t4 genomes in vivo with a fidelity similar to that achieved by t4 gp43. furthermore, replication by rb69 gp43 in the distantly related environment does not enhance the mutator act ...19979223311
the disulfide-bonded structure of feline herpesvirus glycoprotein i.alphaherpesvirus glycoproteins e and i (ge and gi, respectively) assemble into a hetero-oligomeric complex which promotes cell-to-cell transmission, a determining factor of virulence. focusing on gi of feline herpesvirus (fhv), we examined the role of disulfide bonds during its biosynthesis, its interaction with ge, and ge-gi-mediated spread of the infection in vitro. the protein's disulfide linkage pattern was determined by single and pairwise substitutions for the four conserved cysteine resid ...19989696819
screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18.a systematic screen termed the allelic message display (amd) was developed for the hunting of imprinted genes. in amd, differential display pcr is adopted to image allelic expression status of multiple polymorphic transcripts in two parental mouse strains, reciprocal f1 hybrids and pooled backcross progenies. from the displayed patterns, paternally and maternally expressed transcripts can be unequivocally identified. the effectiveness of amd screening was clearly demonstrated by the identificati ...19979256468
prokaryotic 5'-3' exonucleases share a common core structure with gamma-delta resolvase.the three dimensional crystal structure of t5 5'-3' exonuclease was compared with that of two other members of the 5'-3' exonuclease family: t4 ribonuclease h and the n-terminal domain of thermus aquaticus dna polymerase i. though these structures were largely similar, some regions of these enzymes show evidence of significant molecular flexibility. previous sequence analysis had suggested the existence of a helix-hairpin-helix motif in t5 exonuclease, but a distinct, though related structure is ...19979336450
template directed incorporation of nucleotide mixtures using azole-nucleobase analogs.dna that encodes elements for degenerate replication events by use of artificial nucleobases offers a versatile approach to manipulating sequences for applications in biotechnology. we have designed a family of artificial nucleobases that are capable of assuming multiple hydrogen bonding orientations through internal bond rotations to provide a means for degenerate molecular recognition. incorporation of these analogs into a single position of a pcr primer allowed for analysis of their template ...19979396789
differentiation of phylogenetically related slowly growing mycobacteria based on 16s-23s rrna gene internal transcribed spacer sequences.interspecific polymorphisms of the 16s rrna gene (rdna) are widely used for species identification of mycobacteria. 16s rdna sequences, however, do not vary greatly within a species, and they are either indistinguishable in some species, for example, in mycobacterium kansasii and m. gastri, or highly similar, for example, in m. malmoense and m. szulgai. we determined 16s-23s rdna internal transcribed spacer (its) sequences of 60 strains in the genus mycobacterium representing 13 species (m. aviu ...19989431937
a family of human receptors structurally related to drosophila toll.the discovery of sequence homology between the cytoplasmic domains of drosophila toll and human interleukin 1 receptors has sown the conviction that both molecules trigger related signaling pathways tied to the nuclear translocation of rel-type transcription factors. this conserved signaling scheme governs an evolutionarily ancient immune response in both insects and vertebrates. we report the molecular cloning of a class of putative human receptors with a protein architecture that is similar to ...19989435236
identification of the rrma gene encoding the 23s rrna m1g745 methyltransferase in escherichia coli and characterization of an m1g745-deficient mutant.an escherichia coli mutant lacking the modified nucleotide m1g in rrna has previously been isolated (g. r. björk and l. a. isaksson, j. mol. biol. 51:83-100, 1970). in this study, we localize the position of the m1g to nucleotide 745 in 23s rrna and characterize a mutant deficient in this modification. this mutant shows a 40% decreased growth rate in rich media, a drastic reduction in loosely coupled ribosomes, a 20% decreased polypeptide chain elongation rate, and increased resistance to the ri ...19989440525
comparative analysis of haemophilus influenzae hifa (pilin) genes.adherence of haemophilus influenzae to epithelial cells plays a central role in colonization and is the first step in infection with this organism. pili, which are large polymorphic surface proteins, have been shown to mediate the binding of h. influenzae to cells of the human respiratory tract. earlier experiments have demonstrated that the major epitopes of h. influenzae pili are highly conformational and immunologically heterogenous; their subunit pilins are, however, immunologically homogeno ...19989453623
ccpb, a novel transcription factor implicated in catabolite repression in bacillus subtilis.recent work has shown that in bacillus subtilis catabolite repression of several operons is mediated by a mechanism dependent on dna-binding protein ccpa complexed to a seryl-phosphorylated derivative of hpr [hpr(ser-p)], the small phosphocarrier protein of the phosphoenolpyruvate-sugar phosphotransferase system. in this study, it was found that a transposon insertional mutation resulted in the partial loss of gluconate (gnt) and xylose (xyl) operon catabolite repression by glucose, mannitol, an ...19989457849
expression of anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia.anaplasma marginale is an intraerythrocytic rickettsial pathogen of cattle in which infection persists for the life of the animal. persistent a. marginale infection is characterized by repetitive rickettsemic cycles which we hypothesize reflect emergence of a. marginale antigenic variants. in this study, we determined whether variants of major surface protein 2 (msp-2), a target of protective immunity encoded by a polymorphic multigene family, arise during persistent rickettsemia. by using a qua ...19989488414
the crystal structure of pyrococcus furiosus ornithine carbamoyltransferase reveals a key role for oligomerization in enzyme stability at extremely high temperatures.the pyrococcus furiosus (pf) ornithine carbamoyltransferase (otcase; ec 2.1.3.3) is an extremely heat-stable enzyme that maintains about 50% of its activity after heat treatment for 60 min at 100 degrees c. to understand the molecular basis of thermostability of this enzyme, we have determined its three-dimensional structure at a resolution of 2.7 a and compared it with the previously reported structures of otcases isolated from mesophilic bacteria. most otcases investigated up to now are homotr ...19989501170
nadp-isocitrate dehydrogenase from pseudomonas nautica: kinetic constant determination and carbon limitation effects on the pool of intracellular substrates.variations of intracellular concentrations of isocitrate and nadp+ were measured throughout all growth phases of the marine bacterium pseudomonas nautica. the intracellular isocitrate concentration tracked the intracellular protein concentration throughout all phases of growth. it rapidly increased in early exponential phase to a maximum and fell to nearly zero in parallel with pyruvate exhaustion in the culture medium. the intracellular nadp+ and protein concentrations increased in parallel dur ...19989835589
a natural view of microbial biodiversity within hot spring cyanobacterial mat communities.this review summarizes a decade of research in which we have used molecular methods, in conjunction with more traditional approaches, to study hot spring cyanobacterial mats as models for understanding principles of microbial community ecology. molecular methods reveal that the composition of these communities is grossly oversimplified by microscopic and cultivation methods. for example, none of 31 unique 16s rrna sequences detected in the octopus spring mat, yellowstone national park, matches t ...19989841675
protein phylogenies and signature sequences: a reappraisal of evolutionary relationships among archaebacteria, eubacteria, and eukaryotes.the presence of shared conserved insertion or deletions (indels) in protein sequences is a special type of signature sequence that shows considerable promise for phylogenetic inference. an alternative model of microbial evolution based on the use of indels of conserved proteins and the morphological features of prokaryotic organisms is proposed. in this model, extant archaebacteria and gram-positive bacteria, which have a simple, single-layered cell wall structure, are termed monoderm prokaryote ...19989841678
ppi-dependent phosphofructokinase from thermoproteus tenax, an archaeal descendant of an ancient line in phosphofructokinase evolution.flux into the glycolytic pathway of most cells is controlled via allosteric regulation of the irreversible, committing step catalyzed by atp-dependent phosphofructokinase (pfk) (atp-pfk; ec 2.7.1.11), the key enzyme of glycolysis. in some organisms, the step is catalyzed by ppi-dependent pfk (ppi-pfk; ec 2.7.1.90), which uses ppi instead of atp as the phosphoryl donor, conserving atp and rendering the reaction reversible under physiological conditions. we have determined the enzymic properties o ...19989555897
the genome of melanoplus sanguinipes entomopoxvirus.the family poxviridae contains two subfamilies: the entomopoxvirinae (poxviruses of insects) and the chordopoxvirinae (poxviruses of vertebrates). here we present the first characterization of the genome of an entomopoxvirus (epv) which infects the north american migratory grasshopper melanoplus sanguinipes and other important orthopteran pests. the 236-kbp m. sanguinipes epv (msepv) genome consists of a central coding region bounded by 7-kbp inverted terminal repeats and contains 267 open readi ...19999847359
phylogenetic evidence for the existence of novel thermophilic bacteria in hot spring sulfur-turf microbial mats in japan.so-called sulfur-turf microbial mats, which are macroscopic white filaments or bundles consisting of large sausage-shaped bacteria and elemental sulfur particles, occur in sulfide-containing hot springs in japan. however, no thermophiles from sulfur-turf mats have yet been isolated as cultivable strains. this study was undertaken to determine the phylogenetic positions of the sausage-shaped bacteria in sulfur-turf mats by direct cloning and sequencing of 16s rrna genes amplified from the bulk dn ...19989572936
sequence divergence of seryl-trna synthetases in archaea.the genomic sequences of methanococcus jannaschii and methanobacterium thermoautotrophicum contain a structurally uncommon seryl-trna synthetase (serrs) sequence and lack an open reading frame (orf) for the canonical cysteinyl-trna synthetase (cysrs). therefore, it is not clear if cys-trnacys is formed by direct aminoacylation or by a transformation of serine misacylated to trnacys. to address this question, we prepared serrs from two methanogenic archaea and measured the enzymatic properties of ...19989851985
nadh dehydrogenase defects confer isoniazid resistance and conditional lethality in mycobacterium smegmatis.isoniazid (inh) is a highly effective drug used in the treatment and prophylaxis of mycobacterium tuberculosis infections. resistance to inh in clinical isolates has been correlated with mutations in the inha, katg, and ahpc genes. in this report, we describe a new mechanism for inh resistance in mycobacterium smegmatis. mutations that reduce nadh dehydrogenase activity (ndh; type ii) cause multiple phenotypes, including (i) coresistance to inh and a related drug, ethionamide; (ii) thermosensiti ...19989573199
properties of mutant shv-5 beta-lactamases constructed by substitution of isoleucine or valine for methionine at position 69.the effect of replacement of met-69 by ile or val on the properties of the extended-spectrum beta-lactamase shv-5 was studied. mutant enzymes were constructed by site-specific mutagenesis and expressed under isogenic conditions in escherichia coli dh5alpha cells. compared with shv-5, the mutant beta-lactamases conferred lower levels of beta-lactam resistance and were less efficient in hydrolyzing ampicillin, cephalothin, and cefotaxime. the substitutions rendered shv-5 less susceptible to inhibi ...19989593168
structure of the beta-galactosidase gene from thermus sp. strain t2: expression in escherichia coli and purification in a single step of an active fusion protein.the nucleotide sequence of both the bgaa gene, coding for a thermostable beta-galactosidase of thermus sp. strain t2, and its flanking regions was determined. the deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (mr, 73,595). comparative analysis of the open reading frames located in the flanking regions of the bgaa gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. the observed homology between the deduced amino a ...19989603833
peptidoglycan fine structure of the radiotolerant bacterium deinococcus radiodurans sark.peptidoglycan from deinococcus radiodurans was analyzed by high-performance liquid chromatography and mass spectrometry. the monomeric subunit was: n-acetylglucosamine-n-acetylmuramic acid-l-ala-d-glu-(gamma)-l-orn-[(delta)gly-gly]-d-ala-d-ala. cross-linkage was mediated by (gly)2 bridges, and glycan strands were terminated in (1-->6)anhydro-muramic acid residues. structural relations with the phylogenetically close thermus thermophilus are discussed.19999864347
crystal structures of the klenow fragment of thermus aquaticus dna polymerase i complexed with deoxyribonucleoside triphosphates.the crystal structures of the klenow fragment of the thermus aquaticus dna polymerase i (klentaq1) complexed with four deoxyribonucleoside triphosphates (dntp) have been determined to 2.5 a resolution. the dntps bind adjacent to the o helix of klentaq1. the triphosphate moieties are at nearly identical positions in all four complexes and are anchored by three positively charged residues, arg659, lys663, and arg587, and by two polar residues, his639 and gln613. the configuration of the base moiet ...19989605316
non-homologous recombination mediated by thermus aquaticus dna polymerase i. evidence supporting a copy choice mechanism.rt-pcr amplification of p450 2c6 from rat liver, using primers in opposite orientations of exon 6, resulted in pcr products containing segments of exons joined at non-consensus splice sites. moreover, many of the pcr products identified were composed of not only a single region containing exonic segments joined at non-consensus splice sites but, instead, of several repeats of the non-canonically joined region. to investigate whether these pcr products represent pre-existing molecules or are gene ...19989611226
anaerobic growth, a property horizontally transferred by an hfr-like mechanism among extreme thermophiles.despite the fact that the extreme thermophilic bacteria belonging to the genus thermus are classified as strict aerobes, we have shown that thermus thermophilus hb8 (atcc 27634) can grow anaerobically when nitrate is present in the growth medium. this strain-specific property is encoded by a respiratory nitrate reductase gene cluster (nar) whose expression is induced by anoxia and nitrate (s. ramírez-arcos, l. a. fernández-herrero, and j. berenguer, biochim. biophys. acta, 1396:215-1997). we sho ...19989620963
Displaying items 1 - 100 of 1701