| purification of epstein-barr virus dna polymerase from p3hr-1 cells. | the epstein-barr virus dna polymerase was purified from extracts of p3hr-1 cells treated with n-butyrate for induction of the viral cycle. sequential chromatography on dna cellulose, phosphocellulose, and blue sepharose yielded an enzyme preparation purified more than 1,300-fold. the purified enzyme was distinct from cellular enzymes but resembled the viral dna polymerase in cells infected with herpes simplex virus type 1 or 2. the active enzyme had an apparent molecular weight of 185,000 as est ... | 1985 | 2985818 |
| development and analysis of a transformation-defective mutant of harvey murine sarcoma tk virus and its gene product. | the harvey murine sarcoma virus has been cloned and induces focus formation on nih 3t3 cells. recombinants of this virus have been constructed which include the thymidine kinase gene of herpes simplex virus type 1 in a downstream linkage with the p21 ras gene of harvey murine sarcoma virus. harvey murine sarcoma tk virus rescued from cells transfected with this construct is both thymidine kinase positive and focus inducing in in vitro transmission studies. the hypoxanthine-aminopterin-thymidine ... | 1985 | 2985821 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| gamma 2-thymidine kinase chimeras are identically transcribed but regulated a gamma 2 genes in herpes simplex virus genomes and as beta genes in cell genomes. | true gamma or gamma 2 genes, unlike alpha, beta, and gamma 1 (beta gamma) genes of herpes simplex virus 1 (hsv-1), stringently require viral dna synthesis for their expression. we report that gamma 2 genes resident in cells were induced in trans by infection with hsv-1 but that the induction did not require amplification of either the resident gene or the infecting viral genome. specifically, to test the hypothesis that expression of these genes is amplification dependent, we constructed two set ... | 1985 | 2985955 |
| drosophila p element-enhanced transfection in mammalian cells. | we constructed a gene transfer vector containing the herpes simplex virus type 1 thymidine kinase (tk) gene flanked by drosophila p element terminal repeats (w. r. engels, annu. rev. genet. 17:315-344). this vector was introduced into mouse ltk- cells and enhanced the frequency of stable transformation to the tk+ phenotype by approximately 50-fold relative to a similar plasmid lacking the p element terminal repeats. | 1985 | 2985975 |
| herpes simplex virus latency in the rabbit trigeminal ganglia: ganglionic superinfection. | it has been confirmed and further documented that infection of the rabbit cornea with the e-43 strain of hsv-1 precludes superinfection of the corresponding trigeminal ganglia by another hsv strain, i.e., the challenging virus does not establish latency and can not be recovered from the ganglia. it was shown that after primary infection, a state of resistance is established in the neuronal cells of the ganglia, and although the challenging strain reaches the ganglia, it does not cause discernibl ... | 1985 | 2986150 |
| vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d prevents latent herpes in mice. | in humans, herpes simplex virus causes a primary infection and then often a latent ganglionic infection that persists for life. because these latent infections can recur periodically, vaccines are needed that can protect against both primary and latent herpes simplex infections. infectious vaccinia virus recombinants that contain the herpes simplex virus type 1 (hsv-1) glycoprotein d gene under control of defined early or late vaccinia virus promoters were constructed. tissue culture cells infec ... | 1985 | 2986288 |
| [immunoprecipitation, with an antiserum to ovalbumin, of protein np from influenza a virus and of glycoprotein c from the herpes simplex type i virus]. | antisera to ovalbumin and to thyroliberin react in radioimmunoprecipitation and radioimmunoassay with np protein of influenza a virus and c glycoprotein of herpes simplex virus whose mutual amino acid homology does not practically exceed the limits of homology in tripeptides. both proteins contain a tripeptide area corresponding to thyroliberin tripeptide. | 1985 | 2986359 |
| [prevention and therapy of herpesvirus infections]. | the group of the human-pathogenic herpesviruses comprises five subgroups: herpes simplex virus type 1 (hsv-1), herpes simplex virus type 2 (hsv-2), varicella zoster virus (vzv), cytomegalovirus (cmv), and epstein-barr virus (ebv). primary infection with these ubiquitous herpesviruses usually occurs in childhood or during adolescence and frequently remains inapparent. however, it can also give rise to a variety of clinical pictures. important clinical manifestations of herpesvirus infections are ... | 1985 | 2986378 |
| a comparison of the effects of cytotoxic cerebrospinal fluid on cell cultures with other cytopathogenic agents. | protein synthesis, antigen synthesis, and cell membrane permeability were analyzed after inoculating human diploid fibroblasts with control or cytotoxic csf, herpes simplex virus type 1 (hsv 1), poliovirus 3, or clostridium difficile toxin. whereas protein synthesis and membrane permeability were affected by the viruses, and virus antigens detectable by pooled human serum were synthesized, the bacterial toxin and cytotoxic csf did not induce any new proteins or antigens, although the cytotoxic c ... | 1985 | 2987025 |
| murine mammary fm3a carcinoma cells transformed with the herpes simplex virus type 1 thymidine kinase gene are highly sensitive to the growth-inhibitory properties of (e)-5-(2-bromovinyl)-2'-deoxyuridine and related compounds. | murine mammary carcinoma (fm3a tk-/hsv-1 tk+) cells, which are thymidine kinase (tk)-deficient but have been transformed with the herpes simplex virus type 1 (hsv-1) tk gene are inhibited in their growth by (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu), (e)-5-(2-iodovinyl)-2'-deoxyuridine (ivdu) and (e)-5-(2-bromovinyl)-2'-deoxycytidine (bvdc) at 0.5, 0.5 and 0.8 ng/ml, respectively; i.e., a concentration 5000 to 20 000-fold lower than that required to inhibit the growth of the corresponding wild- ... | 1985 | 2987041 |
| erythema multiforme and herpes simplex virus. | it has been suggested that herpes simplex virus (hsv) can trigger erythema multiforme (em) at different times. one recent study showed hsv antigen in immune complexes of patients with em. the purpose of our study was to assess a possible association between em and hsv. sixteen patients and 16 matched controls were studied using an enzyme-linked immunosorbent assay (elisa) to measure antibody of the igg, iga, and igm classes against hsv-1. from our study on patients with oral erythema multiforme, ... | 1985 | 2987326 |
| synergism between recombinant human interferon and nucleoside antiviral agents against herpes simplex virus: examination with an automated microtiter plate assay. | an automated, quantitative, cytopathic effect (cpe) inhibition assay with human fibroblasts in 96-well microtiter plates was used to examine the combination of recombinant human interferon-alpha (rifn-alpha a) and acyclovir, vidarabine, or dihydroxypropoxymethyl guanine against herpes simplex virus types 1 (hsv-1) and 2 (hsv-2) in vitro. fifty percent cpe (cpe50) end points, calculated from optical density readings of crystal violet-stained monolayers in an automated spectrophotometer, represent ... | 1985 | 2987369 |
| nuclear matrix modifications at different stages of infection by herpes simplex virus type 1. | in bhk-21 cells infected with herpes simplex virus type 1 many virus-induced proteins were found attached to the nuclear matrix. to understand the role of this cell fraction during virogenesis, matrix-associated proteins were analysed at different stages of infection. all the immediate-early protein species were bound to the nuclear matrix and their association with this structure was stable. during the first few hours of infection, the pattern of virus-induced proteins attached to the nuclear m ... | 1985 | 2987397 |
| comparison of herpes simplex virus type 1 dna replication and virus production in murine bone marrow-derived and resident peritoneal macrophages. | the mechanism of resistance of murine macrophages (m phi) to infection by herpes simplex virus type 1 (hsv-1) was examined. infection of bone marrow-derived m phi (bmdm phi) and resident peritoneal m phi (res-m phi) was compared with infection of permissive vero cells. in contrast to hsv-1 infection in vero cells, no infectious virus was produced from either m phi cell type. however, marked cytopathic effect (c.p.e.) was evident in bmdm phi at 48 h post-infection, while there was no c.p.e. at an ... | 1985 | 2987398 |
| the alpha sequence of the cytomegalovirus genome functions as a cleavage/packaging signal for herpes simplex virus defective genomes. | although herpes simplex virus (hsv) 1 and human cytomegalovirus (cmv) differ remarkably in their biological characteristics and do not share nucleotide sequence homology, they have in common a genome structure that undergoes sequence isomerization of the long (l) and short (s) components. we have demonstrated that the similarity in their genome structures extends to the existence of an alpha sequence in the cmv genome as previously defined for the hsv genome. as such, the alpha sequence is predi ... | 1985 | 2987533 |
| the immediate-early enhancer element of herpes simplex virus type 1 can replace a regulatory region of the c-ha-ras1 oncogene required for transformation. | a 0.8-kilobase saci dna fragment in the distal 5'-noncoding region of the c-ha-ras1 oncogene hybridized to high guanine x cytosine sites of herpes simplex virus type 1 (hsv-1) dna restriction fragments. nucleotide sequence comparisons localized one of these sites to the intergenic region of hsv between the immediate-early genes coding for iemrna-3 and iemrna-4/5 that has enhancer-type activity. we tested the possibility that the hsv-1 enhancer and the upstream c-ha-ras1 saci fragment were functi ... | 1985 | 2987541 |
| cloning, sequencing, and functional analysis of oril, a herpes simplex virus type 1 origin of dna synthesis. | the herpes simplex virus type 1 genome (160 kilobases) contains three origins of dna synthesis: two copies of oris located within the repeated sequences flanking the short unique arm (us), and one copy of oril located within the long unique arm (ul). precise localization and characterization of oril have been severely hampered by the inability to clone sequences which contain it (coordinates 0.398 to 0.413) in an undeleted form in bacteria. we report herein the successful cloning of sequences be ... | 1985 | 2987682 |
| detailed analysis of the mrnas mapping in the short unique region of herpes simplex virus type 1. | we have analysed the mrnas which map within the short unique (us) region of the herpes simplex virus type 1 (hsv-1) genome. us has a total length of 12979 base pairs (1) and is extensively transcribed with approximately 94% of the total sequence present in cytoplasmic mrnas and 79% of the total sequence considered to be protein coding. there are several examples of overlapping functions and multiple use of dna sequence within this region. us contains 12 genes (1) which are expressed as 13 mrnas. ... | 1985 | 2987814 |
| the consensus sequence ygtgttyy located downstream from the aataaa signal is required for efficient formation of mrna 3' termini. | our previous dna sequence comparisons of 3' terminal portions from equivalent herpes simplex virus type 1 (hsv-1) and hsv-2 genes identified a conserved sequence (consensus ygtgttyy; y = pyrimidine) located approximately 30bp downstream from the aataaa signal. we report here that this signal is located downstream from 67% of the mammalian mrna 3' termini examined. using constructions with the bacterial chloramphenicol acetyl transferase (cat) gene linked to an hsv 'terminator' fragment, we show ... | 1985 | 2987822 |
| reduced in vivo mutagenesis by mutant herpes simplex dna polymerase involves improved nucleotide selection. | we present evidence that mutation frequencies in a mammalian system can vary according to the replication fidelity of the dna polymerase. we demonstrated previously that several derivatives of herpes simplex virus type 1 that encode polymerases resistant to various antiviral drugs (e.g., nucleotide analogues) also produce reduced numbers of spontaneous mutants. here we show that the dna polymerase from one antimutator virus exhibits enhanced replication fidelity. first, the antimutator virus sho ... | 1985 | 2987953 |
| potentiation of antiherpetic activity of acyclovir by ribonucleotide reductase inhibition. | compound a723u, a 2-acetylpyridine thiosemicarbazone, produced apparent inactivation of herpes simplex virus type 1 (hsv-1) ribonucleotide reductase. inactivation occurred after a723u formed a reversible complex with the enzyme and only while the enzyme was catalyzing the formation of deoxynucleotides. a723u inhibited hsv-1 replication at concentrations that were not toxic to the confluent host cells. most importantly, a723u and acyclovir (acv) were found to exhibit mutual potentiation of their ... | 1985 | 2987969 |
| prevalence of serum antibodies to herpes simplex virus types 1 and 2: application of an elisa technique to 100 cases of anogenital herpes. | sera of 100 patients affected by anogenital herpes were tested by an enzyme-linked immunosorbent assay (elisa) technique using partially purified antigens obtained by extraction from the nuclei of infected vero cells. herpes simplex virus type 1 (hsv-1) was isolated from the anogenital lesions of 17 patients and herpes simplex virus type 2 (hsv-2) from 83 patients. the relative proportions of antibody of the igg class to hsv-1 and hsv-2 were determined and their ratio (r) was calculated, except ... | 1985 | 2988144 |
| [genetic transformation of somatic cells. i. clone of chinese hamster cells defective in thymidine kinase and characterized by high transformation efficiency]. | a characteristics is given of clone a238 of the chinese hamster cells deficient in thymidine kinase (tk). the isolation procedure is described. upon transformation with the aid of dna of plasmids, containing thymidine kinase gene (tk-gene) of herpes simplex virus type 1 (hsv1) clone a238 cells show frequency (7.10(-5) and efficiency (130 tk+ colonies per 1 microgram of plasmid dna) compatible with those of mouse line lmtk- cells. modified transformation and selection conditions of clone a238 cel ... | 1985 | 2988162 |
| genetic linkage but independent expression of functional hsv-1 tk and mammalian aprt genes after cotransfer to l cells. | dna-mediated gene transformation of mouse ltk-aprt-hprt-cells was used to obtain stable, doubly selected transformants simultaneously expressing herpes virus thymidine kinase (tk) and mammalian adenine phosphoribosyltransferase (aprt). cotransformants occurred at a frequency of 5 x 10(-6), a similar frequency for the transfer of the aprt marker has been previously observed. isozyme and southern blot analysis show that the tk and aprt expressed in these transformants resulted from gene transfer. ... | 1985 | 2988726 |
| isomerization of herpes simplex virus 1 genome: identification of the cis-acting and recombination sites within the domain of the a sequence. | previous studies have shown that the a sequence located at the termini and at the junction between the l and s components is the site-specific, cis-acting sequence mediating the inversions of herpes simplex virus 1 dna. we constructed mutated a sequences, inserted them into the thymidine kinase gene, and recombined them into the l component of the viral genome. deletion of uc or ub domains of the a sequence did not affect inversions, whereas the deletion of direct repeat #4 (dr4) drastically red ... | 1985 | 2988789 |
| inhibition of virus multiplication and alteration of cyclic amp level in cell cultures by flavonoids. | the inhibitory effect of four flavonoid compounds on virus multiplication and their influence on the intracellular cyclic amp (camp) level were studied in cell cultures. quercetin and quercitrin reduced the yields of human (alpha) herpesvirus 1 (hsv-1) and suid (alpha) herpesvirus 1 (pseudorabies virus), but hesperidin and rutin had no effect. further, quercetin and quercitrin elevated the intracellular level of camp, whereas hesperidin and rutin did not alter the camp level. both antiviral acti ... | 1985 | 2989000 |
| development of molecular probes for simian herpesvirus detection. | a number of serologic procedures are available for specifically determining past infection due to h. hominis, or h. simiae (b virus). a herpesvirus isolated from primate tissues, however, does not lend itself to specific identification. procedures currently in routine use simply do not provide an unequivocal identification of the isolate. we have previously demonstrated that h. simiae contain polypeptide and glycoprotein antigens distinct from those of other herpesviruses. at selected intervals, ... | 1985 | 2989049 |
| herpes simplex virus type 1 and neuronal cells--a special cell-virus interaction. | rat brain glioma cells were semipermissive for herpes simplex virus (hsv) replication, because the growth of hsv was multiplicity-dependent in these cells. by using this property, we successfully isolated 'survivor' glioma cells following hsv infection at low multiplicity and without using any special treatment (such as uv irradiation) either of the cells or of the virus. under the same conditions there were no survivor bhk or 3t3 cells, which suggests the uniqueness of the glioma cell-hsv inter ... | 1985 | 2989213 |
| subtypes of herpes simplex virus type 1 in japan: classification by restriction endonucleases and analysis of distribution. | an attempt was made to classify herpes simplex virus type 1 (hsv-1) isolates into subtypes on the basis of the combination of the gain or loss of specific cleavage sites of hsv-1 genomes with each of three restriction endonucleases (bam hi, kpn i, and sal i). according to the criteria we used for the determination of hsv-1 subtypes, 93 strains of hsv-1 that were isolated in three areas of japan (sapporo, tottori, and kagawa) were tentatively classified into eight subtypes: subtypes a-h. the bulk ... | 1985 | 2989381 |
| synthesis and antiviral activity of 11-azapentacyclo[6.2.1.0.0.0]decane. | 11-azapentacyclo[6.2.1.0.0.0]decane (6a) as well as its 6,7-dimethyl derivative 6b was synthesized by a novel, four-step sequence that holds promise for the construction of a variety of cage compounds with bridging nitrogen atoms. the hydrochloride salt of 6a was shown to possess no antiviral activity against either the influenza virus a/victoria/3/75 or the herpes simplex viruses hsv-1 and hsv-2. | 1985 | 2989519 |
| synthesis and biological activities of 2-pyrimidinone nucleosides. 2. 5-halo-2-pyrimidinone 2'-deoxyribonucleosides. | 1-(2-deoxy-beta-d-ribofuranosyl)-5-bromo-2-pyrimidinone (brpdr) and 1-(2-deoxy-beta-d-ribofuranosyl)-5-iodo-2-pyrimidinone (ipdr) have been synthesized by condensation of the appropriate silylated bases 2a and 2b, respectively, with 3,5-bis-o-(p-chlorobenzoyl)-2-deoxy-alpha-d-ribofuranosyl chloride (8) in 1,2-dichloroethane, in the presence of sncl4, followed by separation of the anomeric blocked nucleosides via column chromatography and subsequent deprotection with methanolic ammonia. both brpd ... | 1985 | 2989522 |
| synthesis and antiherpetic activity of (s)-, (r)-, and (+/-)-9-[(2,3-dihydroxy-1-propoxy)methyl]guanine, linear isomers of 2'-nor-2'-deoxyguanosine. | racemic 9-[(2,3-dihydroxy-1-propoxy)methyl]guanine [(+/-)-indg], a new analogue of acyclovir (acv) and a structural analogue of 2'-nor-2'-deoxyguanosine (2'ndg), was synthesized and found to inhibit the replication of herpes simplex virus types 1 (hsv-1) and 2 (hsv-2). subsequently, its optical isomers, (r)- and (s)-indg, were prepared from chiral intermediates. the chloromethyl ethers of 1,2-di-o-benzyl-d- and -l-glycerol were made and reacted with tris(trimethylsilyl)guanine to give the 9-alky ... | 1985 | 2989523 |
| nucleotide sequence and structural features of a novel us-a junction present in a defective herpes simplex virus genome. | defective genomes generated during serial propagation of herpes simplex virus type 1 (justin) consist of tandem reiterations of sequences that are colinear with a portion of the s component of the standard viral genome. we determined the structure of the novel us-a junction, at which the us sequences of one repeat unit join the a sequences of the adjacent repeat unit. comparison of the nucleotide sequence at this junction with the nucleotide sequence of the corresponding us region of the standar ... | 1985 | 2989551 |
| passive immunization of mice with monoclonal antibodies to glycoprotein gb of herpes simplex virus. | to investigate the protective ability of monoclonal antibodies (mcas) to viral glycoprotein in herpes simplex virus (hsv) infection, athymic nude mice were inoculated intracutaneously with hsv type-1 (hsv-1) in the midflank. three hours after inoculation, one group of mice was passively immunized with one of a series of mcas to glycoprotein gb of hsv-1, and a control group of mice was given phosphate buffered saline alone. the control mice died within 16 days after infection, whereas the mice pa ... | 1985 | 2989659 |
| identification of five new variable restriction sites in hsv-1 dna. | restriction endonuclease analysis of herpes simplex virus type 1 (hsv-1) dna has shown that individual strains differ from one another. the differences can be recognized by the presence or absence of cleavage sites due to base changes, small insertions and occasional deletions. in a study in which 13 hsv-1 isolates from south africa were analysed, a total of 5 new variable restriction sites were identified using the restriction endonucleases hind iii, eco ri and bgl ii. | 1985 | 2990056 |
| [genetic transformation of somatic cells. ii. an analysis of the status of the plasmid nucleotide sequences in chromosomal dna and the thymidine kinase activity in transformant clone cells]. | chinese hamster a238 tk- -cells were transformed with plasmids (derivatives of pbr325) containing thymidine kinase (tk) gene of herpes simplex virus type 1 (hsv1). the results of dot- and blot-hybridization indicate the presence of pbr325 sequences in the chromosomal fractions of dna in the transformant clones. these sequences are probably tandemly arranged, and each cluster contains 25--50 copies. sv40 sequences cloned in pbr325 were introduced into the chinese hamster cells by co-transformatio ... | 1985 | 2990074 |
| [genetic transformation of somatic cells. iii. an analysis of the status of the plasmid nucleotide sequences in the extrachromosomal dna of transformant clone cells and the rescue of extrachromosomal molecules of the plasmid dna]. | extrachromosomal dnas from tk+ transformant clones of a238 chinese hamster cells isolated after the treatment with plasmid pst826 containing thymidine kinase gene (tk-gene) of herpes simplex virus (hsv1) and 1.8 kb insert of human satellite iii dna (hsiii) were studied by hybridization technique. in two tk+-clones (2t301 and 2t16) large quantities of rearranged plasmid dna molecules were found. electron microscopy show in clone 2t301 the presence of circular dnas with average length being 4.64 + ... | 1985 | 2990075 |
| [genetic transformation of somatic cells. iv. the rate of loss of transformant phenotype depends on the structure of the transforming dna and changes when the cells are treated with the tumor promotor 12-o-tetradecanoyl-phorbol-13-acetate]. | analysis was made of the phenotype stability of some clones of thymidine kinase deficient (tk-) chinese hamster cells transformed by thymidine kinase gene (tk-gene) of herpes simplex virus type (hsv 1). the presence of a fragment of human satellite dna iii in the plasmid dna carrying the tk-gene of hsv 1 reduced notably the rate of the loss of tk+-phenotype, and the treatment of the cells with a tumour promoter--12-o-tetradecanoyl-phorbol-13-acetate--immediately after transformation destabilizes ... | 1985 | 2990076 |
| cell-specific selection of mutants of a herpes simplex virus recombinant carrying deletions. | herpes simplex virus 1 (hsv-1) recombinant r316 was constructed so as to convert the thymidine kinase (tk), a beta gene, into an alpha-regulated gene by insertion of the bamhi n fragment in the proper transcriptional orientation into the bglii cleavage site of the tk gene (l. e. post, s. mackem, and b. roizman, cell 24, 555-565 (1981).) the bamhi n fragment contains the promoter and regulatory domains of the alpha 4 gene in addition to an origin of viral dna synthesis and the complete domain of ... | 1985 | 2990098 |
| nucleotide sequence of a herpes simplex virus type 1 gene that causes cell fusion. | the nucleotide sequence (2041 nucleotides) of a genomic region of herpes simplex virus type 1 (kos strain) associated with virus-induced cell fusion has been determined. the sequence is bounded by a nrui site at 0.732 and a bamhi site at 0.745 prototypic map units. an open reading frame in the left-to-right orientation specifies a protein of 338 amino acids. the protein is positively charged. since secondary structure analysis predicts four extensive hydrophobic domains the protein is probably a ... | 1985 | 2990101 |
| effect of the herpes simplex virus genome on the response of infection to corticosteroids. | the type and severity of ocular herpetic disease, as well as the pattern of recurrence, have been shown to be determined by the virus genome. we infected rabbit eyes with two closely related recombinant strains of herpes simplex virus type 1 and treated one half of the eyes in each group with corticosteroids before or immediately after virus inoculation. the severity of disease in the first week was similar in the treated and untreated eyes infected with the f(mp)f strain; however, with f(mp)e i ... | 1985 | 2990213 |
| antiherpes effects and pharmacokinetic properties of 9-(4-hydroxybutyl) guanine and the (r) and (s) enantiomers of 9-(3,4-dihydroxybutyl)guanine. | three acyclic guanosine analogs with similar structures, the (r) and (s) forms of 9-(3,4-dihydroxybutyl)guanine and 9-(4-hydroxybutyl)guanine, were compared for antiherpes activity in vivo and in vitro. the three guanosine analogs were viral thymidine kinase-dependent inhibitors of virus multiplication. in cell cultures, (s)-9-(3,4-dihydroxybutyl)guanine was the least active of these three drugs against a variety of herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) strains. this was also th ... | 1985 | 2990325 |
| effects of combined use of acyclovir and antibody in athymic nude mice inoculated intracutaneously with herpes simplex virus. | antiviral effects of acyclovir (acv) and antibody were studied in athymic nude mice inoculated intracutaneously in the midflank with herpes simplex virus type 1. three hours after virus inoculation, treatment was initiated. in acv-treated mice, the development of skin lesions was inhibited and the mean survival time was prolonged as compared with controls. treatment with acv markedly reduced the viral titers both at the inoculation site and in the neural tissues (dorsal root ganglia, spinal cord ... | 1985 | 2990334 |
| analysis of the hsv-2 early ag-4 antigen. | genital herpes simplex virus type 2 (hsv-2) infections can be distinguished from present or past hsv-1 infections by an ag-4 antigen complement fixation assay. the assay which utilizes a 4 hour hsv-2 infected cell extract prepared at a multiplicity of infection (moi) of 1.0 pfu/cell, appears to consist of several viral proteins. studies using monoclonal antibodies, polyclonal rabbit hyperimmune serum, hsv-1 x hsv-2 intertypic recombinant viruses and polyacrylamide gel electrophoresis suggest tha ... | 1985 | 2990385 |
| human epidermal cells are more potent than peripheral blood mononuclear cells for the detection of weak allogeneic or virus-specific primary responses in vitro. | human epidermal cells (ec) and peripheral blood mononuclear cells (pbmc) have been used as antigen-presenting cells in allogeneic reactions or in self-restricted antiviral responses. comparison of results from both cell types indicates that: (1) ec were better stimulators of primary proliferative responses in all the antigenic systems tested. (2) in secondary reactions, ec and pbmc functioned similarly for allogeneic responses, while a weak but significant difference could be observed in both (h ... | 1985 | 2990735 |
| herpes simplex type 1 ribonucleotide reductase. mechanism studies with inhibitors. | several known inhibitors of mammalian ribonucleotide reductase were studied for their interactions with herpes simplex virus type 1 (hsv-1) ribonucleotide reductase. maiq (4-methyl-5-amino-1-formylisoquinoline thiosemicarbazone) produced apparent inactivation of hsv-1 ribonucleotide reductase. only catalytically cycling, not resting, enzyme could be inactivated. double reciprocal replots of the rates of inactivation versus the concentration of maiq indicated that a reversible complex with the en ... | 1985 | 2991215 |
| involvement of golgi apparatus and a restructured nuclear envelope during biogenesis and transport of herpes simplex virus glycoproteins. | following infection of bhk-21 cells with herpes simplex virus type 1 (hsv-1), progeny nucleocapsids in the nucleus acquire a glycoprotein-rich envelope by budding through host-cell nuclear membranes. to investigate the nature of the glycoprotein products assembled in the virion at the nuclear envelope, infected cells were pulse-labeled with [3h]-mannose, an oligosaccharidal core sugar, or [3h]-fucose, a terminal sugar. after various chase periods, the incorporation of these sugars was monitored ... | 1985 | 2991363 |
| association of type i dna topoisomerase with herpes simplex virus. | a topoisomerase activity is associated with herpes simplex virus type 1. the enzyme was recovered from purified virions which were disrupted with 6 m-guanidine-hcl followed by renaturation of extracted proteins. based upon the following observations, the virion activity is classified as a type i topoisomerase: (i) the linking number of a unique dna topoisomer is altered in steps of one; (ii) atp and mgcl2 are not required for activity; (iii) the enzyme can be trapped in a covalent complex with d ... | 1985 | 2991429 |
| a herpes simplex virus type 1 mutant with a deletion in the polypeptide-coding sequences of the icp4 gene. | a deletion mutant derived from herpes simplex virus type 1 (hsv-1) strain ang was analysed. the deletion mapped within the polypeptide-coding region of the immediate-early icp4 gene. based on dna sequence data the deletion was shown to comprise 84 base pairs. in the wild-type genome of strain ang these sequences were almost completely homologous to the known sequences of hsv-1 strain 17. the icp4 polypeptide induced by the mutant was similar in size to the wild-type icp4 protein and was recogniz ... | 1985 | 2991430 |
| inhibition of herpes simplex virus type 1 penetration by cytochalasins b and d. | internalization of herpes simplex virus type 1 (hsv) kos strain by hep-2 cells was reversibly inhibited by pretreatment of cells with cytochalasins b and d. internalization of virus following preincubation at 4 degrees c and temperature shift to 37 degrees c was normally preceded by a 5 to 8 min lag period and was complete within 20 to 30 min. a similar lag period followed hsv addition at 37 degrees c. cytochalasin d was fivefold more active on hsv entry than cytochalasin b, with 50% inhibition ... | 1985 | 2991432 |
| retrieval of latent herpes simplex virus type 1 genetic information from murine trigeminal ganglia by superinfection with heterotypic virus in vivo. | mice previously latently infected with the f strain of herpes simplex virus type 1 (hsv-1) can be successfully colonized with a second virus strain if hsv-2 is introduced at the same peripheral site as hsv-1. on the other hand, hsv-1 strains seemed able mutually to exclude establishment of latency with each other. mice (3 months or 3 years after nasal infection) latently infected with hsv-1 were thus superinfected with hsv-2. the mice were sacrificed 2 days post-infection when hsv-2 replication ... | 1985 | 2991439 |
| the effect of triterpenoid compounds on uninfected and herpes simplex virus-infected cells in culture. i. effect on cell growth, virus particles and virus replication. | the related triterpenoid compounds carbenoxolone sodium (cbx) and cicloxolone sodium (ccx) have been investigated in clinical trials for treatment of herpes simplex virus (hsv) infections. when the drugs were tested in vitro, two dose-related effects on bhk cells became apparent: the rate of cell growth was reduced and the drugs exhibited cytotoxicity at high concentrations. flow 2002 cells, in contrast, were apparently unaffected by all drug concentrations tested. the effect of up to 3 days inc ... | 1985 | 2991440 |
| production of cell-mediated immune response to herpes simplex virus by immunization with anti-idiotypic heteroantisera. | three balb/c monoclonal antibodies capable of neutralizing herpes simplex virus type 1 (hsv-1) were used to prepare rabbit anti-idiotypic antisera. affinity-purified antibodies from four of these rabbits were used to immunize mice by repeated subcutaneous injection over a period of 6 to 7 weeks: the mice were then challenged with hsv-1 subcutaneously in the ear pinna. measurement of ear swelling showed that prior administration of anti-idiotypic serum could generate dose-dependent delayed-type h ... | 1985 | 2991443 |
| susceptibility to herpes simplex virus type 1 infection of non-permissive rat xc(hprt-) x permissive mouse l(tk-) hybrid cells. | somatic cell hybrids between rat xc(hprt-) cells, non-permissive for herpes simplex virus type 1 (hsv-1) infection, and permissive mouse l(tk-) cells were constructed and karyotyped. infection of these hybrid cells by hsv-1 strains f and mp revealed that they were susceptible to the virus. the amounts of virus produced by the hybrid cells, as well as the cytopathic effect observed, was very similar to that of the parental l(tk-) cells. our results suggest that failure of hsv-1 to replicate in xc ... | 1985 | 2991444 |
| modifications on the heterocyclic base of acyclovir: syntheses and antiviral properties. | a group of compounds was prepared in which variations of the ring portion of the acyclovir (acv) structure were made. these modifications included monocyclic (isocytosine, triazole, imidazole), bicyclic (8-azapurine, pyrrolo[2,3-d]pyrimidine, pyrazolo[3,4-d]pyrimidine) and tricyclic (linear benzoguanine) congeners. the derivatives were evaluated against herpes simplex virus type 1 (hsv-1) by the plaque-inhibition and plaque-reduction methods with only the 8-azapurine analogue 28 showing some act ... | 1985 | 2991522 |
| restriction endonuclease digestion analysis of dna from viruses isolated from different sites of two fatal cases of herpes simplex virus type-1 infection. | herpes simplex virus (hsv) type-1 was isolated from a fatal case of herpes simplex encephalitis (case 1) and from a fatal case of disseminated herpes simplex (case 2). the virus was isolated from the lip lesion, the frontal lobe and the temporal lobe of the brain in case 1 and from a mesenteric node, myocardium and salivary gland in case 2. restriction endonuclease digestion analysis showed that each case was infected with different substrains of hsv. the changes in band pattern in isolates from ... | 1985 | 2991525 |
| herpes simplex virus 1 mutant deleted in the alpha 22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. | r325-beta tk+, a herpes simplex virus 1 mutant carrying a 500-base-pair deletion in the alpha 22 gene and the wild-type (beta) thymidine kinase (tk) gene, was previously shown to grow efficiently in hep-2 and vero cell lines. we report that in rodent cell lines exemplified by the rat-1 line, plating efficiency was reduced and growth was multiplicity dependent. a similar multiplicity dependence for growth and lack of virus spread at low multiplicity was seen in resting, confluent human embryonic ... | 1985 | 2991560 |
| establishment of latency in mice by herpes simplex virus 1 recombinants that carry insertions affecting regulation of the thymidine kinase gene. | herpes simplex virus 1 recombinants carrying alpha-, beta-, and late gamma (gamma 2)-regulated thymidine kinase (tk) genes were tested for the ability to establish latency in balb/c mice inoculated by the eye route. the significant findings were as follows. representatives of alpha- and gamma 2-regulated tk recombinants all established and maintained latent infections, but the efficiency was somewhat lower than that of wild-type virus. of the three alpha tk recombinants tested, one (r316) sponta ... | 1985 | 2991566 |
| specificities of monoclonal and polyclonal antibodies that inhibit adsorption of herpes simplex virus to cells and lack of inhibition by potent neutralizing antibodies. | polyclonal and monoclonal antibodies to individual herpes simplex virus (hsv) glycoproteins were tested for ability to inhibit adsorption of radiolabeled hsv type 1 (hsv-1) strain hfemsyn [hsv-1(hfem)syn] to hep-2 cell monolayers. polyclonal rabbit antibodies specific for glycoprotein d (gd) or gc and three monoclonal mouse antibodies specific for gd-1 or gc-1 most effectively inhibited hsv-1 adsorption. antibodies of other specificities had less or no inhibitory activity despite demonstrable bi ... | 1985 | 2991570 |
| potent neutralizing activity associated with anti-glycoprotein d specificity among monoclonal antibodies selected for binding to herpes simplex virions. | thirty-three monoclonal antibodies were selected for ability to bind to purified virions of herpes simplex virus and were shown by immunoprecipitation to react with one or another of the envelope glycoproteins. only six of these antibodies exhibited potent neutralizing activity, and all six were specific for glycoprotein d. two other anti-glycoprotein d antibodies and 25 antibodies specific for four other viral glycoproteins had much less potent, if any, neutralizing activity. | 1985 | 2991571 |
| rescue of a herpes simplex virus type 1 neurovirulence function with a cloned dna fragment. | a herpes simplex virus type 1 (hsv-1) genetic function that is required for viral replication in the murine central nervous system was unambiguously localized. thus, cosmid clones of either hsv-1 hindiii fragment c (0.64 to 0.87 map units) or fragment b (0.64 to 0.83 plus 0.91 to 1.0 map units) were employed to restore neurovirulence to an intertypic recombinant (re6) that is specifically deficient in this property. the neurovirulent recombinants were generated in cell culture by cotransfecting ... | 1985 | 2991575 |
| herpes simplex virus type 1 icp27 is an essential regulatory protein. | the five immediate-early genes of herpes simplex virus are expressed during the initial stages of the infectious cycle, and certain immediate-early proteins have been shown to play a regulatory role in subsequent viral gene expression. until recently, the functional properties of only one immediate-early protein, icp4, had been examined in any detail, primarily because mutants had been isolated only in the gene for icp4. we report herein the genetic and phenotypic characterization of four temper ... | 1985 | 2991596 |
| latent herpes simplex virus type 1 dna contains two copies of the virion dna joint region. | southern blot analysis of latent herpes simplex virus dna detected in mouse brain and digested with a restriction enzyme revealed two copies of the virion dna joint fragment. thus, the absence of free ends noted previously in latent herpes simplex virus type 1 dna is due to joining of the termini. | 1985 | 2991602 |
| binding of complement component c3b to glycoprotein c is modulated by sialic acid on herpes simplex virus type 1-infected cells. | neuraminidase treatment of cells infected with herpes simplex virus type 1 (hsv-1) markedly enhanced the binding of complement component c3b to hsv 1 glycoprotein c (gc). when hsv-1 was grown in bhk ricr14 cells in which glycoproteins had reduced amounts of n-linked complex oligosaccharides, including sialic acid, the binding of c3b to gc was markedly enhanced. we used neuraminidase treatment to demonstrate that cloning the gc gene from the hsv-1 f strain into an hsv-1 mutant which fails to expr ... | 1985 | 2991604 |
| application of the mini-mu-phage for target-sequence-specific insertional mutagenesis of the herpes simplex virus genome. | an earlier technique for insertional mutagenesis of large viral genomes involved the insertion of the thymidine kinase (tk) gene at a specific target site, cotransfection of the fragment carrying the insertion with the intact viral genome, and selection of the progeny for viral recombinants expressing the tk gene. the inserted tk gene could then be replaced by cotransfection of the recombinant dna with fragments carrying a foreign sequence or a deletion in the target sequence. to enable the prob ... | 1985 | 2991892 |
| identification of immediate early genes from herpes simplex virus that transactivate the virus thymidine kinase gene. | a hela cell transient-expression assay system was used to determine if isolated immediate early (alpha) genes from herpes simplex virus (hsv) could transcriptionally activate (transactivate) the type 1 (hsv-1) thymidine kinase (tk) gene [an early (beta) gene]. cells transfected with the tk gene alone transcribed very low levels of tk rna. cells cotransfected with plasmids bearing the sequences that encode the alpha-gene product infected cell protein 0 or 4 (icp0 or icp4) and the tk gene faithful ... | 1985 | 2991915 |
| [genetic transformation of somatic cells. v. inheritability of the rate of loss of the trait and the stabilization of the transformant phenotype]. | subclones were isolated both on selective and nonselective medium from the chinese hamster cells transformed by thymidine kinase gene (tk-gene) of herpes simplex virus (hsv-1) and varying in the rate of the loss of transformant phenotype. the study of the stability of thymidine kinase-positive (tk+) phenotype in cell populations the subclones shows that the nonstability and the rate of the loss of transformant phenotype are the characters that are inherited in the cell generations. durable culti ... | 1985 | 2992136 |
| [genetic transformation of somatic cells. vi. transfer of the trait of the rate of loss of transformant phenotype by means of dna from cells containing the thymidine kinase gene of the herpes simplex virus]. | using dot-hybridization with thymidine kinase gene (tk gene) of herpes simplex virus type 1 (hsv 1) of dna preparations obtained from isolated metaphase chromosomes and lysate fractions of metaphase cells, which presumably contain smaller particles compared to metaphase chromosomes, it has been shown that the tk gene of hsv 1 is localized in chromosomes of cells of transformant clones unstable in tk+-phenotype. the dna isolated from the metaphase chromosomes from cells of transformant clones is ... | 1985 | 2992137 |
| preclinical assessment of topical treatments of herpes simplex virus infection: 5% (e)-5-(2-bromovinyl)-2'-deoxyuridine cream. | the potential efficacy of topical therapy with (e)-5-w-bromovinyl)-2'-deoxyuridine (bvdu) for cutaneous herpesvirus infection was evaluated in vitro and in guinea pigs. drug sensitivity testing against herpes simplex virus type 1 strain e115 revealed an id50 of 0.008 microgram/ml for bvdu and 0.19 microgram/ml for acyclovir (acv). in vitro drug diffusion studies showed poor penetration of guinea pig skin by bvdu from the cream compared to bvdu from dimethylsulfoxide (dmso) (0.04 vs. 1.5 microgra ... | 1985 | 2992371 |
| spread of herpes simplex virus and distribution of latent infection after intraocular infection of the mouse. | intraocular inoculation of hsv 1 in the mouse results not only in uveitis, but also in the spread of virus via sensory, sympathetic and optic nerves. during the acute infection with hsv 1 strain sc 16 in both outbred and nih (inbred) mice, virus reached the ipsilateral trigeminal ganglion, superior cervical ganglion, both sides of the brain stem and the contralateral (uninoculated) eye. with hsv 1 strain kos in outbred mice the same tissues became infected but virus was also isolated from the op ... | 1985 | 2992417 |
| iontophoresis of epinephrine isomers to rabbit eyes induced hsv-1 ocular shedding. | iontophoresis of 0.01% levo(-) epinephrine for 8 min at 0.8 mamp once daily for 3 consecutive days induces ocular shedding of herpes simplex virus type 1 (hsv-1) in latently infected rabbits. in the present experiment, we tested dextro(+) and levo(-) epinephrine for their comparative effects on induced hsv-1 ocular shedding. one hundred percent of the eyes shed virus after either 0.01% dextro(+) or levo(-) epinephrine iontophoresis (8 min, 0.8 mamp). however, the shedding frequency caused by 0.0 ... | 1985 | 2993192 |
| metabolism of the carbocyclic analogue of (e)-5-(2-iodovinyl)-2'-deoxyuridine in herpes simplex virus-infected cells. incorporation of c-ivdu into dna. | the carbocyclic analogues of (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) and (e)-5-(2-iodovinyl)-2'-deoxyuridine (ivdu), in which the sugar moiety is replaced by a cyclopentane ring and which have been designated as c-bvdu and c-ivdu, respectively, are, like their parent compounds bvdu and ivdu, potent and selective inhibitors of herpes simplex virus type 1 (hsv-1) and, to a lesser extent, herpes simplex virus type 2 (hsv-2) replication. we have now synthesized the radiolabeled c-ivdu analogue, ... | 1985 | 2993282 |
| the therapeutic efficacy of a xanthate compound on herpes simplex virus in skin lesions of mice and guinea-pigs. | xanthates have recently been shown to inhibit the replication of both dna and rna viruses in vitro. the antiviral activity was exerted only under acidic ph conditions. curative effects in vivo on herpes simplex virus (hsv)-induced skin lesions were only observed when the xanthate compound was administered in the form of an ointment containing acidic buffer (sodium phosphate ph 5.0). advanced hsv-2-induced skin lesions in mice were healed by topical treatment with the xanthate compound. hsv-1-ind ... | 1985 | 2993486 |
| identification of cross-reacting glycoproteins of four herpesviruses by western blotting. | monospecific rabbit antisera against purified herpes simplex virus type 1 (hsv-1) gb, gc or gd antigens or polyvalent rabbit antiserum against equine herpesvirus type 1 (ehv-1)-infected cells was used in western blotting to identify antigenically related proteins in cells infected with hsv-1, hsv-2, bovine mammillitis virus or ehv-1. monomeric and oligomeric polypeptides related to hsv-1 gb were found in cells infected with each of the four herpesviruses. the gc antiserum was specific for hsv-1 ... | 1985 | 2993488 |
| lack of oral hsv-2 in a college student population. | a population of individuals with a high incidence of genital herpes simplex virus type 1 (hsv-1), due most likely to oro-genital contact, was examined to determine the incidence of oral herpes simplex virus type 2 (hsv-2) infection. herpes simplex virus was isolated from the oral cavity of 43 college students whose symptoms ranged from singular lesions of the lips with minimal discomfort to severe oral disease with systemic involvement resulting in lymphadenopathy, chills, sweat, myalgia, and fe ... | 1985 | 2993498 |
| synthesis and antiherpes simplex virus activity of 9-[(1,3-dihydroxy-2-propylthio)methyl]guanine. | the synthesis of the thio analogue (thio-dhpg, 2) of 9-[(1,3-dihydroxy-2-propoxy)methyl]guanine (dhpg, 1) is described. the synthesis of 2 proceeded via the condensation of acetoxymethyl sulfide 9 with diacetylguanine 10 to give the protected nucleoside analogue 11. although catalytic hydrogenolysis failed, the benzyl ether functionalities of 11 were successfully cleaved by an acetolysis reaction to furnish 14. ammonolysis of 14 gave 2, which was also transformed to sulfoxide 15 and sulfone 16. ... | 1985 | 2993615 |
| sialylated oligosaccharides o-glycosidically linked to glycoprotein c from herpes simplex virus type 1. | glycoprotein c (gc) was purified by immunoabsorbent from herpes simplex virus type-1-infected bhk cells labeled with [14c]glucosamine for 11 h and chased for 3 h. glycopeptides obtained by pronase digestion of gc were fractionated by bio-gel filtration and concanavalin a-sepharose chromatography. each glycopeptide fraction was analyzed for amino sugar composition by thin-layer chromatography. the majority of radioactivity was recovered as n-acetylglucosamine, but a significant amount of labeled ... | 1985 | 2993643 |
| regulation of cytomegalovirus gene expression: alpha and beta promoters are trans activated by viral functions in permissive human fibroblasts. | we have fused immediate (alpha) and delayed (beta) early promoter-regulatory sequences taken from the cytomegalovirus (cmv) genome to escherichia coli lacz (beta-galactosidase) as an indicator gene to study regulated expression of these promoters. after transfection of human fibroblast cells with plasmid constructs carrying beta-galactosidase fusions, and subsequent infection with cmv, we have demonstrated that viral trans-acting functions up-regulate the expression of these genes in a temporall ... | 1985 | 2993644 |
| virus-induced modification of the host cell is required for expression of the bacterial chloramphenicol acetyltransferase gene controlled by a late herpes simplex virus promoter (vp5). | the requirements for expression of genes under the control of early (alkaline exonuclease) and late (vp5) herpes simplex virus type 1 (hsv-1) gene promoters were examined in a transient expression assay, using the bacterial chloramphenicol acetyltransferase gene as an expression marker. both promoters were induced, resulting in the production of high levels of the enzyme upon low-multiplicity infection by hsv-1. s1 nuclease analysis of hybrids between rna isolated from infected cells containing ... | 1985 | 2993649 |
| application of antibody to synthetic peptides for characterization of the intact and truncated alpha 22 protein specified by herpes simplex virus 1 and the r325 alpha 22- deletion mutant. | the alpha 22 protein is one of five proteins synthesized immediately after infection of permissive cells with herpes simplex virus 1 and 2 (hsv-1 and hsv-2). on the basis of the reported nucleotide sequence of the hsv-1 gene, we synthesized two peptides containing the predicted amino acids 12 through 23 (12 residues) and 21 through 36 (16 residues) in two hydrophilic domains near the n terminus of the protein. rabbit antisera made against these peptides were then used to characterize the alpha 2 ... | 1985 | 2993651 |
| virion component of herpes simplex virus type 1 kos interferes with early shutoff of host protein synthesis induced by herpes simplex virus type 2 186. | herpes simplex virus (hsv) strains hsv type 1 (hsv-1) kos and hsv-2 186 are representative of delayed and early shutoff strains, respectively, with regard to their ability to inhibit protein synthesis in friend erythroleukemia cells. when these cells were simultaneously infected with hsv-1 kos and hsv-2 186, hsv-1 kos interfered with the rapid suppression of globin synthesis induced by hsv-2 186. the observed interference was competitive and not due to exclusion of hsv-2 by hsv-1 at the level of ... | 1985 | 2993660 |
| sp1 binds to promoter sequences and activates herpes simplex virus 'immediate-early' gene transcription in vitro. | during a herpes simplex virus (hsv-1) lytic infection, three classes of viral genes are transcribed in a temporally regulated manner. the hsv-1 'immediate-early' (ie) promoter sequences contain multiple copies of a hexanucleotide sequence, gggcgg, known as a gc box, and one or more copies of an 11-base pair (bp) conserved a + t-rich element, designated taatgarat. the taatgarat elements are thought to mediate the trans-activation of ie rna synthesis by a virion-associated protein(s), and the flan ... | 1985 | 2993923 |
| demonstration of a stimulatory protein for virus-specified dna polymerase in phorbol ester-treated epstein-barr virus-carrying cells. | a heat-labile epstein-barr virus-specific dna polymerase stimulatory protein having a molecular mass of 45 kda was purified from phorbol 12-myristate 13-acetate-treated p3hr-1 cells by column chromatography. the virus dna polymerase stimulatory protein was precipitated by sera from patients with nasopharyngeal carcinoma but not by sera from healthy donors. the interaction of the stimulatory protein with dna polymerase was stoichiometric. furthermore, this protein stimulated epstein-barr virus dn ... | 1985 | 2994045 |
| nucleotide sequence and predicted amino acid sequence of a protein encoded in a small herpes simplex virus dna fragment capable of trans-inducing alpha genes. | the five alpha genes of herpes simplex virus 1 are the first set of genes to be expressed after infection. previous studies have shown that alpha genes resident in eukaryotic cells are induced by infection with herpes simplex virus 1 or 2 but not by other herpesviruses and indicate that the alpha trans-inducing factor was a structural component of the virion. this factor induces genes linked to a bona fide promoter and containing at the 5' end a small sequence derived from the promoter-regulator ... | 1985 | 2994050 |
| glucocorticoid regulation of mouse mammary tumor virus sequences in transgenic mice. | we have introduced a chimeric plasmid, pltr2tk, containing the mouse mammary tumor virus (mtv) long terminal repeat (ltr) linked to the herpes simplex virus type 1 thymidine kinase gene into the mouse germ line by microinjection. in one mouse line, the thymidine kinase gene is appropriately expressed in the lactating mammary glands of heterozygous females; expression also occurs in the ovaries of these mice. in heterozygous males of this line, and in a male derived from another microinjection, t ... | 1985 | 2994051 |
| different populations of herpes simplex virus glycoprotein c discriminated by the carbohydrate-binding characteristics of n-acetylgalactosamine specific lectins (soybean and helix pomatia). brief report. | from the herpes simplex virus specified glycoprotein c two fractions were isolated with affinity either for helix pomatia lectin (hpa) or soybean lectin (sba). the data indicated that hpa and sba, despite their mutual main specificity for n-acetylgalactosamine, recognize structurally different gc populations. | 1985 | 2994599 |
| immunoblotting and enzyme-linked immunosorbent assay analysis of serological responses in patients infected with herpes simplex virus types 1 and 2. | serological responses to soluble membrane and cytoplasmic antigens specified by herpes simplex type 1 (hsv1) and 2 (hsv2) were studied by immunoblotting and by enzyme-linked immunosorbent assay (elisa). in the immunoblotting test, polypeptides migrating like the hsv1-specified glycoprotein c showed type-specific reactivity but could not always be detected. the immunoblotting and elisa results were in agreement when antibody responses to hsv1- and hsv2-specified antigens were compared, and they a ... | 1985 | 2995271 |
| hsv1-specific thymidylate kinase activity in infected cells. | several 5-methoxymethyldeoxyuridine (mmdu)-resistant mutants of herpes simplex virus type 1 (hsv1) were classified by measuring their sensitivities to the deoxythymidine kinase (dtk)-dependent antiviral drugs 9-(2-hydroxyethoxymethyl)-guanine (acyclovir, acv), 1-beta-d-arabinofuranosylthymine (arat), and e-(2)-5-bromovinyldeoxyuridine (bvdu) and to the dtk-independent antiviral drug phosphonoacetate (paa). compared to wild-type (wt) virus, all five of the dtk- mutants were highly resistant (grea ... | 1985 | 2995273 |
| asynchronous expression of the immediate-early protein of herpesvirus saimiri in populations of productively infected cells. | the time course of virus replication in cultures of permissive cells infected with high multiplicities of herpesvirus saimiri (hvs), a gammaherpesvirus, is protracted relative to the replication of herpes simplex virus (hsv), an alphaherpesvirus, under similar conditions. the basis for this difference was investigated by quantitative immunofluorescence microscopy exploiting monoclonal antibodies specific to the hvs 52 000 mol. wt. immediate-early polypeptide (ie 52k) and to delayed-early (de 51k ... | 1985 | 2995555 |
| differences in humoral immunogenicity between herpes simplex virus types 1 and 2. | infection of nmri mice with increasing doses of six different strains of herpes simplex virus type 1 (hsv-1) induced increasing levels of neutralizing antibodies. in contrast, three strains of hsv-2, irrespective of the dose, induced only marginal antibody responses. only strain hg 52 (hsv-2) at high doses of infection stimulated antibody formation. the virus content of some organs in 6- to 8-week-old mice appeared to be lower after hsv-2 than after hsv-1 infection. application of immune-modulat ... | 1985 | 2995556 |
| inhibition of herpes simplex virus replication in vitro by human cytotoxic t cell clones and natural killer cell clones. | the abilities of human cytotoxic t cell (ctl) clones and natural killer (nk) cell clones to inhibit the replication of herpes simplex virus (hsv) in vitro were shown. the specificities of clones inhibiting hsv replication were the same as those of cytotoxicity in hsv type specificity and hla restriction, i.e. hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ctl clones inhibited the replication of both hsv-1 and hsv-2 in autologous cells, but not in allogeneic cells. hsv-1-specific ctl clones inh ... | 1985 | 2995557 |
| a comparison of the acid-soluble polypeptides of five herpesviruses. | the polypeptides soluble in 0.25 m-hcl were extracted from the nuclei of bhk cells infected with herpes simplex virus type 1 or type 2 and separated by sds-page. seventeen polypeptides were detectable in each extract of which 10 type 1 and nine type 2 polypeptides were reproducibly effectively extracted. in cells infected with bovine mammillitis virus, pseudorabies virus or equine herpesvirus type 1, at least 12, 13 and eight polypeptides respectively were acid-soluble. in addition to histones, ... | 1985 | 2995559 |
| acute and latent herpes simplex virus neurological disease in mice immunized with purified virus-specific glycoproteins gb or gd. | groups of 5-week-old balb/c mice were immunized intraperitoneally with approximately 10 micrograms of purified alum-precipitated glycoprotein gb or gd of either herpes simplex virus type 1 (hsv-1) or type 2 (hsv-2) origin. control mice received injections of alum-precipitated 1% bovine serum albumin (bsa). following a second immunization 4 weeks later, seroconversion was confirmed by demonstrating the presence of glycoprotein-specific antibody by immune precipitation. all animals were challenged ... | 1985 | 2995573 |
| ocular infection with herpes simplex virus (hsv-1) in vitamin a-deficient and control rats. | an experimental model was developed for studying ocular infections with herpes simplex virus (hsv) type 1 in vitamin a-deficient (-a) and pair-fed control (+a) rats. the severity and course of the disease was evaluated by clinical examination, slit lamp biomicroscopy and histopathologic observations. experimental animals were in good health and were infected in the early stages of vitamin deficiency (either prior to or at the beginning of the weight plateau). in all trials the onset of herpetic ... | 1985 | 2995622 |
| (+/-)-2-amino-3,4-dihydro-7-[2,3-dihydroxy-4-(hydroxymethyl)-1- cyclopentyl]-7h-pyrrolo[2,3-d]pyrimidin-4-ones: new carbocyclic analogues of 7-deazaguanosine with antiviral activity. | 5-allyl-2-amino-4,6-dihydroxypyrimidine (3) was chlorinated and ozonized to yield (2-amino-4,6-dichloro-pyrimidin-5-yl)acetaldehyde (5). acetalization of 5 with ethanol afforded a new pyrimidine intermediate 6 which can lead to 2-amino-3,4-dihydro-7-alkyl-7h-pyrrolo[2,3-d]pyrimidin-4-ones and therefore to carbocyclic analogues of 7-deazaguanosine. the 7-substituent was a cyclopentyl analogue of the arabinofuranosyl moiety in 10a, lyxofuranosyl moiety in 10b, and ribofuranosyl moiety in 10c. comp ... | 1985 | 2995667 |
| comparison of the dna sequence and secondary structure of the herpes simplex virus l/s junction and the adeno-associated virus terminal repeat. | the defective parvovirus adeno-associated virus (aav) is absolutely dependent upon coinfection with either adenovirus or herpes simplex virus (hsv) for its multiplication. we have compared the terminal repeats of hsv-1f strain dna with the terminal 200 nucleotides of aav dna. our findings demonstrate similarities between portions of the hsv inverted repeats found at the l/s junction and the termini of aav. by computer analysis we have determined potential secondary folding patterns for both geno ... | 1985 | 2995732 |
| locating a nucleotide-binding site in the thymidine kinase of vaccinia virus and of herpes simplex virus by scoring triply aligned protein sequences. | computer techniques were used to locate related segments of amino acid sequences in the thymidine kinases of vaccinia virus and of herpes simplex virus type 1 and in porcine adenylate kinase. as determined by a procedure that evaluates triply aligned sequences, the probability that the similarities among the segments described here arose by chance was no greater than 0.001. because the sequence in porcine adenylate kinase is a nucleotide phosphate-binding site it is concluded that the segments i ... | 1985 | 2995987 |
| [genetic transformation of somatic cells. vii. the loss of the transformant phenotype is accompanied by both stable and unstable changes in dna]. | from 6 clones of chinese hamster cells varying in the rate of the loss of transformant phenotype and containing a thymidine kinase gene (tk-gene) of herpes simplex virus type 1 (hsv1), 25 subclones negative in thymidine kinase (tk-) were isolated on a medium with 50 micrograms/ml 5-bromodeoxyuridine (brdu). a study was made of the frequency of spontaneous reversions to the tk+ phenotype in cell populations of brdu-resistant subclones, and of the transforming activity (upon transformation of tk- ... | 1985 | 2996189 |
| [genetic transformation of somatic cells. ix. the loss of the transformant phenotype is accompanied by rearrangements in the plasmid dna containing the thymidine kinase gene of the herpes virus]. | as demonstrated by dot-hybridization, the cells of ht-subclones isolated from the cells of transformant clones cultured on a non-selective medium differ significantly in the number of copies of thymidine kinase gene (tk-gene) of herpes simplex virus (hsv1). since the cells of transformant clones lose thymidine kinase-positive (tk+) phenotype during cultivation, this data are indicative of high frequence rearrangements in the region of transforming dna as responsible for the transformant phenotyp ... | 1985 | 2996190 |