| [effect of certain factors on block formation in ceratophillus tesquorum and neopsylla setosa setosa]. | studies were conducted of the effect of temperature and humidity, variant of plague microbe, frequency and duration of feeding and specificity of the host on the blockformation in the souslik fleas c. tesquorum and n. setosa infected with plague. 28 tests on the effect of temperature and humidity on the blockformation were undertaken, for which 14411 fleas of the above species were used. a temperature of 16 to 22 degrees proved to be optimal; at this temperature the number of blocked fleas (c. t ... | 1976 | 958724 |
| [lysogenic clones of wild-type plague bacteria and characteristics of the phages produced by them]. | comparative population analysis of 3 lysogenic clones of plague bacteria of wild type by lysogenic properties demonstrated that they failed to show any difference from one another by immunity to homolgous and heterologous phages, but differed by the number of cells capable of producing the phage spontaneously. lysogenic properties were transmitted by heredity both after the ten-fold passage in the presence of a homologous antiphage serum and after a 10-fold colning. phages produced by the wild l ... | 1976 | 961226 |
| bubonic plague from direct exposure to a naturally infected wild coyote. | an 11-year-old boy developed axillary bubonic plague and plague meningitis 3 days after skinning a dead coyote near albuquerque, new mexico. the coyoto carcass was recovered 10 days later, and yersinia pestis was isolated from spleen and marrow of the animal. this is the first report of human plague from exposure to a coyote. a review of experimental and epidemiologic studies suggests that severe plague infection in members of the family canidae is unusual, and that the risk of acquiring plague ... | 1976 | 961983 |
| distribution of plague in rhodesia as demonstrated by serological methods. | | 1976 | 963738 |
| trapping and serum testing of rodents caught prior to the outbreak of plague in rhodesia. | | 1976 | 963739 |
| [normal antibodies and immunologic reactivity]. | antibodies to the capsular antigen of plague causative agent were found in the serum of many nonimmunized mice of 6 strains, but none were found in mice of the dba/2 strain. after the administration of the capsular antigen to mice of different strains cells forming the antibodies to the antigen administered were revealed in a quantitative correlation with the natural antibody level. an association was revealed between the level of natural antibodies and the number of antibody-forming cells in th ... | 1976 | 986741 |
| [study of the penicillinase of the plague microbe, the synthesis of which is determined by the r-episome]. | penicillinase produced by a culture of the plague microbe with episomic resistance to benzylpenicillin was isolated and purified. comparative investigation of the substrate spectrum, michaelis constant and antigenic properties of the enzymes from the plague and dysentery microbes (r-factor donor) showed that transfer of the r-episome to the new host did not affect the investigated properties of penicillinase the synthesis of which was controlled by this episome. | 1976 | 999263 |
| [electron microscopic study of dry live plague vaccine eb by the scanning method]. | dry live plague vaccine eb was examined under microscope; it appeared that in the mentioned preparation the bacterial cells were enclosed in the artificial sucrose-gelatin capsule of the stabilizer which apparently maintained the vital activity of the microorganisms in the state of anabiosis by forming a stable bond with the bacterial body. | 1976 | 1007728 |
| the preparation and characterization of a cell-free system from saccharomyces cerevisiae that translates natural messenger ribonucleic acid. | a cell-free protein-synthesizing system has been prepared from saccharomyces cerevisiae by differential centrifugation of lysed spheroplasts. the preparation, a modified 100,000 x g supernatant fraction, contains ribosomes and monosomes, ribosomal subunits, translation factors, and aminoacyl-trna synthetases, but no polysomes. after removal of small amounts of remaining mrna with micrococcal nuclease, protein synthesis is stringently dependent on the addition of mrna, as well as amino acids and ... | 1979 | 374404 |
| [phage typing of rough e. coli strains isolated from urine (author's transl)]. | a differentiation of e. coli rough strains is generally not well established in bacteriological urine diagnosis although these strains are relatively often isolated from urine samples of patients with urinary tract infections (see table 2). an exact characterization of rough strains seems to be necessary especially for the distinction between recurrent and reinfection during therapy and follow-up studies. the application of phage typing for characterization of e. coli rough strains isolated from ... | 1978 | 373321 |
| biological consequences of incorporation of 5-fluorocytidine in the rna of 5-fluorouracil-treated eukaryotic cells. | treatment of hela cells with 5-fluoro-[3h]uracil leads to the incorporation into cellular rna of 5-fluorocytidine to the extent of about 0.2% of the 5-fluorouridine incorporated. in tobacco mosaic virus rna produced in tobacco leaves this ratio is one order of magnitude lower. copolymers of cytidylic with 5-fluorocytidylic acids show unchanged template activity with e. coli rna polymerase, but slightly altered messenger activity in the wheat germ system, compared to poly(c), and it is suggested ... | 1976 | 1064021 |
| presence of messenger specifying sequences in the dna of chromatin subunits. | messenger-specifying sequences in subunits of human lymphocyte chromatin were detected by hybridization of dna complementary to cytoplasmic polyadenylylated rna with dna isolated from the subunits. comparison of the kinetics and extents of hybridization of complementary dna with chromatin subunit dna and with nuclear dna showed that most of the repetitive sequences and single copy sequences in mrna are present in chromatin subunits. this result indicates that inclusion of a dna sequence into the ... | 1976 | 1064026 |
| hypersensitivity to tobacco antigen. | a glycoprotein of molecular weight 18,000 was purified from saline extracts of cured tobacco leaves by ammonium sulfate fractionation, chromatography on sephadex g-25 and continuous-flow preparative electrophoresis on polyacrylamide gel. twelve of 31 volunteers (6/15 smokers and 6/16 nonsmokers) exhibited immediate cutaneous hypersensitivity (wheal and flare reactions) when injected intracutaneously with 2 mug of this material. immunochemically similar material was demonstrated in, and purified ... | 1976 | 1064042 |
| cloning of chemically synthesized lactose operators. ii. ecori-linkered operators. | a 40 base, mainly duplex dna segment, with the following sequence paattccacatgtggaattgtgagcggataacaatttgtt (3') ggtgtacaccttaacactcgcctattgttaaacaccttaap (5') has been synthesized by combination of chemical and enzymatic methods. it consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the ecori restriction endonuclease. this segment has been ligated into the pmb9 plasmid and the resulting operator ... | 1978 | 357249 |
| [the nature of nuclear enlargement in urethane and isoprotenol-stimulated salivary glands (author's transl)]. | | 1975 | 1073694 |
| [condensation products of nitrated heterocyclic aldehydes with oxo-cyclopentathiophenes and oxo-tetrahydroquinolines (author's transl)]. | | 1975 | 1081385 |
| ampicillin-resistant hemophilus sp. | | 1976 | 1082793 |
| [influence of substances that change the serotonin level of the brain on the analgesic effect of promedol in rats]. | in tests with determination of pain reaction in rats registered by their squeak and arising in reponse to a single electric irritation of the tail evidence was obtained to the effect that substances both lowering the serotonin content in the brain (p-chlorphenylalanine, reserpine) and raising it (5-oxytryptophan, pargilin) cause a fall of the threshold, viz. 5-oxytryptophan and pargilin display antagonism to the analgetic effect of trimeperidine hydrochloride, whereas p-chlorphenylalanine, and i ... | 1976 | 1082823 |
| sequence analysis of operator constitutive mutants of the tryptophan operon of escherichia coli. | | 1978 | 351194 |
| the requirement of ia-positive accessory cells for the induction of hapten-reactive cytotoxic t lymphocytes in vitro. | | 1979 | 315427 |
| analysis of t cell subpopulations by laser doppler spectroscopy and the association of electrophoretic mobility differences with differences in rosette-forming affinity. | | 1979 | 313961 |
| [biochemical characteristics of yersinia pestis samples isolated in brazil]. | | 1977 | 283471 |
| basal and human chorionic gonadotropin-stimulated 17 alpha-hydroxyprogesterone and testosterone levels in klinefelter's syndrome. | in nine patients with klinefelter's syndrome, mean basal plasma levels of testosterone (302 +/- 145 ng/100 ml) and its major precursor, 17 alpha-hydroxyprogesterone (17-ohp; 86 +/- 46 ng/100 ml), were significantly lower (p less than 0.01 to less 0.05) than in eight eugonadal men (605 +/- 180 and 136 +/- 39 ng/100 ml, respectively). the ratio of 17-ohp to testosterone, however, was comparable in both groups (0.29 +/- 0.09 vs. 0.24 +/- 0.08; p less than 0.10). in the klinefelter patients, basal p ... | 1978 | 263344 |
| ["in vitro" study on the susceptibility of "yersinia pestis", isolated in brazil, to sulfonamides, tetracyclines, aminoglycosides, penicillins and erythromicine]. | | 1975 | 1088769 |
| [bacteriocinogeny in yersinia enterocolitica]. | bacteriocinogeny was found in 19.8 per cent of y. enterocolitica strains tested. it was designated by the authors as enterocoliticacinogeny and the substance produced by the pathogen was named enterocoliticacine. bacteriocinogeny was found among the collection strains isolated in the south primorye and not among the strains isolated abroad. some cultures of y. enterocolitica isolated abroad and in the south primorye were used as indicator strains for revealing enterocoliticacinogeny. enterocolit ... | 1975 | 1091204 |
| aromatic amino acid transport in yersinia pestis. | the uptake and concentration of aromatic amino acids by yersinia pestis tjw was investigated using endogenously metabolizing cells. transport activity did not depend on either protein synthesis or exogenously added energy sources such as glucose. aromatic amino acids remained as the free, unaltered amino acid in the pool fraction. phenylalanine and tryptophan transport obeyed michaelis-menten-like kinetics with apparent km values of 6 x 10(-7) to 7.5 x 10(-7) and 2 x 10(-6) m, respectively. tyro ... | 1975 | 238939 |
| [occurrence of induced vitamin-dependent mutants of yersinia pestis]. | vitamin-dependent mutants were isolated from yersinia pestis after the treatment with supermutagens. from 13 mutants obtained 10 appeared to be unstable. the stable vitamin-dependent mutants were revealed with the frequency of 2.5.10(-11) divided by 4.9.10(-11) by the indirect method of selection and 5.10(-7) by the use of davis's method. the frequency of amino acid and nitrogen base dependent auxotroph isolation was significantly higher than that of the vitamin-dependent mutants. | 1977 | 614956 |
| siderochrome production by yersinia pestis and its relation to virulence. | p+ plague strains contained more siderochrome-producing organisms than p-. siderochrome enhanced the mouse virulence of an f1+vw+p1+p-pu+ strains, inhibited p1 activity, and could be assayed by a paper disk titration method. | 1975 | 1104486 |
| the phylogenetic status of pasteurella pestis. | yersinia pestis has been characterized in terms of fingerprints of digests (pancreatic and/or t1 ribonuclease) of its 16s and 5s ribosomal rnas. these show clearly that y. pestis is a member of the enterobacteriaceae and suggest that within the family it is most closely related to serratia and/or proteus. | 1975 | 1107566 |
| [effect of the digestive process on the survival of the plague agent in xenopsylla gerbilli minax fleas]. | hystological investigations of experimentally infected x. gerbilli minax have shown that at the early stages of the digestion, while in the intestine compact clots of non-digested blood, are preserved, proceeds the reproduction of the plague agent. with the decay of the alimentary clot it changes into the dying off of the microbe population and after the ceasing of digestion the accumulation of bacteria renews again. simultaneously with the changes in the number of microbes their morphology vari ... | 1977 | 593719 |
| endemic human plague in new mexico: risk factors associated with infection. | a retrospective case-control study was conducted to identify risk factors, other than contact with infected animal tissues, for infection caused by yersinia pestis in non-indian residents of areas with endemic sylvatic plague in new mexico. the study group consisted of 16 persons who had bacteriologically confirmed cases of plague in the period 1975-1976 and 45 controls who were matched by age, sex, and location of residence. participants were questioned about outdoor activities, environmental c ... | 1979 | 574152 |
| crown gall: economic importance and control. | many plants of economic importance are possible hosts for agrobacterium tumefaciens, the causal organism of the crown gall tumor disease. damage has been reported on stone fruit (australia), vineyard (hungary, bulgaria), lettuce (brasil) ... in western-europe, crown gall seems to be of less economic importance for plants growing in the open air. however, plants cultivated in greenhouses have a greater chance to be tumorized, because of the more favourable circumstances for tumor induction. moder ... | 1979 | 549390 |
| the effect of temporary exercising of a joint during an immobilization period: an experimental study on rabbits. | the right hind limbs of adult rabbits were immobilized for 5 weeks. the rabbits were then allowed to move freely for 8 weeks. the rabbits of the control group were immobilized uninterruptedly. in a second group of rabbits the plaster was removed during the immobilization period 6 days a week for 5 minutes for careful exercise and in a third group of rabbits, for violent exercise. the temporary careful exercise was of no benefit and was sometimes harmful, and the violent exercise was usually inju ... | 1979 | 535243 |
| letter: reactions of cartilage. | | 1975 | 1113834 |
| measurement of rates of lipogenesis with deuterated and tritiated water. | | 1975 | 1121283 |
| enzymatic formaldehyde production from 5-methyltetrahydrofolic acid: prior step to alkaloid formation. | | 1975 | 1125096 |
| influence of age and sex on the metabolism of oestrogens in mouse liver: in vitro perfusion of radioactive oestrone and oestradiol-17beta. | | 1975 | 1134094 |
| proceedings: cell-wall composition of aerobic cutaneous "diphtherios" organisms. | | 1975 | 1142405 |
| histologic diagnosis of diseases of malabsorption. | the diagnoses which may be arrived at by examination of peroral small bowel mucosal biopsy specimens are presented. celiac sprue, unclassified sprue (refractory sprue), infectious gastroenterititis, stasis syndrome and kwashiorkor have a severe mucosal lesion. other clinical conditions are required to establish the diagnosis in these diseases. a number of diseases have specific diagnostic features. included are whipple's disease, abetalipoproteinemia, collagenous sprue, primary intestinal lympho ... | 1979 | 517556 |
| letter: cryptic infection of rats with non-encapsulated variants of yersinia pestis. | | 1975 | 1145712 |
| human plague in new mexico: report of three autopsied cases. | plague is a deadly disease of obvious concern to individuals, communities, and public health officials. the rapid recognition of plague victims is of paramount importance in saving the lives of the victims and in the protection of contacts. three autopsied plague cases have been presented and the pathological features have been discussed. | 1979 | 512611 |
| catecholamines and intracranial pressure. | | 1979 | 430167 |
| proceedings: the effect of tris on the response of various isolated, mammalian preparations to nerve and drug stimulation. | | 1975 | 1151799 |
| proceedings: effects of histamine, 2-methylhistamine and 4-methylhistamine on blood pressure and vascular resistance in the cat. | | 1975 | 1151865 |
| proceedings: the influence of extracellular potassium ions on the action of ouabain on membrane currents in sheep purkinje fibres. | | 1975 | 1151872 |
| [epizootiological importance of frontopsylla hetera (siphonaptera) fleas in the gorno-altai natural plague focus]. | experiments conducted during all seasons have established that f. hetera, one of the mass species of fleas in mountain altai, can be infected both by the strain of selective virulence typical to this nidus and by the non-typical non-virulent mountain-altai strain of plague agent. the non-virulent strain does not form in fleas the block of proventriculus and within 1.5-2 months they become free from the microbe. at the infection with the typical strain of the altai subspecies rare transmissions o ... | 1978 | 622294 |
| [experience from a 30-year study of the stability of the properties of the plague vaccine strain ev in the ussr]. | | 1975 | 1154937 |
| atypical plague bacilli isolated from rodents, fleas, and man. | | 1978 | 637172 |
| comparative morphology of genital cones of genus ancylostoma dubini, 1843. | male worms of ancylostoma braziliense, a. ceylanicum, a. kusimaense, a. malayanum, a. duodenale, a. caninum, a. tubaeforme, agriostomum vryburgi and cyclodontostomum purvisi have the external appendages beside the anogenital aperture. these anogenital structures are morphologically similar and are assumed to be homologous among the species with three pairs of teeth or more. in hookworms with two pairs of teeth, the anogenital structures are complex. anogenital features can be used as a taxonomic ... | 1975 | 1166351 |
| [resistance to plague of mice experimentally infected with "yersinia enterocolitica" (author's transl)]. | | 1978 | 718023 |
| [litter effect on fetal toxicity test]. | | 1975 | 1169531 |
| cyclic kinetics and mathematical expression of the primary immune response to soluble antigen. vi. the possibility of prediction of plasma cell reaction in the spleen of mice immunized with soluble antigen. | a mathematical expression of the accumulation of the plasma cells in the spleen of cba mice immunized intraperitoneally is presented. the dependence of the plasma cell reaction in the spleen on the kinetics of antigen concentration in the blood was confirmed. for the transition from antigen to plasma cells, index a was proposed. the mean values of index a were used for comparison of the calculated and experimental values of the plasma cell reaction and the recorded differences were not great. in ... | 1975 | 1176044 |
| [deacylating activity of sera as a cause for the ineffectiveness of the treatment of experimental plaque in white mice with benzylpenicillin]. | it was shown that serum of albino mice infected with plague microbe cells inactivated benzylpenicillin. such deacetylating activity reached its peak by the 3rd day and after that decreased reaching by the 5th--7th day the level registered in non-infected animal and being apparently of non-specific character. ampicillin proved to be 2 times more resistant to the effect of serum acylase as compared to benzylpenicillin. it was supposed that the ability of serum of infected animals to inactivate ben ... | 1977 | 848916 |
| a study of viral fever in the city of madras. | | 1975 | 1184536 |
| serological studies on human plague in southern africa. part ii. a bubonic/pneumonic plague epidemic in lesotho. | a description is given of an outbreak of human plague in lesotho in 1968 which was preceded by, and merged with, a typhoid epidemic. this circumstance was responsible for a diagnosis of typhoid fever being made in the earliest plague cases, especially as the clinical presentation was similar to that of the typhoid patients. consequently, the plague epidemic ran its natural course and with the onset of winter the pneumonic form appeared. serological follow-up studies of recovered patients were ca ... | 1976 | 935988 |
| electrospinogram and spinal and cortical evoked potentials in experimental spinal cord trauma. | studies in 28 traumatized cats showed the following acute changes after spinal cord compression in the cord segment below the trauma: 1) increase in size of the spinal cord evoked potential; 2) increase in size of the electrospinogram; and 3) increase in frequency of the electrospinogram. | 1975 | 1194940 |
| brain 2-phenylethylamine as a major mediator for the central actions of amphetamine and methylphenidate. | | 1975 | 1196013 |
| synchronization of the fission yeast schizosaccharomyces pombe using heat shocks. | | 1975 | 1196141 |
| bubonic plague from exposure to a rabbit: a documented case, and a review of rabbit-associated plague cases in the united states. | a 62-year-old woman developed bubonic plague with an epitrochlear bubo one to two days after skinning two cottontail rabbits. the implicated rabbits were later recovered from the patient's freezer, and yersinia pestis was isolated from marrows of both rabbits. although human plague cases in the united states have occasionally been traced to exposure to wild rabbits, this is the first documentation of plague infection in the actual rabbits to which the patient was exposed. all reported cases of r ... | 1976 | 937344 |
| the functional consequences of colectomy. | the colon plays a decisive role in salt and water conservation in the intact human, normally removing from the terminal intestine approximately one liter of isotonic fluid that escapes small bowel absorption. the primary purpose of this colon function is probably to prevent extracellular fluid volume depletion and only incidentally to produce a normal solid stool. the patient with an ileostomy can partly adapt to replace the absorptive capacity lost after colectomy but is still vulnerable if sal ... | 1975 | 1200267 |
| studies of the human testis. xi. leydig cell clusters and levels of intratesticular testosterone and 20 alpha-dihydroprogesterone. | testosterone concentration in testes of 23 men, ages 51 to 90, was determined as 490 +/- 172 ng/g tissue (m +/- s.d.) and 20 alpha-dihydroprogesterone concentration as 10.0 +/- 2.3 ng/g tissue (m +/- s.d.) in 18 men of the same patient group. leydig cells were estimated by the number of leydig cell clusters per tubule. there was a high correlation (r = 0.88, p less than .001) of the leydig cell index with intratesticular testosterone. it is proposed that the leydig cell cluster index provides a ... | 1978 | 263345 |
| proceedings: anaesthetics in porphyria: intravenous induction agents. | | 1975 | 1201181 |
| median rhomboid glossitis. candidiasis and not a developmental anomaly. | infection by candida albicans was found in all biopsies taken from ten patients presenting with midline lesions of the tongue which clinically presented as median rhomboid glossitis. | 1975 | 1201190 |
| binding of vitamin b12--rat transcobalamin ii and free vitamin b12 to plasma membranes isolated from rat liver. | when dialysed rat serum which contains a single, low molecular weight binder for vitamin b12, rat transcobalamin ii (rat tc-ii), was labelled in vitro with 57co-vitamin b12 and then incubated at 30 degrees c (ph 7-5) with vesicles of highly purified plasma membranes separated from microsomal fractions of rat liver by density gradient centrifugation, the 57co-vitamin b12-rat tc-ii complex bound to high affinity sites on the vesicles via a specific (binding after correction for 'non-specific' bind ... | 1975 | 1201244 |
| new inhibitors of methane production by rumen micro-organisms. experiments with animals and other practical possibilities. | 1. two inhibitors of rumen methane production were given to sheep and their effects were measured using an in vitro technique. 2. the substances used were trichloroethyl pivalate (tce-p) and trichloroethyl adipate (tce-a). in one experiment with two sheep tce-p was injected into the rumen and in another experiment with two sheep the same inhibitor was mixed with the food just before feeding. in another experiment, tce-a was given to two sheep at two dose levels, and in an experiment with four sh ... | 1975 | 1201268 |
| polypectate digestion by yersinia. | the ability of yersinia to digest polypectate may be of some value in differentiating y. enterocolitica and y. pseudotuberculosis from some of the other fermenting gram-negative bacilli, such as enterobacter agglomerans, with which they can be confused. pectolytic activity in yersinia may also have some teleologic or taxonomic significance about which we do not care to speculate. | 1975 | 1206110 |
| [sensitivity of inbred mice to the causative agent of plague]. | | 1975 | 1210890 |
| [variety of effects of vitamins on yeast cells in aerobic conditions]. | the effect of thiamine and biotin on the processes of cell division, assimilation of glucose, and accumulation of the biomass and nitrogen in the cells was studied with the candida yeast. the action of the vitamins depended on the source of nitrogen. in some strains, asparagine can substitute for biotin. biotin has different effect on the production of gamma-aminobutyric acid in candida pulcherrima, c. guilliermondii. c. tropicalis k3-10. high concentrations of arginine were found in c. guillie ... | 1975 | 1214604 |
| [electron microscopic study of double infection induced by potato virus x and potato virus y in nicotiana glutinosa]. | | 1975 | 1214639 |
| [effect of the prolonged contact of a flea population with plague bacteria on the infective activity of vetors]. | results of the experimental infection of fleas (x. cheopis) with the plague agent after their long (2.5 years, 19 generations) feeding on infected white mice showed no difference in the infection activity of these insects as compared to control ones. the authors question the hypothesis according to which a low frequency of protein-formation in some species of fleas is due to their long contact with the plague agent in the historical past. | 1975 | 1221343 |
| blockade by morphine of acetylcholine release from the caudate nucleus in the mid-pontine pretrigeminal cat. | | 1975 | 1111819 |
| [isolation and properties of several auxotrophic mutants of a highly virulent strain of the plague microbe]. | 2432 stable auxotrophic mutants were selected from high virulent yersinia pestis strain 20b after treatment with nitroso guanidine. they were deficient in amino acids (arginine, aspartic acid, citrulline, glycine, glutamic acid, histidine, isoleucine, serine, leucine, lysine, ornithine, proline, tryptophan, tyrosine, valine), pyrimidine and vitamins (riboflavin, thyamine, nicotinamide). some mutants were two- and three-fold dependent. the leucine-, histidine-, purine-dependent mutants were isola ... | 1975 | 1232031 |
| similar combining sites of igg1 and igg2a antibodies in individual mice as judged from affinity and rate constant measurements. | within individual sera, mouse igg1 and igg2a subclass antibodies against the antigenic determinant oligo-d-alanine are likely to have similar combining sites. the antibodies are characterized by two methods, by their rate of binding to antigen equipped sheep red blood cells and by the hapten inhibition of antigen binding. the two characteristics are shown to be independent. the subclass antibodies of thirteen different sera differ by a factor of about 10 in their rate constant and by a factor of ... | 1975 | 1234045 |
| cat bite transmission of yersinia pestis infection to man. | the transmission of bubonic plague from the kitten of a domestic cat to a man by means of a bite on a finger is described. the human case was complicated by the development of a secondary meningitis, followed, after specific therapy, by protracted recovery. the kitten showed swollen lymph nodes of the head and neck, frothing at the mouth and nostrils, and signs of an acute infectious disease which had a fatal termination. yersinia pestis was isolated on about the 8th day from the cerebrospinal f ... | 1975 | 1238568 |
| [electron microscopic studies of epinephrine choroiditis in rabbits. 3. scanning electron microscopic observations of the retinal pigment epithelial cells in the early stage (author's transl)]. | | 1975 | 1239915 |
| [determination of human placental lactogen in the blood of pregnant women by rcc-hpl-ria kit--experimental studies]. | | 1975 | 1240044 |
| exteroceptive suppression and motor control of the masseter and temporalis muscles in normal man. | single electrical stimuli to the gums and mucosa inside the mouth elicit two successive exteroceptive suppressions (es1 and es2) in the voluntary electromyogram of the masseter and temporalis muscles in normal man. the same afferent axons appear to be involved in the two effects, as indicated by the intensity function, the electrical excitability, the afferent conduction velocity and the lack of differential effect of xylocaine infiltration of the inferior alveolar nerve. two similar phases of i ... | 1975 | 1111848 |
| free amino acids in human tonsillar tissue. | free amino acids in the tonsils of 20 individuals were measured column chromatographically. those always found in readily detectable amounts included o-phosphoserine, taurine, o-phosphoethanolamine, aspartic acid, hydroxyproline, threonine, serine, glutamic acid, proline, glycine, alanine, alpha-amino-n-butyric acid, valine, cystine, methionine, isoleucine, leucine, tyrosine, phenylalanine, ornithine, gamma-amino-butyric acid, lysine, histidine, and arginine. results were compared for three clin ... | 1975 | 1112054 |
| separation of two hepatitis b human antibody fractions by cold-ethanol precipitation. | antibodies to three different samples of hepatitis b antigen-positive serum were found to be absent from a cohn fraction ii hepatitis b immune globulin preparation, but present in the whole plasma from which the immune globulin was made. fractions containing the antibodies specific for the three antigen samples were isolated from the plasma by euglobulin precipitation, and the antibodies were characterized as to immunoglobulin class and precipitability in the cohn fractionation procedure. they a ... | 1976 | 1251569 |
| familial clustering of selective iga deficiency. | serum iga levels of 35 healthy iga-deficient index cases, of their 180 first-degree relatives, and of 31 other family members were studied. iga deficiency was detected in 7.2% of the first-degree relatives, which is significantly more than the 0.25% frequency of iga deficiency in healthy finnish blood donors. subnormal serum iga levels were found in additional 13 (7.2%) first-degree relatives. the familial clustering of iga deficiency seemed to be controlled by multigenic factors. iga-deficient ... | 1976 | 1251582 |
| [diagnostic problems in gout in a 44-year-old man]. | | 1976 | 1251615 |
| the effect of subdermal testosterone filled polydimethylsiloxane implants on spermatogenesis in rhesus monkeys (macaca mulata). | previously it was reported that testosterone-filled polydimethyl silicone (pds) implants induced azoospermia in male rabbits without chronically altering plasma testosterone concentration or the weight or secretory activity of accessory sex glands. assayable serum luteinizing hormone (lh) and testicular testosterone secretion were completely suppressed. testosterone emanating from the pds capsule maintained libido but failed to support spermatogeneis in the rabbits. to test results in subhuman ... | 1976 | 1261261 |
| the detection of antibodies in human and animal filariases by counterimmunoelectrophoresis with dirofilaria immitis antigens. | counterimmunoelectrophoresis revealed the presence of precipitin antibody in all of 6 dogs and the 1 cat infected with dirofilaria immitis and in the serum of 17 of 24 individuals living in a setting of hyperendemic subperiodic bancroftian filariasis. antigens used in the test were prepared from microfilariae and adult male d. immitis. some humans and animals had antibodies to both antigens while others had antibodies against microfilariae or adult worms only. the presence of soluble circulating ... | 1976 | 1262695 |
| attenuated, streptomycin-dependent salmonella typhi oral vaccine: potential deleterious effects of lyophilization. | four studies were done with streptomycin-dependent salmonella typhi as an oral, attenuated vaccine. studies 1 and 3 employed freshly harvested vaccine, whereas studies 2 and 4 involved lyophilized vaccine. five to eight doses (3 x 10(10)-10(11) organisms/dose) were given; oral streptomycin (1.0 g) was administered concomitantly in studies 2 and 3, with only two of the doses of vaccine in study 1, and was not given in study 4. no adverse reactions were encountered in 179 vaccinated men, and 94% o ... | 1976 | 1262709 |
| yersinia pestis infection in vietnam. ii. quantiative blood cultures and detection of endotoxin in the cerebrospinal fluid of patients with meningitis. | quantitative blood cultures were obtained from 42 patients with acute yersinia pestis infection to determine whether the concentration of bacteria in blood influenced the clinical severity and outcome of illness. in 17 bacteremic patients, colony counts in blood cultures ranged from less than 10 to 4 x 10(7)/ml. three of five patients with colony counts of greater than 10(2)/ml died, and two patients survived episodes of hypotension. results from plasma limulus tests were positive at the time of ... | 1976 | 1262715 |
| [use of erythrocyte diagnostic agents for the determination of integrative association constants]. | the authors described a method of determination of integrative association constant differing from intrinsic association constant by the value of the valency of macromolecular antigen. the method is based on the using of erythrocytes on whose surface one of the components is fixed, whereas the other is in free state. application of equations was demonstratedon a number of examples with determination of integrative association constant. the data obtained permitted to assess qualitative peculiarit ... | 1976 | 1266452 |
| [cryosurgery of the esophagus and the cardia in animal experiments]. | | 1976 | 1272986 |
| the toxic effects of dieldrin in rats: a reevalution of data obtained in a two-year feeding study. | | 1976 | 1273845 |
| the isolation and identification of noradrenaline and dopamine from the venom of the honey bee, apis mellifica. | | 1976 | 1273857 |
| [changes in the activity of succinate dehydrogenase in the cells of different brain structures under the effect of uhf field of low intensity]. | | 1976 | 1274298 |
| glial cells and extracellular potassium: their relationship in mammalian cortex. | simultaneous recordings were made of glial cell potentials and the extracellular potassium concentration ([k+]o) in cat cortex in an attempt to provide more quantitative information about the sensitivity of mammalian neuroglia to changes in [k+]o. a penicillin epileptogenic focus served to generate both transient and sustained elevations in [k+]o, thus allowing measurement of glial membrane potential (vm) at both resting and increased [k+]o levels many times during the same experiment. resting v ... | 1976 | 1276917 |
| [morphological and histochemical changes in the flea x. cheopis roths. infected with plaque bacilli]. | | 1975 | 1113714 |
| acrylamide-induced alterations in axonal transport. biochemical and autoradiographic studies. | alterations in the axonal transport of proteins, glycoproteins, and gangliosides in sensory neurons of the sciatic nerve were examined in adult male rats exposed to acrylamide (40 mg ip/kg body wt/d for nine consecutive days). twenty-four hours after the last dose, the l5 dorsal root ganglion (drg) was injected with either [35s]methionine to label proteins or [3h]glucosamine to label glycoproteins and gangliosides. the downflow patterns of radioactivity for [35s]methionine-labeled proteins and [ ... | 1992 | 1282332 |
| regeneration of an adult peripheral nerve preparation in culture. | the methods used to maintain the vagus nerve from the adult rat in culture and how regeneration is studied in this preparation are described. a hypothesis is presented on the triggering of the cell body reaction. it is suggested that this reaction is initiated by proteins synthesized in nonneuronal cells at the site of a nerve lesion. these proteins, referred to as regenerins, reach the nerve cell body by retrograde axonal transport, where they initiate the regeneration process. | 1992 | 1282333 |
| isolation of dna polymerase gamma from an adenovirus 2 dna replication complex. | the major dna polymerase in a nuclear membrane complex that is capable of synthesizing viral dna sequences in vitro has been purified about 900-fold from adenovirus 2-infected kb cells. the enzyme was characterized as belonging to the class of mammalian dna polymerases (dna polymerase gamma) that can utilize poly(a) with oligo(dt) as template primer. | 1975 | 1142477 |
| child health surveillance. surveillance of the child under 5. | 1. general health checks should be made at the following times as outlined in these guidelines: initial neonatal assessment 7-10 day check, 6-week check, 7-9 months: general examination with particular attention to hearing and vision, 18-24 months: check with special attention to gait, speech and understanding, 36-42 months: general examination and developmental assessment, 2. parental concern over a child's special senses should be carefully followed up and investigated. 3. immunization schedul ... | 1992 | 1285363 |
| separation of phenylalanine transport events by using selective inhibitors, and identification of a specific uncoupler activity in yersinia pestis. | phenylalanine transport in yersinia pestis tjw was differentially inhibited by sulfhydryl blocking reagents, uncoupling agents, and respiratory inhibitors. kinetic studies with potassium cyanide and sodium azide showed that these compounds have no immediate effect on the initial rate of phenylalanine transport, but have an immediate and severe inhibitory effect on the rate of oxygen uptake. identical studies with p-chloromercuribenzoate (pcmb) and 2,4-dinitrophenol (dnp) showed that these compou ... | 1975 | 1150617 |
| [biological characteristics of tumor growth delay in human nasopharyngeal carcinoma xenograft (npc-837) after irradiation]. | tumor growth and cell cycle of human nasopharyngeal carcinoma xenograft in nude mice (npc-837) after irradiation were studied. after cobalt-60 irradiation of 5.0gy, 7.5gy, 10gy, 15gy and 20gy, the tumor volume was reduced to 80, 70, 50, 35 and 10 percent of the control, respectively. however, the tumors began to grow again. the time (in days) the tumors took to reach the volume of the control was radiation dose-dependent. with 20 gy irradiation the tumor volume was kept at 10% of the control lev ... | 1992 | 1291288 |
| [dna probe for detecting yersinia pestis and serovariant i of yersinia pseudotuberculosis by detecting specific dna repeating sequences]. | in order to construct a dna probe for the plague pathogen detection, we have obtained the recombinant plasmid prd100 carrying an ecori-flanked 140 bp fragment from the genetically silent region of yersinia pestis species-specific plasmid pyp1. when used as a dna probe for hybridization of dna from various strains of 25 bacterial species, this dna fragment was shown to have the complementary sequences in all investigated yersinia pestis strains (200), including the plasmid pyp1 lacking ones, and ... | 1992 | 1298882 |
| [serovariation of the plague pathogen capsular antigen]. | the phenomenon of serovariation in the capsule antigen of the plague pathogen has been found. the synthesis of fi-serovar is determined by the expression of the caf1m gene. the damages in the caf1m gene structure result in production of the fi1 and fi2 serotypes. expression of the caf1m gene does not affect the secretion of fi-antigen. | 1992 | 1298883 |