bacteriolytic activity caused by the presence of a novel lactococcal plasmid encoding lactococcins a, b, and m. | lactococcus lactis subsp. lactis biovar diacetylactis dpc938 was identified as a bacteriocin-producing strain which exhibited a bacteriolytic effect on other lactococci. lysis of such target strains was associated with decreases in optical density and release of the intracellular enzyme lactate dehydrogenase. dpc938 exhibits cross-immunity to l. lactis subsp. cremoris 9b4 (m.j. van belkum, b.j. hayema, a. geis, j. kok, and g. venema, appl. environ. microbiol. 55:1187-1191, 1989), a strain which ... | 1995 | 7487031 |
oligopeptides are the main source of nitrogen for lactococcus lactis during growth in milk. | the consumption of amino acids and peptides was monitored during growth in milk of proteinase-positive (prt+) and -negative (prt-) strains of lactococcus lactis. the prt- strains showed monophasic exponential growth, while the prt+ strains grew in two phases. the first growth phases of the prt+ and prt- strains were in same, and no hydrolysis of casein was observed. also, the levels of consumption of amino acids and peptides in the prt+ and prt- strains were similar. at the end of this growth ph ... | 1995 | 7487034 |
characterization of plasmid-encoded citrate permease (citp) genes from leuconostoc species reveals high sequence conservation with the lactococcus lactis citp gene. | the citrate permease determinant (citp) in several leuconostoc strains was demonstrated to be plasmid encoded by curing experiments and hybridization studies with a dna fragment containing the citp gene from lactococcus lactis subsp. lactis biovar diacetylactis ncdo176. cloning and nucleotide sequence analysis of leuconostoc lactis nz6070 citp revealed almost complete identity to lactococcal citp. | 1995 | 7487049 |
the isolation of lactococcal promoters and their use in investigating bacterial luciferase synthesis in lactococcus lactis. | 18 different promoter elements, encompassing a 71-fold range of activity, were isolated from the chromosome of lactococcus lactis (ll) mg1363 and from an uncharacterised small isometric bacteriophage of ll. the vibrio fischeri (vf) luciferase-encoding gene (lux) was used as a reporter in ll, so that the promoters could be identified strictly on the basis of their activity in the homologous host. sequence and primer extension analysis of six of the promoters has provided a new consensus sequence ... | 1995 | 7489923 |
an archaeal gene upstream of grpe different from eubacterial counterparts. | in some eubacteria with a dnak locus in which grpe is close upstream of dnak, grpe is preceded by an open reading frame (orf) believed to be a heat-shock gene. we also found an orf, orf16, upstream of grpe in the archaeon methanosarcina mazei s-6, but this gene differs from the eubacterial counterpart: it is shorter, does not respond to a temperature upshift as heat-shock genes do, and the deduced protein orf16, does not resemble the proteins coded by the eubacterial equivalents. orf16 is expres ... | 1995 | 7495860 |
expression of foreign genes and selection of promoter sequences in acholeplasma laidlawii. | the stable maintenance and expression of foreign genes in mollicutes (mycoplasmas) have been difficult to achieve due to the lack of suitable vectors. in this paper we show for the first time that a replicating vector can been used to express foreign genes other than antibiotic resistance genes in acholeplasma laidlawii. plasmids derived from the lactococcal vector pnz18 could introduce and maintain four different genes for many generations in a. laidlawii. one of these, encoding the dominant me ... | 1995 | 7496518 |
in vitro fructooligosaccharide utilization and inhibition of salmonella spp. by selected bacteria. | in vitro experiments were conducted to determine: 1) inhibitory capacities of potential direct-fed microbial bacteria against salmonella serotypes; and 2) the ability of bifidobacterium bifidum, enterococcus faecium, lactobacillus casei, lactococcus lactis, pediococcus sp., and salmonella spp. to grow in media containing fructooligosaccharides (fos-50 or fos pure formulation) as the only carbohydrate source. thirteen bacteria (two strains of bacillus coagulans, bacillus licheniformis, bacillus s ... | 1995 | 7501585 |
genetic and molecular analysis of the rpod gene from lactococcus lactis. | a gene of lactococcus lactis atcc19435, the product of which is homologous with the principal sigma factors of escherichia coli and bacillus subtilis, was cloned and sequenced. the deduced amino acid sequence of the 340-residue protein and the upstream open reading frame of the cloned gene showed a homology to b. subtilis sigma 43 factor (the rpod product) and dna primase (the dnae product), respectively, suggesting that l. lactis also has the rpod operon. surprisingly, introduction of the clone ... | 1993 | 7503808 |
physiological and genetic regulation of rrna synthesis in lactococcus. | the macromolecular composition of lactococcus was regulated by growth rate in the same general way as that of less fastidious bacteria such as escherichia coli and salmonella typhimurium. the ratios of rna:dna and rna:protein increased approximately threefold over a 13.5-fold increase in growth rate, whereas the ratio of dna:protein remained approximately constant. using reporter genes fused to a dna fragment of a cloned lactococcal rrna operon, promoter activity was located upstream of the 16s ... | 1993 | 7504067 |
isolation of lactococcus lactis subsp. cremoris from nature by colony hybridization with rrna probes. | lactococcus lactis subsp. cremoris is widely used in the manufacture of fermented milk products. despite numerous attempts, efforts to isolate new strains by traditional plating and identification methods have not been successful. previously, we described oligonucleotide probes for 16s rrnas which could be used to discriminate l. lactis subsp. cremoris from related strains. these probes were used in colony hybridization experiments to screen large numbers of colonies obtained from enrichment cul ... | 1993 | 7506898 |
in vivo restriction by llai is encoded by three genes, arranged in an operon with llaim, on the conjugative lactococcus plasmid ptr2030. | the llai restriction and modification (r/m) system is encoded on ptr2030, a 46.2-kb conjugative plasmid from lactococcus lactis. the llai methylase gene, sequenced previously, encodes a functional type iis methylase and is located approximately 5 kb upstream from the abia gene, encoding abortive phage resistance. in this study, the sequence of the region between llaim and abia was determined and revealed four consecutive open reading frames (orfs). northern (rna) analysis showed that the four or ... | 1995 | 7528201 |
evidence for a large dispensable segment in the subtilisin-like catalytic domain of the lactococcus lactis cell-envelope proteinase. | the lactococcus lactis sk11 cell-envelope proteinase contains various inserts, located in external loops of the catalytic domain compared with related subtilisins. in this study, protein engineering was employed to determine the function of the largest loop insertion (residues 238-388) relative to the subtilisin structure. by site-directed mutagenesis we have deleted the fragment of the proteinase gene encoding these 151 residues and analyzed the mutant delta 238-388 proteinase for activity, (au ... | 1994 | 7528919 |
[the immunostimulating action of lactobacteria on the cytotoxicity of natural killer cells and interferon production]. | | 1994 | 7533464 |
mode of action of lcia, the lactococcin a immunity protein. | monoclonal antibodies were raised against a fusion between the escherichia coli maltose-binding protein and lcia, the immunity protein that protects lactococcus lactis against the effects of the bacteriocin lactococcin a. one of the antibodies directed against the lcia moiety of the fusion protein was used to locate the immunity protein in the l. lactis producer cell. lcia was present in the cytosolic, the membrane-associated, and the membrane fractions in roughly equal amounts, irrespective of ... | 1994 | 7533883 |
the lactococcus lactis triosephosphate isomerase gene, tpi, is monocistronic. | triosephosphate isomerase (ec 5.3.1.1) from lactococcus lactis was purified to electrophoretic homogeneity. approximately 3 mg purified enzyme (specific activity 3300 u mg-1) was obtained from 70 g (wet wt) cells. in solution, triosephosphate isomerase (pi 4.0-4.4) was observed to exist as a homodimer (m(r) 57,000) of noncovalently linked subunits. the sequence of the first 37 amino acid residues from the nh2-terminus were determined by step-wise edman degradation. this sequence, and that of a r ... | 1995 | 7534588 |
citrate utilization gene cluster of the lactococcus lactis biovar diacetylactis: organization and regulation of expression. | the transport of citrate in lactococcus lactis biovar diacetylactis is mediated by the citrate permease p. this polypeptide is encoded by the citp gene carried by plasmid pcit264. in this report, we characterize the citp transcript, identify a cluster of two genes cotranscribed with citp and describe their post-transcriptional regulation. the transcriptional promoter is located 1500 nucleotides upstream of the citp gene and the transcriptional terminator is positioned next to the 3'-end of this ... | 1995 | 7535377 |
specific antibody-mediated detection of brochothrix thermosphacta in situ in british fresh sausage. | a rabbit polyclonal antibody-linked probe was developed which detected 76% of 800 food isolates of the spoilage bacterium brochothrix thermosphacta when cells were bound to nitrocellulose. in slide cross-reaction tests all six environmental isolates tested were stained but the type strain was not. the antibody did not cross-react with listeria grayi, l. monocytogenes, lactobacillus plantarum, lactococcus lactis, streptococcus mutans, bacillus cereus or b. subtilis. the antibody-linked probe dete ... | 1995 | 7538105 |
characterization of prokaryotic mrnas by rt-pcr. | | 1995 | 7542457 |
enhancement of antigen-specific antibody production by extracellular slime products from slime-forming lactococcus lactis subspecies cremoris sbt 0495 in mice. | the effect of extracellular slime products (esp) produced by lactococcus lactis subspecies cremoris sbt 0495 on antigen specific antibody production was studied in mice. esp contained 48.5% protein, 15.4% neutral sugar, and 1.1% of phosphorus. the optimum dose of esp was between 100 to 500 micrograms per mouse. esp administered intraperitoneally (200 micrograms per mouse) enhanced the production of specific antibody in mice. these results indicate that esp may act as an adjuvant. | 1995 | 7547146 |
transformation of lactococcus by electroporation. | | 1995 | 7550735 |
nucleotide sequence of the lantibiotic pep5 biosynthetic gene cluster and functional analysis of pepp and pepc. evidence for a role of pepc in thioether formation. | the biosynthesis of pep5, a lanthionine-containing antimicrobial peptide, is directed by the 20-kbp plasmid ped503. we identified a 7.9-kbp dna-fragment within this plasmid which covers the information for pep5 synthesis in the homologous host staphylococcus epidermidis 5 which has been cured of ped503. this fragment contained, in addition to the previously described structural gene pepa and the immunity gene pepi [reis, m., eschbach-bludau, m., iglesias-wind, m. i., kupke, t. & sahl, h.-g. (199 ... | 1995 | 7556197 |
characterization of superoxide dismutase genes from gram-positive bacteria by polymerase chain reaction using degenerate primers. | an internal fragment representing approximately 85% of sod genes from seven gram-positive bacteria was amplified by using degenerate primers in a polymerase chain reaction assay. the dna sequences of sod polymerase chain reaction products from clostridium perfringens, enterococcus faecalis, enterococcus faecium, lactococcus lactis, staphylococcus aureus, streptococcus agalactiae, streptococcus pneumoniae, and streptococcus pyogenes were determined. comparisons of their deduced amino acid sequenc ... | 1995 | 7557308 |
the cellular location and effect on nisin immunity of the nisi protein from lactococcus lactis n8 expressed in escherichia coli and l. lactis. | lactococcus lactis cells secreting the lantibiotic nisin, commercially used for food preservation, must protect their cell membrane against the pore-forming activity of extracellular nisin. the nisi gene product has been suggested to be a lipoprotein, which due to the location on the extracellular surface would be an ideal candidate for an immunity protein. in vivo labelling of nisi from l. lactis n8 expressed in escherichia coli proved that nisi is a lipoprotein. expression of nisi in the nisin ... | 1995 | 7557313 |
construction of a streptococcus pyogenes reca mutant via insertional inactivation, and cloning and sequencing of the complete reca gene. | to facilitate future genetic studies with streptococcus pyogenes (sp), a reca mutant (rec11) was constructed using a streptococcal integration vector carrying a pcr-derived internal reca fragment. the insertion of the plasmid in the mutant chromosome was identified by southern hybridization. resistance to uv and the ability to accept linear dna transformation by rec11 were greatly decreased, confirming its reca phenotype. using the pcr-derived fragment as a probe, we cloned and sequenced the com ... | 1995 | 7557418 |
a family of bacteriocin abc transporters carry out proteolytic processing of their substrates concomitant with export. | lantibiotic and non-lantibiotic bacteriocins are synthesized as precursor peptides containing n-terminal extensions (leader peptides) which are cleaved off during maturation. most non-lantibiotics and also some lantibiotics have leader peptides of the so-called double-glycine type. these leader peptides share consensus sequences and also a common processing site with two conserved glycine residues in positions -1 and -2. the double-glycine-type leader peptides are unrelated to the n-terminal sig ... | 1995 | 7565085 |
novel insertion sequence-like element is982 in lactococci. | a novel insertion sequence-like (is) element, designated is982, was found on the lactose plasmid, psk11l, from lactococcus lactis subsp. cremoris sk11 and was located between the origin of replication and the oligopeptide transport gene cluster. the 1003-base pair (bp) is982 was flanked by 18-bp perfect inverted repeats. is982 contained an open reading frame encoding a putative transposase of 296 amino acids. an almost identical is-like element (99% dna sequence identity) was cloned and partiall ... | 1995 | 7568469 |
the role of lactic acid bacteria in colon cancer prevention. | | 1995 | 7569753 |
the proteolytic pathway of lactococcus lactis. | | 1995 | 7570167 |
virion positions and relationships of lactococcal temperate bacteriophage tp901-1 proteins. | the major proteins of phage tp901-1 virion were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and structural relations were determined using specific antibodies, obtained by affinity purification from a polyclonal serum. a 23-kda protein was identified as the major tail protein, and a 31-kda molecule as the major head protein, respectively. labeling experiments with antibodies against two proteins, with molecular masses of 20 and 19 kda, indicated that they were base ... | 1995 | 7571429 |
the formation of biogenic amines by fermentation organisms. | a total of 523 strains representing 35 species related to food fermentation organisms of practical importance were investigated for their potential for formation of biogenic amines (ba). the investigation was performed with resting cells in phosphate buffer (ph 5.5) and the formation of the following bas was followed: putrescine, cadaverine, histamine, tyramine and 2-phenylethylamine. no potential was observed in species of lactococcus, leuconostoc, pediococcus, streptococcus and several lactoba ... | 1995 | 7571871 |
contribution of lactic acid bacteria to cheese ripening. | | 1995 | 7572362 |
applications of confocal microscopy to fat globule structure in cheese. | | 1995 | 7572372 |
microbiology and biochemistry of reduced-fat cheese. | | 1995 | 7572375 |
biogenesis of flavour compounds in cheese. | | 1995 | 7572380 |
cloning and molecular analysis of the dihydrofolate reductase gene from lactococcus lactis. | the lactococcus lactis gene encoding trimethoprim resistance has been cloned and expressed in escherichia coli and bacillus subtilis. several lines of evidence indicate that the cloned gene encodes dihydrofolate reductase (dhfr). (i) it fully complements the fol "null" mutation in e. coli. (ii) nucleotide sequencing of the cloned fragment revealed the presence of one open reading frame encoding a protein that shares homology with the family of bacterial dhfr enzymes. (iii) overexpression of this ... | 1995 | 7574597 |
detection and characterization of lactose-utilizing lactococcus spp. in natural ecosystems. | the presence of lactose-utilizing lactococcus species in nondairy environments was studied by using identification methods based on pcr amplification and (sub)species-specific probes derived from 16s rrna sequences. environmental isolates from samples taken on cattle farms and in the waste flow of a cheese production plant were first identified to the genus level, using a lactococcus genus-specific probe. isolates which showed a positive signal with this probe were further identified to the (sub ... | 1995 | 7574616 |
expression of lactococcin a and pediocin pa-1 in heterologous hosts. | pediocin pa-1 production, immunity and secretion are specified by a cluster of four genes in pediococcus acidilactici pac1.0. the production by, secretion of, and immunity to lactococcin a of lactococcus lactis are also determined by four genes. here, expression of the pediocin operon in lactococcus lactis is reported, which could only be achieved by placing it under control of a lactococcal promoter. expression of the lactococcin a operon in pediococcus is also described: recombinant clones of ... | 1995 | 7576505 |
16s-23s and 23s-5s intergenic spacer regions of streptococcus thermophilus and streptococcus salivarius, primary and secondary structure. | the 16s-23s intergenic spacer region (spacer region 1) of streptococcus salivarius, s. thermophilus, and lactococcus lactis subsp. cremoris and the 23s-5s intergenic spacer region (spacer region 2) of s. salivarius and l. lactis subsp. cremoris were sequenced and compared with the spacer regions 1 and 2 of other streptococci. a high degree of intraspecific conservation was observed for s. thermophilus and l. lactis, and very similar sequences were found for s. salivarius and s. thermophilus. whe ... | 1995 | 7580797 |
characterization of diacetin b, a bacteriocin from lactococcus lactis subsp. lactis bv. diacetylactis ul720. | fourteen lactococcus lactis strains showing inhibitory activity against listeria innocua sicc 4202 were isolated from different french raw milks and raw milk cheeses and screened for bacteriocin production by the triple layer method under conditions that eliminate the effects of lactic acid and hydrogen peroxide. three bacteriocinogenic strains (two lactococcus lactis subsp. lactis bv. diacetylactis ul719 and ul720 and one lactococcus lactis subsp. lactis ul730) were selected for their high capa ... | 1995 | 7585360 |
sequence analysis, distribution and expression of an aminopeptidase n-encoding gene from lactobacillus helveticus cnrz32 [gene 155 (1995) 89-93]. | lactobacillus (lb.) helveticus cnrz32 possesses a 97-kda metalloenzyme with aminopeptidase activity (pepn; ec 3.4.11.2). a 3.8-kb fragment encoding pepn was cloned into pil253 and designated psuw34. transformation of lactococcus (lc.) lactis lm0230 with psuw34 resulted in > 180-fold increase in general aminopeptidase (ap) activity using l-lysine-p-nitroanilide. southern hybridization was conducted to determine the distribution of homology to the cnrz32 pepn gene among lactic-acid bacteria (lab). ... | 1995 | 7590315 |
generation of auxotrophic mutants of enterococcus faecalis. | a 22-kb segment of chromosomal dna from enterococcus faecalis og1rf containing the pyrimidine biosynthesis genes pyrc and pyrd was previously detected as complementing escherichia coli pyrc and pyrd mutations. in the present study, it was found that the e. faecalis pyrimidine biosynthetic genes in this clone (designated pkv48) are part of a larger cluster resembling that seen in bacillus spp. transposon insertions were isolated at a number of sites throughout the cluster and resulted in loss of ... | 1995 | 7592480 |
the lactococcal lmrp gene encodes a proton motive force-dependent drug transporter. | to genetically dissect the drug extrusion systems of lactococcus lactis, a chromosomal dna library was made in escherichia coli and recombinant strains were selected for resistance to high concentrations of ethidium bromide. recombinant strains were found to be resistant not only to ethidium bromide but also to daunomycin and tetraphenylphosphonium. the drug resistance is conferred by the lmrp gene, which encodes a hydrophobic polypeptide of 408 amino acid residues with 12 putative membrane-span ... | 1995 | 7592810 |
autoregulation of nisin biosynthesis in lactococcus lactis by signal transduction. | the post-translationally modified, antimicrobial peptide nisin is secreted by strains of lactococcus lactis that contain the chromosomally located nisin biosynthetic gene cluster nisabtciprkfeg. when a 4-base pair deletion is introduced into the structural nisa gene (delta nisa), transcription of delta nisa is abolished. transcription of the delta nisa gene is restored by adding subinhibitory amounts of nisin, nisin mutants, or nisin analogs to the culture medium, but not by the unmodified precu ... | 1995 | 7592991 |
isolation of lactococcus lactis nonsense suppressors and construction of a food-grade cloning vector. | nonsense suppressor strains of lactococcus lactis were isolated using plasmids containing nonsense mutations or as revertants of a nonsense auxotrophic mutant. the nonsense suppressor gene was cloned from two suppressor strains and the dna sequence determined. one suppressor is an ochre suppressor with an altered trna(gln) and the other an amber suppressor with an altered trna(ser). the nonsense suppressors allowed isolation of nonsense mutants of a lytic bacteriophage and suppressible auxotroph ... | 1995 | 7596286 |
effects of the generation of single-stranded dna on the maintenance of plasmid pmv158 and derivatives in different bacillus subtilis strains. | the effects of the single-strand origins (ssos) of plasmid pmv158 on (i) the conversion of its single-stranded (ss) replication intermediates to double-stranded (ds) plasmid dna and (ii) its maintenance were analyzed. the rolling-circle plasmid pmv158, which replicates via ssdna intermediates, contains two single-strand origins (ssos) of replication, pala and palu. in this paper the results obtained with bacillus subtilis are described; complementary studies with lactococcus lactis are presented ... | 1995 | 7597110 |
effects of the generation of single-stranded dna on the maintenance of plasmid pmv158 and derivatives in lactococcus lactis. | the effects of the single-strand origins (ssos) of the broad-host-range streptococcal plasmid pmv158 on (i) the conversion of its single-stranded (ss) dna replication intermediates to double-stranded (ds) plasmid dna and (ii) its maintenance were analyzed. pmv158 is distinguished from most other plasmids that replicate by the rolling-circle mechanism by the presence of two single-strand origins of replication, pala and palu. in this paper the results obtained with lactococcus lactis are presente ... | 1995 | 7597111 |
sequence analysis of a 5.6 kb fragment of chromosome ii from saccharomyces cerevisiae reveals two new open reading frames next to cdc28. | the sequence of a 5653 bp dna fragment of the right arm of chromosome ii of saccharomyces cerevisiae contains two unknown open reading frames (ybr1212 and ybr1213) next to gene cdc28. gene disruption reveals both putative genes as non-essential. orf ybr1212 encodes a predicted protein with 71% similarity and 65% identity (total polypeptide of 376 aa) with the 378 aa surl protein of s. cerevisiae, while the putative product of orf ybr1213, which is strongly expressed, has 28% identity with a lact ... | 1995 | 7597849 |
induction of thermotolerance by chemical agents in lactococcus lactis subsp. lactis il1403. | like in other organisms tested to date, adapted cells of lactococcus lactis subsp. lactis il1403 pretreated at 42 degrees c for 30 min develop a thermotolerant state, i.e. an increased ability to survive subsequent exposure to a lethal challenge temperature (52 degrees c for 15 or 30 min). in different cellular systems, chemicals as diverse as divalent metal salts, natural or synthetic compounds trigger the development of thermotolerance. yet, in l. lactis subsp. lactis il1403, among the 17 chem ... | 1995 | 7599033 |
characterization of the lactococcal abid1 gene coding for phage abortive infection. | lactococcal phage abortive infection (abid1) determined by plasmid pil105 is active on both prolate- and small-isometric-head phages of the c6a and 936 phage groups, respectively, which are considered two different species. the abi phenotype was found to be encoded by a single gene, designated abid1. the abid1-encoded protein (351 amino acids) does not show homology with any known protein and has a deduced isoelectric point of 10. it also possesses two helix-turn-helix structures and an unusuall ... | 1995 | 7601848 |
phage operon involved in sensitivity to the lactococcus lactis abortive infection mechanism abid1. | phage bil66 is unable to grow on lactococcus lactis cells harboring the abortive infection gene abid1. spontaneous phage mutants able to grow on abid1 cells were used to study phage-abi interaction. a 1.33-kb dna segment of a mutant phage allowed growth of abid1s phages in abid1 cells when present in trans. sequence analysis of this segment revealed an operon composed of four open reading frames, designated orf1 to orf4. the operon is transcribed 10 min after infection from a promoter presenting ... | 1995 | 7601849 |
restriction-modification systems in lactococcus lactis. | several restriction-modification (r-m) systems have been identified in lactococcus lactis. most of the systems have been plasmid encoded and function as phage-resistance mechanisms. at least five different type-ii r-m systems, llaai, llabi, llaci, lladi and llaei, were identified in isolates from a mixed cheddar starter culture. llaai and llabi recognized the dna sequences 5'- decreases gatc-3' and 5'-c decreases tryag-3', respectively. the genes coding for the llaai and llabi r-m systems have b ... | 1995 | 7607475 |
the ssoii and nlax dna methyltransferases: overproduction and functional analysis. | overproduction of the nlax dna methyltransferase (m.nlax) in an escherichia coli host conferred resistance to ssoii restriction endonuclease (r.ssoii) digestion. this suggested an overlap of sequence specificity between m.nlax and m.ssoii, the latter of which modifies the internal cytosine of the target sequence 5'-ccngg-3'. a variant of m.nlax (m.sso/nla), containing an n-terminal extension from m.ssoii, was also enzymatically active. using deletion analysis, the n-terminal 71 amino-acid residu ... | 1995 | 7607533 |
cloning and partial characterization of regulated promoters from lactococcus lactis tn917-lacz integrants with the new promoter probe vector, pak80. | transposon tn917-ltv1 was used to produce a collection of lactococcus lactis strains with fusion of a promoterless lacz gene to chromosomal loci. screening 2,500 tn917-ltv1 integrants revealed 222 that express beta-galactosidase on plates at 30 degrees c. pulsed-field gel electrophoresis revealed tn917-ltv1 insertions in at least 13 loci in 15 strains analyzed. integrants in which beta-galactosidase expression was regulated by temperature or ph and/or arginine concentration were isolated. in mos ... | 1995 | 7618865 |
genetic marking of lactococcus lactis shows its survival in the human gastrointestinal tract. | a human feeding study was performed with lactococcus lactis tc165.5, which is genetically marked by insertion of the sucrose-nisin conjugative transposon tn5276 and chromosomal resistance to rifampin and streptomycin. the fate of strain tc165.5 and its nucleic acids was monitored by conventional plating methods and by molecular detection techniques based on specific pcr amplification of the nisin (nisa) gene from dna extracted from human feces. a method was developed for the efficient extraction ... | 1995 | 7618890 |
purification and cloning of dna fragments fractionated on agarose gels. | purification of dna fragments from acrylamide or agarose gels is a commonly used technique in the molecular biology laboratory. this article describes a rapid, efficient, and inexpensive method of purifying dna fractions from an agarose gel. the purified dna is suitable for use in a wide range of applications including ligation using dna ligase. the procedure uses standard high-melting-temperature agarose and normal tbe electrophoresis buffer. in addition, the protocol does not involve the use o ... | 1995 | 7620974 |
purification and characterization of a small membrane-associated sugar phosphate phosphatase that is allosterically activated by hpr(ser(p)) of the phosphotransferase system in lactococcus lactis. | in the gram-positive bacterium, lactococcus lactis, nonmetabolizable cytoplasmic sugar phosphates, accumulated by the phosphoenolpyruvate:sugar phosphotransferase system, are rapidly dephosphorylated and expelled from the cell upon addition of glucose (inducer expulsion). our recent studies have established that a metabolite-activated, atp-dependent protein kinase that phosphorylates serine-46 in hpr of the phosphoenolpyruvate:sugar phosphotransferase system activates a sugar phosphate phosphata ... | 1995 | 7622485 |
the codon usage of the nisz operon in lactococcus lactis n8 suggests a non-lactococcal origin of the conjugative nisin-sucrose transposon. | an 11.6 kb area downstream from the structural gene of nisin z in the conjugative nisin-sucrose transposon of lactococcus lactis subsp. lactis n8 was cloned and sequenced. analysis of the sequence revealed eight open reading frames, niszbtclprk, followed by a putative rho-independent terminator (delta g degrees = -4.7 kcal/mol). the c-terminal hydrophilic domain of the nisk protein is homologous to the c-termini of several histidine kinases of bacterial two-component regulator systems, such as s ... | 1995 | 7626780 |
characterization and heterologous expression of the tetl gene and identification of iso-iss1 elements from enterococcus faecalis plasmid pjh1. | the tetracycline-resistance (tcr) determinant of the enterococcus faecalis plasmid pjh1 has been identified and located on a 2.2-kb rsai-ecori fragment. the fragment was cloned in escherichia coli, and specified tcr in this host. the nucleotide (nt) sequence of the cloned fragment showed the presence of an open reading frame (orf) of 1374 bp, designated tetl. the nt sequence of tetl from pjh1 was identical to that of the tetl present on pls1 from streptococcus agalactiae. upstream of the pjh1 te ... | 1995 | 7628724 |
homology modelling of the lactococcus lactis leader peptidase nisp and its interaction with the precursor of the lantibiotic nisin. | a model is presented for the 3-d structure of the catalytic domain of the putative leader peptidase nisp of lactococcus lactis, and the interaction with its specific substrate, the precursor of the lantibiotic nisin. this homology model is based on the crystal structures of subtilisin bpn' and thermitase in complex with the inhibitor eglin. predictions are made of the general protein fold, inserted loops, ca2+ binding sites, aromatic interactions and electrostatic interactions of nisp. cleavage ... | 1995 | 7630881 |
specificity of peptide transport systems in lactococcus lactis: evidence for a third system which transports hydrophobic di- and tripeptides. | a proton motive force-driven di-tripeptide carrier protein (dtpt) and an atp-dependent oligopeptide transport system (opp) have been described for lactococcus lactis mg1363. using genetically well-defined mutants in which dtpt and/or opp were inactivated, we have now established the presence of a third peptide transport system (dtpp) in l. lactis. the specificity of dtpp partially overlaps that of dtpt. dtpp transports preferentially di- and tripeptides that are composed of hydrophobic (branched ... | 1995 | 7642491 |
cloning and characterization of the abortive infection genetic determinant abid isolated from pbf61 of lactococcus lactis subsp. lactis kr5. | a 6.3-kb fragment from pbf61 in lactococcus lactis subsp. lactis kr5 was cloned and found to confer an abortive phage infection (abi+) phenotype exhibiting a reduction in efficiency of plating and plaque size for small isometric- and prolate-headed bacteriophages sk1 and c2, respectively, and to produce a 10-fold decrease in c2 phage burst size. phage adsorption was not significantly reduced. an open reading frame of 1,098 bp was sequenced and designated abid. tn5 mutagenesis confirmed that abid ... | 1995 | 7646042 |
characterization and distribution of two insertion sequences, is1191 and iso-is981, in streptococcus thermophilus: does intergeneric transfer of insertion sequences occur in lactic acid bacteria co-cultures? | a chromosomal repeated sequence from streptococcus thermophilus was identified as a new insertion sequence (is), is1191. this is the first is element characterized in this species. this 1313 bp element has 28 bp imperfect terminal inverted repeats and is flanked by short direct repeats of 8 bp. the single large open reading frame of is1191 encodes a 391-amino-acid protein which displays homologies with transposases encodes by is1201 from lactobacillus helveticus (44.5% amino-acid sequence identi ... | 1995 | 7651138 |
[data on the cultural and morphologic features of dissociation forms of nisin-producing streptococcus]. | colonies and cells of s and g variants of streptococcus lactis, strain msu were studied comparatively. it was shown that in the g form the growth rate and other biosynthetic peculiarities and in particular the capacity for the nisin synthesis were lower. morphological properties of the colonies and cells of the s and g variants of the nisin-producing streptococcus were investigated. | 1995 | 7654096 |
behavior of listeria monocytogenes in mozzarella cheese in presence of lactococcus lactis. | the behavior of listeria monocytogenes (scott a) on fully processed italian mozzarella cheese was examined in presence and in absence of bacteriocins produced by lactococcus lactis ssp. lactis strains (dip 15 and dip 16). these strains, isolated from raw milk, produced heat stable bacteriocins that were inactivated by pronase, alpha- chymotrypsin and proteinase k, but not by pepsin, trypsin and catalase. the addition of crude bacteriocins to the growing culture of listeria monocytogenes resulted ... | 1995 | 7654515 |
glucose metabolism and internal ph of lactococcus lactis subsp. lactis cells utilizing nmr spectroscopy. | the metabolism of glucose was studied in lactococcus lactis subsp. cnrz 125 by 13c nmr. the initial rate of glucose utilization was higher for exponential phase cells than for stationary phase cells [150 vs 85 nmol g (dry wt)-1 s -1]. 31p nmr was used to determine changes in glycolytic phosphorylated intermediates (fructose-1,6-diphosphate, dihydroxyacetone phosphate and phosphoglycerate). the internal phs of l. lactis subsp. lactis cnrz 141 and cnrz 125 were also measured by 31p nmr as a functi ... | 1995 | 7662330 |
stress response in lactococcus lactis: cloning, expression analysis, and mutation of the lactococcal superoxide dismutase gene. | in an analysis of the stress response of lactococcus lactis, three proteins that were induced under low ph culture conditions were detected. one of these was identified as the lactococcal superoxide dismutase (soda) by n-terminal amino acid sequence analysis. the gene encoding this protein, designated soda, was cloned by the complementation of a soda sodb escherichia coli strain. the deduced amino acid sequence of l. lactis soda showed the highest degree of similarity to the manganese-containing ... | 1995 | 7665513 |
streptococcus lactis septicemia in a patient with chronic lymphocytic leukemia. | | 1995 | 7668230 |
a milk-based method for detecting antimicrobial substances produced by lactic acid bacteria. | a new technique for the detection of antimicrobial substances produced by lactic acid bacteria has been developed. in this technique, milk agar plates were supplemented with tetrazolium chloride or tetrazolium blue dyes. comparisons of milk agar assays with m17 agar plates indicated that, out of 30 bacterial strains, 13 strains produced bacteriocins or inhibitory substances that were detectable on milk agar plates but not on m17 agar plates. multiple-strain lactococcal cultures are used in milk ... | 1995 | 7673514 |
oligopeptidases from lactococcus lactis. | | 1995 | 7674946 |
gene inactivation in lactococcus lactis: histidine biosynthesis. | lactococcus lactis strains from dairy and nondairy sources were tested for the ability to grow in the absence of histidine. among 60 dairy strains tested, 56 required histidine, whereas only 1 of 11 nondairy strains had this requirement. moreover, 10 of the 56 auxotrophic strains were able to grow in the presence of histidinol (hol+), the immediate histidine precursor. this indicates that adaptation to milk often results in histidine auxotrophy. the histidine operon was detected by southern hybr ... | 1993 | 7687248 |
characterization of the nisin gene cluster nisabtcipr of lactococcus lactis. requirement of expression of the nisa and nisi genes for development of immunity. | the nisin gene cluster nisabtcipr of lactococcus lactis, located on a 10-kbp dna fragment of the nisin-sucrose transposon tn5276, was characterized. this fragment was previously shown to direct nisin-a biosynthesis and to contain the nisp and nisr genes, encoding a nisin leader peptidase and a positive regulator, respectively [van der meer, j. r., polman, j., beerthuyzen, m. m., siezen, r. j., kuipers, o. p. & de vos, w. m. (1993) j. bacteriol. 175, 2578-2588]. further sequence analysis revealed ... | 1993 | 7689965 |
sequence analysis, distribution and expression of an aminopeptidase n-encoding gene from lactobacillus helveticus cnrz32. | lactobacillus (lb.) helveticus cnrz32 possesses a 97-kda metalloenzyme with aminopeptidase activity (pepn; ec 3.4.11.2). a 3.8-kb fragment encoding pepn was cloned into pil253 and designated psuw34. transformation of lactococcus (lc.) lactis lm0230 with psuw34 resulted in > 180-fold increase in general aminopeptidase (ap) activity using l-lysine-p-nitroanilide. southern hybridization was conducted to determine the distribution of homology to the cnrz32 pepn gene among lactic-acid bacteria (lab). ... | 1995 | 7698673 |
isolation of nisin-producing lactococcus lactis strains from dry fermented sausages. | a total of 4608 lactic acid bacteria (lab) were isolated from 24 spanish fermented sausages and screened for bacteriocin production. two strains, bb24 and g18, produced bacteriocins that inhibited a broad spectrum of gram-positive bacteria. bb24 and g18 were tentatively identified as lactococcus lactis by carbohydrate fermentation patterns and other biochemical characteristics. the characterization of their bacteriocins suggested that both could be the well-known lantibiotic nisin. this was conf ... | 1995 | 7698947 |
utilization of cheddar cheese containing nisin as an antimicrobial agent in other foods. | cheddar cheese made with nisin-producing lactococci contained between 400 and 1200 iu of nisin per gram of cheese. cultures used were lactococcus lactis ssp. cremoris js102, a nisin-producing transconjugant developed in the laboratories of dr. l.l. mckay and lactococcus lactis ssp. lactis ncdo 1404 obtained from the national collection of food bacteria, reading, england. pasteurized process cheese spreads with 53% and 60% moisture and 0, 301 and 387 iu nisin/g were manufactured and inoculated wi ... | 1994 | 7703016 |
scanning electron microscopy of target cells and molecular weight determination of a bacteriocin produced by lactococcus lactis d53. | a bacteriocin, lactococcin d53, from lactococcus lactis strain d53 was partially purified by precipitation with ammonium sulfate and dialysis against deionized water, at which time it precipitated from solution. a native molecular weight was determined by gel filtration, where bacteriocin was detected in two fractions which were measured at 104 and 6.7 kda. a molecular weight of 7.0 kda under denaturing conditions was determined by tricine-sds-polyacrylamide gel electrophoresis. the molecular we ... | 1994 | 7703022 |
repair of oxidative dna damage in gram-positive bacteria: the lactococcus lactis fpg protein. | the formamidopyrimidine dna glycosylase gene (fpg-l) of the gram-positive microaerophilic bacterium lactococcus lactis subsp. cremoris ml3 has been cloned, characterized and sequenced. the fpg-l gene is composed of 819 bp encoding a protein of 31.3 kda (fpg-l). the deduced amino acid sequence of the fpg-l protein shows 59% similarity and 38% identity with the escherichia coli fpg protein (fpg-e). polyclonal antibodies against fpg-e react with the fpg-l protein. the fpg-l protein was purified to ... | 1995 | 7704272 |
cloning of promoter-like sequences from lactobacillus paracasei subsp. paracasei cg11 and their expression in escherichia coli, lactococcus lactis, and lactobacillus reuteri. | fragments of chromosomal dna from lactobacillus paracasei subsp. paracasei cg11 (formerly lactobacillus casei cg11) capable of functioning as promoters were isolated using the broad host range, promoter-probe vector pgkv210. five such fragments designated p61, p79, p80, p116, and p144 were completely sequenced and analyzed. fragment p61 had the highest transcriptional efficiency in escherichia coli and lactobacillus reuteri whereas p80 was the most active in lactococcus lactis. in general, the o ... | 1994 | 7704831 |
preparation of bacterial x-prolyl dipeptidyl aminopeptidase and its stabilization by organic cosolvents. | to obtain large amounts of the x-prolyl dipeptidyl aminopeptidase from lactococcus lactis subsp lactis (pepx, e.c. 3.4.14.5), pepx was purified from a commercial l. lactis cell extract. the enzyme was purified in only three steps and the last one was performed by hplc on a c4 reverse-phase column using acetonitrile as an eluent. despite its high molecular mass (175 kda), the enzyme was recovered with a good activity yield (75%). advantages and drawbacks of this technique compared to the classica ... | 1995 | 7710078 |
distribution of proteins similar to iiimanh and iiimanl of the streptococcus salivarius phosphoenolpyruvate:mannose-glucose phosphotransferase system among oral and nonoral bacteria. | in streptococcus salivarius, the phosphoenolpyruvate (pep):mannose-glucose phosphotransferase system, which concomitantly transports and phosphorylates mannose, glucose, fructose, and 2-deoxyglucose, is composed of the general energy-coupling proteins ei and hpr, the specific membrane-bound iiiman, and two forms of a protein called iiiman, with molecular weights of 38,900 (iiimanh) and 35,200 (iiimanl), that are found in the cytoplasm as well as associated with the membrane. several lines of evi ... | 1995 | 7730253 |
construction of a food-grade host/vector system for lactococcus lactis based on the lactose operon. | a plasmid-based food-grade vector system was developed for lactococcus lactis by exploiting the genes for lactose metabolism. l. lactis mg5267 is a plasmid-free strain containing the entire lactose operon as a chromosomal insertion. the lacf gene was deleted from this strain by a double cross-over homologous recombination event. the lacf-deficient strain produced a lac- phenotype on indicator agar. a cloned copy of the lacf gene expressed on a plasmid was capable of complementing the lacf-defici ... | 1995 | 7737470 |
locating nisin-producing lactococcus lactis in a fermented meat system. | antibody-linked probes were used to locate nisin in a fermented meat system. free nisin or nisin bound to susceptible cells or food components was not detected. colonies of nisin-producing lactococcus lactis were stained at all times during growth. the position of nisin-producing l. lactis colonies was noted and compared with the location of spoilage organisms or the distribution of areas with a fermented meat appearance. no relationship between the distribution of starter culture and the locati ... | 1995 | 7744718 |
cloning, expression, sequence analysis, and site-directed mutagenesis of the tn5306-encoded n5-(carboxyethyl)ornithine synthase from lactococcus lactis k1. | the gene (ceo) encoding n5-(carboxyethyl)ornithine synthase (ec 1.5.1.24) has been isolated from the sucrose-nisin transposon tn5306 of lactococcus lactis k1, sequenced, and expressed at high level in escherichia coli. the cloned enzyme has allowed the synthesis of the novel n omega-carboxypropyl amino acids n5-(1-carboxypropyl)-l-ornithine and n6-(1-carboxypropyl)-l-lysine. comparison of the deduced amino acid sequence of n5-(1-carboxyethyl)-l-ornithine synthase (m(r) = 35,323) to the functiona ... | 1995 | 7744873 |
secretion of biologically active murine interleukin-2 by lactococcus lactis subsp. lactis. | secretion of functional recombinant murine interleukin-2 (mil2) by lactococcus lactis was achieved by fusion of the sequence encoding mature mil2 to the secretion signal leader of the lactococcal usp45 gene placed under transcriptional control of the phage t7 promoter-t7 rna polymerase expression system. the recombinant mature mil2 was one of only a few proteins which accumulated in the growth medium. sequence analysis revealed correct processing at the first amino acid of the mature protein. a ... | 1995 | 7747977 |
pucl287 plasmid from tetragenococcus halophila (pediococcus halophilus) atcc 33315 represents a new theta-type replicon family of lactic acid bacteria. | a cryptic plasmid, pucl287, was isolated from tetragenococcus halophila (pediococcus halophilus) atcc 33315. it had a theta-type mechanism of replication in its natural host. its minimal replicon, rep287, was isolated on a 1.6-kb ecori fragment. the rep287 host range included the genera pediococcus, enterococcus, lactobacillus and leuconostoc but not genus lactococcus. plasmids hybridizing to pucl287 are rare among lactic acid bacteria. as assessed by hybridization, rep287 is dissimilar to pam b ... | 1995 | 7750734 |
physical and genetic map of the lactococcus lactis subsp. cremoris mg1363 chromosome: comparison with that of lactococcus lactis subsp. lactis il 1403 reveals a large genome inversion. | a physical and genetic map of the chromosome of the lactococcus lactis subsp. cremoris reference strain mg1363 was established. the physical map was constructed for noti, apai, and smai enzymes by using a strategy that combines creation of new rare restriction sites by the random-integration vector prl1 and ordering of restriction fragments by indirect end-labeling experiments. the mg1363 chromosome appeared to be circular and 2,560 kb long. seventy-seven chromosomal markers were located on the ... | 1995 | 7751295 |
use of continuous culture for the selection of plasmids with improved segregational stability. | in this report a method that enables the selection of stable plasmid variants and the isolation of dna sequences that improve plasmid maintenance is described. the method is based on the principle that in populations of cells carrying derivatives of a plasmid that differ only in the level of segregational stability, when grown in a chemostat under conditions with selective pressure on the plasmid, cells that carry more stable plasmid variants will be enriched. we developed the system for lactoco ... | 1995 | 7753912 |
the nucleotide sequence for the replication region of pvs40, a lactococcal food grade cloning vector. | the replication region of a limited host range lactococcal vector, pvs40, was located within a 2359 bp ecori--clai fragment. within this fragment a sequence for a 1197 bp reading frame coding for a 46,826 da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (tatagcgtatgaaaaaactgtg), suggesting an origin of replication. the prot ... | 1993 | 7763788 |
methods to demonstrate the bactericidal activity of bacteriocins. | two simple techniques were developed to demonstrate bactericidal activity of bacteriocins. both were based on allowing a lawn of indicator strain to grow first, then exposing the lawn to bacteriocin-containing cell-free supernatants in a well cut in the seeded agar lawn or by inoculating the bacteriocin-producing strain onto the indicator lawn. lysis of cells of the indicator strain resulted in a clear zone. these techniques may be adapted to test antimicrobial substances other than bacteriocins ... | 1993 | 7763935 |
the regulation of expression of the lactococcus lactis lactose operon. | translational gene fusions between the escherichia coli beta-galactosidase (lacz) gene and the lactococcus lactis lactose operon were constructed such that transcription from the lactose operon promoter could be assessed by measuring beta-galactosidase activity. the level of beta-galactosidase activity was up to 2.5-fold lower when mg5267 cells, which contain a chromosomal copy of the lactose operon, were grown in glucose compared to those grown in lactose. a greater degree of repression was see ... | 1993 | 7763936 |
partial characterization of an rpod-like gene of lactococcus lactis subsp. lactis ml3 with a polymerase chain reaction-based approach. | with degenerated oligonucleotide primers for conserved regions of bacterial sigma factor proteins, a 117-bp internal dna fragment of an rpod-like gene of lactococcus lactis subsp. lactis ml3 was amplified by the polymerase chain reaction (pcr). the dna sequence of this pcr product was determined by cycle sequencing, and the deduced amino acid sequence of this internal fragment showed an extensive homology with the known sigma factor sequences from six other microorganisms and present a 13-amino ... | 1993 | 7764136 |
construction of first-generation lactococcal integrative cloning vectors. | using a randomly-cloned, hindiii-digested, chromosomal fragment from lactococcus lactis subsp. lactis lm0230, first-generation lactococcal integrative cloning vectors were developed. through dideoxy dna sequence analysis, the cloned chromosomal dna fragment was determined to be 1026 base pairs. southern hybridization studies demonstrated applicability of the integrative vector to other strains of l. lactis and l. lactis subsp. cremoris. identification of a single nrui site near the middle of the ... | 1993 | 7764390 |
production of chymosin for the dairy industry by recombinant dna technology. | the increasing world production of cheese, coupled with a decline in the number of slaughtered calves, has stimulated a search for alternative sources of chymosin. this article briefly reviews microbial alternatives to chymosin and discusses chymosins produced using recombinant dna technology. recombinant chymosin represents one of the first successful applications of recombinant dna technology in the food industry. | 1994 | 7764615 |
simple method for extracting plasmid dna from lactic acid bacteria. | rapid screening and large-scale plasmid dna isolation procedures are described for lactic acid bacteria, using glass beads to break cells. the rapid screening procedure allows one to obtain plasmid dna pellets in less than 1 h. this method has been successfully tested on various bacteria from the genera lactococcus, leuconostoc, lactobacillus, pediococcus, streptococcus, enterococcus and propionibacterium. this procedure yields plasmid dna with minor chromosomal and plasmid dna-degraded form con ... | 1994 | 7764702 |
influence of dilution rate and cell immobilization on plasmid stability during continuous cultures of recombinant strains of lactococcus lactis subsp. lactis. | the influence of dilution rate and cell immobilization on plasmid stability in recombinant strains of lactococcus lactis subsp. lactis was investigated during continuous cultures. the studied strains, l. lactis il2682 and il2683, contained plasmids pil9 (lac+), pil205 (cmr) and plasmids pil252 (low copy number) and pil253 (high copy number), respectively, that conferred resistance to erythromycin. plasmid pil205 was remarkably stable. dilution rate did not affect the rate of loss of plasmids pil ... | 1994 | 7764746 |
rapid isolation and purification of lactococcal bacteriophage dna without the use of caesium chloride gradients. | intact bacteriophage of lactococcus lactis were recovered from small volumes of lysate by centrifugation at 15,000 g without precipitation with polyethylene glycol and sodium chloride, or ultracentrifugation in a caesium chloride gradient. dna was then extracted and purified by standard protocols. this dna was readily digested with restriction endonucleases and used successfully in hybridization experiments. | 1994 | 7764812 |
action of a cell-envelope proteinase (cepiii-type) from lactococcus lactis subsp. cremoris am1 on bovine kappa-casein. | the specificity of the cell-envelope proteinase (cepiii-type) from lactococcus lactis subsp. cremoris am1 in its action on bovine kappa-casein was studied. a 4-h digest (ph 6.2, 15 degrees c) of kappa-casein was made with the purified proteinase. the ph-4.6 soluble fraction, representing more than 95% of the whole hydrolysate, was ultrafiltered to obtain a high-molecular-mass (hmm) and a low-molecular-mass (lmm) fraction, which were separately further purified by electrophoretic and chromatograp ... | 1994 | 7765163 |
a novel approach for high level production of a recombinant human parathyroid hormone fragment in escherichia coli. | we describe a novel approach to the production in e. coli of a peptide fragment derived from the human parathyroid hormone (hpth). the first 38 amino acids of hpth were fused at the amino terminus to a derivative of the bacteriophage t4-encoded gp55 protein, and were expressed in the e. coli cytoplasm in inclusion bodies at levels exceeding 50% of the total cell protein. solubilization and subsequent incubation of the inclusion bodies in dilute hydrochloric acid facilitated the cleavage of an ac ... | 1994 | 7765406 |
expression of lactobacillus casei atcc 393 beta-galactosidase encoded by plasmid plz15 in lactococcus lactis cnrz 1123. | lactococcus lactis subsp. lactis cnrz 1123, a lac- derivative of cnrz 1122 was transformed by electroporation with the lactobacillus casei atcc 393 plasmid plz15, which bears a beta-galactosidase gene. the transformants expressed a constitutive beta-galactosidase activity at a higher level than in lact. casei, and in the cell-free extract two additional protein bands were detected by sds-page which could correspond to lactose metabolism enzymes. both plasmid and beta-gal activity were stable in ... | 1994 | 7765447 |
cloning and nucleotide sequencing of l-lactate dehydrogenase gene from streptococcus thermophilus m-192. | the gene encoding l-lactate dehydrogenase (ldh) was cloned from an industrial dairy strain of streptococcus thermophilus m-192 using a synthetic oligonucleotide probe based on the n-terminal amino acid sequence of the purified enzyme, and its nucleotide sequence was determined. the enzyme was deduced to have 328 amino acid residues with a molecular weight of 35,428 and found to have high sequence similarity to ldhs from other lactic acid bacteria (89.0% to streptococcus mutans, 76.3% to lactococ ... | 1994 | 7765475 |
new opportunities in food biotechnology. | | 1994 | 7765676 |