| the rhodobacter sphaeroides flagellar motor is a variable-speed rotor. | the rotation rate of the unidirectional stop/start motor of rhodobacter sphaeroides was investigated using computerised motion analysis of tethered cells. the r. sphaeroides motor was found to have a variable rotation rate compared to the virtually constant-speed motor of wild-type and cher mutant (smooth swimming) escherichia coli. in addition, the dynamics of the r. sphaeroides motor during stopping was analysed with no consistent correlation behaviour. the motor could go from full rotation to ... | 1997 | 9199499 |
| kinetics of h+ ion binding by the p+qa-state of bacterial photosynthetic reaction centers: rate limitation within the protein. | the kinetics of flash-induced h+ ion binding by isolated reaction centers (rcs) of rhodobacter sphaeroides, strain r-26, were measured, using ph indicators and conductimetry, in the presence of terbutryn to block electron transfer between the primary and secondary quinones (qa and qb), and in the absence of exogenous electron donors to the oxidized primary donor, p+, i.e., the p+qa-state. under these conditions, proton binding by rcs is to the protein rather than to any of the cofactors. after l ... | 1997 | 9199801 |
| characterization of pheophytin ground states in rhodobacter sphaeroides r26 photosynthetic reaction centers from multispin pheophytin enrichment and 2-d 13c mas nmr dipolar correlation spectroscopy. | the electronic ground states of pheophytin cofactors potentially involved in symmetry breaking between the a and b branch for electron transport in the bacterial photosynthetic reaction center have been investigated through a characterization of the electron densities at individual atomic positions of pheophytin a from 13c chemical shift data. a new experimental approach involving multispin 13c labeling and 2-d nmr is presented. bacterial photosynthetic reaction centers of rhodobacter sphaeroide ... | 1997 | 9200701 |
| nucleotide sequence and transcriptional analysis of the flanking region of the gene (spb) for the trans-acting factor that controls light-mediated expression of the puf operon in rhodobacter sphaeroides. | we recently reported the existence of a trans-acting factor (spb) in rhodobacter sphaeroides that repressed the expression of the puf operon during illumination. spb was somewhat homologous to hvra of rhodobacter capsulatus, but these proteins appear to have functionally different properties. we now report an analysis of the flanking region of spb in the genome of r.sphaeroides, and we show that spb is a positional counterpart of hvra of r. capsulatus. the region directly downstream of spb was f ... | 1997 | 9210332 |
| characterisation of the pterin molybdenum cofactor in dimethylsulfoxide reductase of rhodobacter capsulatus. | analysis of dimethylsulfoxide reductase from rhodobacter capsulatus showed that it contained 1 mol mo and 2 mol gmp. this indicates that the molybdenum cofactor in dimethylsulfoxide reductase is bis(molybdopterin guanine dinucleotide) molybdenum. the absorption spectrum of the molybdopterin guanine dinucleotide released from dimethylsulfoxide reductase after denaturation of the holoenzyme was compared with those of pterin standards of known redox state. the spectra were most similar to pterin st ... | 1997 | 9210484 |
| confirmation of the structure of lipid a derived from the lipopolysaccharide of rhodobacter sphaeroides by a combination of maldi, lsims, and tandem mass spectrometry. | the chemical structure of nontoxic diphosphoryl lipid a from rhodobacter sphaeroides was confirmed using a combination of lsims (on a two-sector mass spectrometer) and maldi (on time-of-flight and ion trap mass spectrometers) in conjunction with tandem mass spectrometry in both positive and negative ion modes. accurate molecular weight measurement accompanied by the analysis of fragment ion masses yielded the composition of fatty acyl groups. tandem experiments (collisionally induced dissociatio ... | 1997 | 9212704 |
| influence of iron-removal procedures on sequential electron transfer in photosynthetic bacterial reaction centers studied by transient epr spectroscopy. | electron spin polarized electron paramagentic resonance (esp epr) spectra were obtained with deuterated iron-removed photosynthetic bacterial reaction centers (rcs) to specifically investigate the effect of the rate of primary charge separation, metal-site occupancy, and h-subunit content on the observed p865+qa- charge-separated state. fe-removed and zn-substituted rcs from rb. sphaeroides r-26 were prepared by refined procedures, and specific electron transfer rates (kq) from the intermediate ... | 1997 | 9214300 |
| temperature dependence of the qy resonance raman spectra of bacteriochlorophylls, the primary electron donor, and bacteriopheophytins in the bacterial photosynthetic reaction center. | qy-excited resonance raman spectra of the accessory bacteriochlorophylls (b), the bacteriopheophytins (h), and the primary electron donor (p) in the bacterial photosynthetic reaction center (rc) of rhodobacter sphaeroides have been obtained at 95 and 278 k. frequency and intensity differences are observed in the low-frequency region of the p vibrational spectrum when the sample is cooled from 278 to 95 k. the b and h spectra exhibit minimal changes of frequencies and relative intensities as a fu ... | 1997 | 9214301 |
| identification of membrane spanning beta strands in bacterial porins. | the membrane assembly of outer membrane proteins is more complex than that of transmembrane helical proteins owing to the intervention of many charged and polar residues in the membrane. accordingly, the predictive accuracy of transmembrane beta strands is considerably lower than that of transmembrane alpha helices. in this paper we develop a set of conformational parameters for membrane spanning beta strands. we formulate an algorithm to predict the transmembrane beta strands in the family of b ... | 1997 | 9215567 |
| dna binding characteristics of crtj. a redox-responding repressor of bacteriochlorophyll, carotenoid, and light harvesting-ii gene expression in rhodobacter capsulatus. | previous genetic analysis indicated that the photosynthesis gene cluster from rhodobacter capsulatus coded for the transcription factor, crtj, that is responsible for aerobic repression of bacteriochlorophyll, carotenoid, and light harvesting-ii gene expression. in this study, we have heterologously overexpressed and purified crtj to homogeneity and shown by gel mobility shift assays that crtj is biologically active. dnase i footprint analysis confirms molecular genetic studies by showing that c ... | 1997 | 9218481 |
| protein and gene structure of the nadh-binding fragment of rhodobacter capsulatus nadh:ubiquinone oxidoreductase. | membranes of aerobically grown rhodobacter capsulatus contain only one type of nadh:ubiquinone oxidoreductase which is homologous to the proton-translocating complex i. the k(m) value of the enzyme for nadh was determined to be 8 microm. after solubilization of the membranes with an alkylglucoside detergent, two fragments of complex i with molecular masses of 110 kda and 140 kda were isolated by chromatographic steps in the presence of detergent. both fragments contain at least two polypeptides ... | 1997 | 9219542 |
| molecular analysis of the rhodobacter capsulatus chaperone dnakj operon: purification and characterization of dnak. | in rhodobacter capsulatus (rbc), the participation of dnak in the synthesis of light harvesting antenna complex i (lhi) has been recently inferred from the finding that the amount of lhi alpha- and beta-polypeptides synthesized in an in vitro translation system was strongly reduced when dnak was depleted. in the present work, a dnak protein was isolated from rbc and biochemically characterized. the n-terminus of the protein was sequenced and a corresponding oligo was used as probe in order to cl ... | 1997 | 9224898 |
| cloning, sequencing, and oxygen regulation of the rhodobacter capsulatus alpha-ketoglutarate dehydrogenase operon. | the rhodobacter capsulatus suca, sucb, and lpd genes, which encode the alpha-ketoglutarate dehydrogenase (e1o), the dihydrolipoamide succinyltransferase (e2o), and the dihydrolipoamide dehydrogenase (e3) components of the alpha-ketoglutarate dehydrogenase complex (kgd), respectively, were cloned, sequenced, and used for regulatory analyses. the kgd enzymatic activity was greater in cells grown under aerobic, respiratory growth conditions than under anaerobic, photosynthetic conditions. similarly ... | 1997 | 9226266 |
| amaricoccus gen. nov., a gram-negative coccus occurring in regular packages or tetrads, isolated from activated sludge biomass, and descriptions of amaricoccus veronensis sp. nov., amaricoccus tamworthensis sp. nov., amaricoccus macauensis sp. nov., and amaricoccus kaplicensis sp. nov. | three isolates of gram-negative bacteria, strains ben 102t, ben 103t, and ben 104t, were obtained in pure culture by micromanipulation from activated sludge biomass from wastewater treatment plants in italy, australia, and macau, respectively. these isolates all had a distinctive morphology; the cells were cocci that usually were arranged in tetrads. based on this criterion, they resembled other bacteria from activated sludge previously called "g" bacteria. on the basis of phenotypic characteris ... | 1997 | 9226904 |
| triplet energy transfer between the primary donor and carotenoids in rhodobacter sphaeroides r-26.1 reaction centers incorporated with spheroidene analogs having different extents of pi-electron conjugation. | three carotenoids, spheroidene, 3,4-dihydrospheroidene and 3,4,5,6-tetrahydrospheroidene, having 8, 9 and 10 conjugated carbon-carbon double bonds, respectively, were incorporated into rhodobacter (rb.) sphaeroides r-26.1 reaction centers. the extents of binding were found to be 95 +/- 5% for spheroidene, 65 +/- 5% for 3,4-dihydrospheroidene and 60 +/- 10% for 3,4,5,6-tetrahydrospheroidene. the dynamics of the triplet states of the primary donor and carotenoid were measured at room temperature b ... | 1997 | 9230708 |
| coupling of cytochrome and quinone turnovers in the photocycle of reaction centers from the photosynthetic bacterium rhodobacter sphaeroides. | a minimal kinetic model of the photocycle, including both quinone (q-6) reduction at the secondary quinone-binding site and (mammalian) cytochrome c oxidation at the cytochrome docking site of isolated reaction centers from photosynthetic purple bacteria rhodobacter sphaeroides, was elaborated and tested by cytochrome photooxidation under strong continuous illumination. the typical rate of photochemical excitation by a laser diode at 810 nm was 2.200 s-1, and the rates of stationary turnover of ... | 1997 | 9251814 |
| the dmsr gene encoding a dimethyl sulfoxide-responsive regulator for expression of dmscba (dimethyl sulfoxide respiration genes) in rhodobacter sphaeroides f. sp. denitrificans. | upstream of the dmscba genes encoding dimethyl sulfoxide (dmso) reductase in the phototrophic bacterium rhodobacter sphaeroides f. sp. denitrificans, there was found one gene (referred to dmsr) which encoded a protein composed of 232 amino acid residues and was divergently transcribed from the dmscba genes. the deduced amino acid sequence was homologous to the ompr subfamily of response regulators in two-component systems for transcriptional regulation. the encoded protein dmsr was shown to bind ... | 1997 | 9256068 |
| the roles of the two proton input channels in cytochrome c oxidase from rhodobacter sphaeroides probed by the effects of site-directed mutations on time-resolved electrogenic intraprotein proton transfer. | the crystal structures of cytochrome c oxidase from both bovine and paracoccus denitrificans reveal two putative proton input channels that connect the heme-copper center, where dioxygen is reduced, to the internal aqueous phase. in this work we have examined the role of these two channels, looking at the effects of site-directed mutations of residues observed in each of the channels of the cytochrome c oxidase from rhodobacter sphaeroides. a photoelectric technique was used to monitor the time- ... | 1997 | 9256439 |
| sequence of a 189-kb segment of the chromosome of rhodobacter capsulatus sb1003. | cosmids from the 1a3-1a10 region of the complete miniset were individually subcloned by using the vector m13 mp18. sequences of each cosmid were assembled from about 400 dna fragments generated from the ends of these phage subclones and merged into one 189-kb contig. about 160 orfs identified by the codonuse program were subjected to similarity searches. the biological functions of 80 orfs could be assigned reliably by using the wit and magpie genome investigation tools. eighty percent of these ... | 1997 | 9256491 |
| mannitol dehydrogenase from rhodobacter sphaeroides si4: subcloning, overexpression in escherichia coli and characterization of the recombinant enzyme. | by polymerase chain reaction mutagenesis techniques, an ndei restriction site was introduced at the initiation codon of the mannitol dehydrogenase (mdh) gene (mtlk) of rhodobacter sphaeroides si4. the mtlk gene was then subcloned from plasmid pak74 into the ndei site of the overexpression vector pet24a+ to give plasmid pasfg1. plasmid pasfg1 was introduced into escherichia coli bl21(de3), which was grown in a 1.5-1 bioreactor at 37 degrees c and ph 7.0. overexpression of mdh in escherichia coli ... | 1997 | 9274047 |
| temperature dependence of the electrogenic reaction in the qb site of the rhodobacter sphaeroides photosynthetic reaction center: the qa-qb --> qaqb- transition. | the temperature dependencies for the kinetics and relative amplitudes of electrogenic reaction(s) coupled with the first reduction of the secondary quinone acceptor qb were measured with dark-adapted chromatophores of rhodobacter sphaeroides. the kinetics, while acceptably fitted by a single exponent at room temperature, clearly split into two components below 15 degrees c (rise times, 25 micros and 300 micros at ph 7.0 and 10 degrees c) with the slow phase ousting the fast one at ph > 9.0. the ... | 1997 | 9276452 |
| differential levels of specific cytochrome c biogenesis proteins in response to oxygen: analysis of the ccl operon in rhodobacter capsulatus. | the photosynthetic bacterium rhodobacter capsulatus synthesizes c-type cytochromes under a variety of growth conditions. for example, under aerobic growth, c-type cytochromes are synthesized as part of an electron transport pathway, using oxygen as the terminal electron acceptor. anaerobically in the light, r. capsulatus requires cytochrome bc1 and other c-type cytochromes for the photosynthetic electron transport pathway. it is shown here that the ccl1 and ccl2 genes of r. capsulatus are requir ... | 1997 | 9286996 |
| analysis of the role of the nnrr gene product in the response of rhodobacter sphaeroides 2.4.1 to exogenous nitric oxide. | rhodobacter sphaeroides 2.4.1, which is incapable of denitrification, has been found to carry nnrr, the nor operon, and nnrs, which are utilized for denitrification in r. sphaeroides 2.4.3. the gene encoding nitrite reductase was not found in 2.4.1. expression of beta-galactosidase activity from a norb-lacz fusion was activated when cells of 2.4.1 were incubated with no-producing bacteria. this result indicates that the products of nnrr and the genes flanking it are utilized when 2.4.1 is growin ... | 1997 | 9287025 |
| the role of betaarg-10 in the b800 bacteriochlorophyll and carotenoid pigment environment within the light-harvesting lh2 complex of rhodobacter sphaeroides. | previous work has suggested that the betaarg-10 residue forms part of the binding site for the b800 bacteriochlorophyll in the lh2 complex of rhodobactersphaeroides [crielaard, w., visschers, r. w., fowler, g. j. s., van grondelle, r., hellingwerf, k. j., hunter, c. n. (1994) biochim. biophys. acta1183, 473-482], and this is consistent with the x-ray crystallographic data that have been subsequently obtained for the related lh2 complex from rhodopseudomonas acidophila [mcdermott, g., prince, s. ... | 1997 | 9287171 |
| antenna excited state decay kinetics establish primary electron transfer in reaction centers as heterogeneous. | the decay of the excited primary electron donor p* in bacterial photosynthetic reaction centers (both membrane-bound and detergent-isolated) has been observed to be nonexponential on a time scale of some tens of picoseconds. although the multipicosecond nonexponentiality of p* has been ascribed to heterogeneity in teh rate of primary electron transfer (pet), the decay kinetics can be interpreted equally well using homogeneous models. to address this ambiguity, we studied the decay of excited bac ... | 1997 | 9289013 |
| functional analysis of the reca promoter of rhodobacter capsulatus. | expression of the rhodobacter capsulatus reca gene is inducible by dna damage. by using primer extension and serial deletion, we have identified the promoter of the r. capsulatus reca gene. electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the r. capsulatus reca promoter containing the imperfect palindromic ttgtactcataccatgagaacaa, which is centered on position-8 with respect to the transcriptional starting site. pcr mutagenesis of both halves of th ... | 1997 | 9294033 |
| the ccrm dna methyltransferase is widespread in the alpha subdivision of proteobacteria, and its essential functions are conserved in rhizobium meliloti and caulobacter crescentus. | the caulobacter crescentus dna methyltransferase ccrm (m.ccrmi) methylates the adenine residue in the sequence gantc. the ccrm dna methyltransferase is essential for viability, but it does not appear to be part of a dna restriction-modification system. ccrm homologs are widespread in the alpha subdivision of gram-negative bacteria. we have amplified and sequenced a 258-bp region of the cerm gene from several of these bacteria, including rhizobium meliloti, brucella abortus, agrobacterium tumefac ... | 1997 | 9294447 |
| the involvement of serine 175 and alanine 185 of cytochrome b of rhodobacter sphaeroides cytochrome bc1 complex in interaction with iron-sulfur protein. | an approach involving cysteine replacement of potentially noncritical amino acid residues, followed by chemical modification studies, was used to investigate structure-function of the "cd helix" of cytochrome b from rhodobacter sphaeroides. three amino acid residues, ser-155, ser-175, and ala-185, which span this region of cytochrome b, were selected for this study. the s155c substitution yields cells unable to support photosynthetic growth, indicating that ser-155 is a critical amino acid resid ... | 1997 | 9295316 |
| behavioural responses of bacteria to light and oxygen. | motile bacteria have long been known to swim towards or away from specific environmental stimuli such as nutrients, oxygen or light. although there has been a detailed description of chemosensory responses in enteric species for several years, there has been little information on the mechanisms involved in responses to stimuli affecting electron transport as these usually also change the electrochemical proton gradient - at least transiently - and, thus, directly change flagellar rotation. there ... | 1997 | 9297461 |
| the electron transport system of the halophilic purple nonsulfur bacterium rhodospirillum salinarum. 1. a functional and thermodynamic analysis of the respiratory chain in aerobically and photosynthetically grown cells. | plasma membranes isolated from cells of the halophilic purple nonsulfur bacterium rhodospirillum salinarum grown in light or in the dark were examined. membranes isolated from cells grown aerobically in the dark contained three b-type and two c-type membrane-bound cytochromes with em,7 of +180, +72 and -5 mv (561-575 nm), and +244 and +27 mv (551-540 nm), respectively. conversely, membranes isolated from cells grown anaerobically in the light contained two b-type and five c-type haems with em,7 ... | 1997 | 9297468 |
| characterization of porin from roseobacter denitrificans. | porin from roseobacter denitrificans was isolated and purified to homogeneity. the pore characteristics from this marine bacterium were compared to those of its phylogenetically closely related freshwater bacteria rhodobacter capsulatus, rhodobacter sphaeroides and rhodopseudomonas blastica. the porin formed weakly cation-selective, general diffusion pores in lipid bilayer membranes. high transmembrane potentials caused channel closing in steps that were of one or two thirds of the initial on-st ... | 1997 | 9298192 |
| primary electron transfer kinetics in membrane-bound rhodobacter sphaeroides reaction centers: a global and target analysis. | absorbance difference kinetics were measured on quinone-reduced membrane-bound wild type rhodobacter sphaeroides reaction centers in the wavelength region from 690 to 1060 nm using 800 nm excitation. global analysis of the data revealed five lifetimes of 0.18, 1.9, 5.1, and 22 ps and a long-lived component for the processes that underlie the spectral evolution of the system. the 0.18 ps component was ascribed to energy transfer from the excited state of the accessory bacteriochlorophyll (b*) to ... | 1997 | 9298955 |
| a thioreduction pathway tethered to the membrane for periplasmic cytochromes c biogenesis; in vitro and in vivo studies. | the c-type cytochromes are distinguished from other heme proteins by the covalent ligation of two heme vinyl groups to two cysteine residues on the apoprotein (at a cxxch domain). the present study was undertaken to elucidate the roles and topological locations of two of the proteins necessary for cytochrome c biogenesis, the helx and ccl2 proteins in the gram-negative bacteria rhodobacter capsulatus. from their primary sequence, each of these proteins has a cxxc motif that could be involved in ... | 1997 | 9299319 |
| a nonradioactive double detection method for the assignment of spots in two-dimensional blots. | a method for identification of spots on two-dimensional electrophoresis gels by means of immunoblotting is described. this method does not require radioactive-labeled proteins and is based on the dual use of colloidal gold staining to detect the general 2d pattern on the blot and on chemiluminescence to detect the antibody-reactive spot(s). profit is taken from the fact that the general gold stain produces a background pattern on strong ecl exposures, which allows alignment of the antibody-react ... | 1997 | 9300084 |
| the assimilatory nitrate reductase from the phototrophic bacterium, rhodobacter capsulatus e1f1, is a flavoprotein. | the assimilatory nitrate reductase from the phototrophic bacterium rhodobacter capsulatus has been purified to electrophoretic homogeneity and its molecular and kinetic parameters determined. the native nitrate reductase is a dimer of 144 kda composed of two subunits of 46 and 95 kda. the purified enzyme catalyzes the electron transfer from nadh, reduced bromophenol blue or reduced viologens to nitrate. the nitrate reductase contains 1 mol fad per mole of enzyme and also reduces cytochrome c or ... | 1997 | 9305729 |
| conserved nonliganding residues of the rhodobacter capsulatus rieske iron-sulfur protein of the bc1 complex are essential for protein structure, properties of the [2fe-2s] cluster, and communication with the quinone pool. | the iron-sulfur (fe-s) protein subunit of the bc1 complex, known as the rieske protein, contains a high-potential [2fe-2s] cluster ligated by two nitrogen and two sulfur atoms to its apoprotein. earlier work indicated that in rhodobacter capsulatus these atoms are provided by two cysteine (c133 and c153) and two histidine (h135 and h156) residues, located at the carboxyl-terminal end of the protein [davidson, e., ohnishi, t., atta-asafo-adjei, e., & daldal, f. (1992) biochemistry 31, 3342-3351]. ... | 1997 | 9305957 |
| the amino-terminal portion of the rieske iron-sulfur protein contributes to the ubihydroquinone oxidation site catalysis of the rhodobacter capsulatus bc1 complex. | the rieske iron-sulfur (fe-s) protein subunit of bc1 complexes contains in its carboxyl-terminal part two highly conserved hexapeptide motifs (box i and box ii) that include the four amino acid ligands of its [2fe-2s] cluster. in the preceding paper [liebl, u., sled, v., brasseur, g., ohnishi, t., & daldal, f. (1997) biochemistry 36, 11675-11684], the effects of mutations at two of the nonliganding residues [threonine (t) 134 and leucine (l) 136 in the rhodobactercapsulatus rieske fe-s protein] ... | 1997 | 9305958 |
| factors determining electron-transfer rates in cytochrome c oxidase: studies of the fq(i-391) mutant of the rhodobacter sphaeroides enzyme. | the mechanisms of internal electron transfer and oxygen reduction were investigated in cytochrome c oxidase from rhodobacter sphaeroides (cytochrome aa3) using site-directed mutagenesis in combination with time-resolved optical absorption spectroscopy. electron-transfer reactions in the absence of o2 were studied after flash photolysis of co from the partly-reduced enzyme and the reaction of the fully-reduced enzyme with o2 was studied using the so-called flow-flash technique. results from studi ... | 1997 | 9305969 |
| distribution of a sub-class of bacterial abc polar amino acid transporter and identification of an n-terminal region involved in solute specificity. | a new sub-class of binding protein-dependent transporter with specificity for a broad range of polar amino acids has been identified by sequence comparison, in rhizobium leguminosarum, rhodobacter capsulatus, escherichia coli and pseudomonas fluorescens. southern blotting and pcr analysis has shown that transporters from this new sub-class are widely distributed in gram-negative bacteria, including, in addition to the above, citrobacter freundii, erwinia carotovorum and rhizobium meliloti. abc t ... | 1997 | 9315727 |
| in bacterial reaction centers rapid delivery of the second proton to qb can be achieved in the absence of l212glu. | in the reaction center (rc) of rhodobacter capsulatus, residue l212glu is a component of the pathway for proton transfer to the reduced secondary quinone, qb. we isolated phenotypic revertants of the photosynthetically incompetent (ps-) l212glu-->gln mutant; all of them retain the l212glu-->gln substitution and carry a second-site mutation: l227leu-->phe, l228gly-->asp, l231arg-->cys, or m231arg-->cys. we also characterized the l212ala strain, which is a phenotypic revertant of the ps- l212glu-l ... | 1997 | 9315859 |
| cloning of the sdsa gene encoding solanesyl diphosphate synthase from rhodobacter capsulatus and its functional expression in escherichia coli and saccharomyces cerevisiae. | different organisms produce different species of isoprenoid quinones, each with its own distinctive length. these differences in length are commonly exploited in microbial classification. the side chain length of quinone is determined by the nature of the polyprenyl diphosphate synthase that catalyzes the reaction. to determine if the side chain length of ubiquinone (uq) has any distinct role to play in the metabolism of the cells in which it is found, we cloned the solanesyl diphosphate synthas ... | 1997 | 9324242 |
| isolation and ultrastructural study of the flagellar basal body complex from rhodobacter sphaeroides ws8 (wild type) and a polyhook mutant pg. | filament-hook-basal body (fhbb) complexes were isolated from the purple non-sulphur facultative anaerobic bacterium rhodobacter sphaeroides (ws8) by lysozyme digestion of the cells followed by an alkaline treatment and ultracentrifugation, and they were analysed by electron microscopy. the structure is composed of a filament linked through an enlarged junction to the hook and a basal body composed of l and p rings, a rod, and a less well-defined cytoplasmic ring that has evidence of additional a ... | 1997 | 9325158 |
| molybdate transport and regulation in bacteria. | molybdate is transported in bacteria by a high-affinity transport system composed of a periplasmic binding protein, an integral membrane protein, and an energizer protein. these three proteins are coded by moda, modb, and modc genes, respectively. the moda, modb, and modc proteins from various organisms (escherichia coli, haemophilus influenzae, azotobacter vinelandii, and rhodobacter capsulatus) are very similar. the lowest km value reported for molybdate in the molybdate transport process is a ... | 1997 | 9325422 |
| light-induced electrogenic events associated with proton uptake upon forming qb- in bacterial wild-type and mutant reaction centers. | light-induced voltage changes (electrogenic events) were measured in wild-type and site-directed mutants of reaction centers (rcs) from rhodobacter sphaeroides oriented in a lipid monolayer adsorbed to a teflon film. a rapid increase in voltage associated with charge separation was followed by a slower increase attributed to proton transfer from solution to protonatable amino-acid residues in the vicinity of the qb site. in native reaction centers the proton-transfer voltage had a ph-dependent a ... | 1997 | 9332502 |
| cloning, nucleotide sequence, and overexpression of smos, a component of a novel operon encoding an abc transporter and polyol dehydrogenases of rhodobacter sphaeroides si4. | the gene coding for sorbitol dehydrogenase (sdh) of rhodobacter sphaeroides si4 was located 55 nucleotides upstream of the mannitol dehydrogenase gene (mtlk) within a previously unrecognized polyol operon. this operon probably consists of all the proteins necessary for transport and metabolization of various polyols. the gene encoding sdh (smos) was cloned and sequenced. analysis of the deduced amino acid sequence revealed homology to enzymes of the short-chain dehydrogenase/reductase protein fa ... | 1997 | 9335280 |
| orientation of photosynthetic reaction center reconstituted in neutral and charged liposomes. | the photosynthetic reaction center from the photosynthetic bacterium rhodobacter sphaeroides was reconstituted into neutral, positively charged, or negatively charged liposomes. about 70% of photosynthetic reaction centers were reconstituted in the proteoliposomes exposing their h-subunit outside with positively charged lipids while only 30-40% of them were in the same topological orientation with neutral or negatively charged lipids. | 1997 | 9339562 |
| characterization of the rhodobacter capsulatus housekeeping rna polymerase. in vitro transcription of photosynthesis and other genes. | to begin to characterize biochemically the transcriptional activation systems in photosynthetic bacteria, the rhodobacter capsulatus rna polymerase (rnap) that contains the sigma70 factor (r. capsulatus rnap/sigma70) was purified and characterized using two classical sigma70 type promoters, the bacteriophage t7a1 and the rna i promoters. transcription from these promoters was sensitive to rifampicin, rnase, and monoclonal antibody 2g10 (directed against the escherichia coli sigma70 subunit). spe ... | 1997 | 9341173 |
| sulfite stimulates the atp hydrolysis activity of but not proton translocation by the atp synthase of rhodobacter capsulatus and interferes with its activation by delta muh+. | sulfite stimulates the rate of atp hydrolysis by the atp synthase in chromatophores of rhodobacter capsulatus. the stimulated activity is inhibited by oligomycin. the activation takes place also in uncoupled chromatophores. the activation consists in an increase of about 12-15-fold of the vmax for the atp hydrolysis reaction, while the km for mgatp is unaffected at 0.16+/-0.03 mm. the dependence of vmax on the sulfite concentration follows a hyperbolic pattern with half maximum effect at 12 mm. ... | 1997 | 9346308 |
| programmed cell death in prokaryotes. | programmed cell death (pcd), also referred to as apoptosis, is a cellular "suicide" mechanism, based on information from its own internal metabolism, environment, developmental history, and genome. this system was described in eukaryotes continuously along evolution, through amoebae, nematodes, insects, and animals. pcd is essential for the proper development or function of a cell system, organ, or survival of the organism as a whole. research in the last 2 decades has shown that the life cycle ... | 1997 | 9347220 |
| the coupling of light-induced electron transfer and proton uptake as derived from crystal structures of reaction centres from rhodopseudomonas viridis modified at the binding site of the secondary quinone, qb. | in a reaction of central importance to the energetics of photosynthetic bacteria, light-induced electron transfer in the reaction centre (rc) is coupled to the uptake of protons from the cytoplasm at the binding site of the secondary quinone (qb). in the original structure of the rc from rhodopseudomonas viridis (pdb entry code 1prc), the qb site was poorly defined because in the standard rc crystals it was only approximately 30% occupied with ubiquinone-9 (uq9). we report here the structural ch ... | 1997 | 9351808 |
| extracellular reduction of selenite by a novel marine photosynthetic bacterium. | a novel purple nonsulfur bacterium strain nkpb030619, which has resistance to over 5 mm selenite, was isolated from a marine environment. an initial concentration of 1.1 mm selenite, added to the medium, was decreased to under 0.05 mm within 5 days. the color of the cell suspension turned red within 2 days. the red coloration gradually decreased and black precipitates appeared during 2 weeks of cultivation. under these conditions, two main types of deposit were formed extracellularly. these depo ... | 1997 | 9352678 |
| structural and genetic analysis of a mutant of rhodobacter sphaeroides ws8 deficient in hook length control. | motility in the photosynthetic bacterium rhodobacter sphaeroides is achieved by the unidirectional rotation of a single subpolar flagellum. in this study, transposon mutagenesis was used to obtain nonmotile flagellar mutants from this bacterium. we report here the isolation and characterization of a mutant that shows a polyhook phenotype. morphological characterization of the mutant was done by electron microscopy. polyhooks were obtained by shearing and were used to purify the hook protein mono ... | 1997 | 9352903 |
| photoresponses of the purple nonsulfur bacteria rhodospirillum centenum and rhodobacter sphaeroides. | we have measured the photoresponse of two purple nonsulfur bacteria, rhodobacter sphaeroides and rhodospirillum centenum, under defined conditions in a light beam propagating at 90 degrees to the optical axis of the microscope. this beam presented cells with a steep gradient of intensity perpendicular to the direction of propagation and a shallow gradient in the direction of light propagation. r. centenum, a species that reverses to change direction, accumulated in the light beam, as expected fo ... | 1997 | 9352928 |
| low-resolution sequencing of rhodobacter sphaeroides 2.4.1t: chromosome ii is a true chromosome. | the photosynthetic bacterium rhodobacter sphaeroides 2.4.1t has two chromosomes, ci (approximately 3.0 mb) and cii (approximately 0.9 mb). in this study a low-redundancy sequencing strategy was adopted to analyse 23 out of 47 cosmids from an ordered cii library. the sum of the lengths of these 23 cosmid inserts was approximately 495 kb, which comprised approximately 417 kb of unique dna. a total of 1145 sequencing runs was carried out, with each run generating 559 +/- 268 bases of sequence to gi ... | 1997 | 9353914 |
| transcriptional control of several aerobically induced cytochrome structural genes in rhodobacter sphaeroides. | to decipher how the synthesis of energy-transducing enzymes responds to environmental cues, the response of three rhodobacter sphaeroides aerobic cytochrome gene promoters was analysed under different conditions. two of these promoters are upstream of structural genes (ctad and coxii) for individual subunits of the cytochrome aa3 respiratory complex. the third promoter is that for the cycfg operon, which encodes two c-type cytochromes of unknown function, cytochrome c554 and cycg. primer extensi ... | 1997 | 9353915 |
| proton and electron transfer to the secondary quinone (qb) in bacterial reaction centers: the effect of changing the electrostatics in the vicinity of qb by interchanging asp and glu at the l212 and l213 sites. | the bacterial reaction center (rc) plays a central role in photosynthetic energy conversion by facilitating the light induced double reduction and protonation of a bound quinone molecule, qb. two carboxylic acid residues, asp-l213 and glu-l212, located near qb, were previously shown to be important for proton transfer to qb. in this work, the ability of glu to substitute for asp at l213 and asp to substitute for glu at l212 was tested by site-directed mutagenesis. both single mutants and a doubl ... | 1997 | 9369497 |
| molecular characterisation of the pifc gene encoding translation initiation factor 3, which is required for normal photosynthetic complex formation in rhodobacter sphaeroides ncib 8253. | in order to determine whether translation initiation events play a selective role in regulating the expression of photosynthetic complexes in the photosynthetic bacterium rhodobacter sphaeroides, we have undertaken an initial study to investigate the potential role of translation initiation factor if3, which also behaves as a pleiotropic regulatory factor in some bacteria. following the isolation and purification of a 24-kda if3-like protein (pifc) from r. sphaeroides, we used nested pcr to clon ... | 1997 | 9370368 |
| atpases and phosphate exchange activities in magnesium chelatase subunits of rhodobacter sphaeroides. | three separate proteins, bchd, bchh, and bchi, together with atp, insert magnesium into protoporphyrin ix. an analysis of atp utilization by the subunits revealed the following: bchh catalyzed atp hydrolysis at the rate of 0.9 nmol per min per mg of protein. bchi and bchd, tested individually, had no atpase activity but, when combined, hydrolyzed atp at the rate of 117.9 nmol/min per mg of protein. magnesium ions were required for the atpase activities of both bchh and bchi+d, and these activiti ... | 1997 | 9371849 |
| glutamate 286 in cytochrome aa3 from rhodobacter sphaeroides is involved in proton uptake during the reaction of the fully-reduced enzyme with dioxygen. | the reaction with dioxygen of solubilized fully-reduced wild-type and eq(i-286) (exchange of glutamate 286 of subunit i for glutamine) mutant cytochrome c oxidase from rhodobacter sphaeroides has been studied using the flow-flash technique in combination with optical absorption spectroscopy. proton uptake was measured using a ph-indicator dye. in addition, internal electron-transfer reactions were studied in the absence of oxygen. glutamate 286 is found in a proton pathway proposed to be used fo ... | 1997 | 9374859 |
| site-directed modification of the ligands to the bacteriochlorophylls of the light-harvesting lh1 and lh2 complexes of rhodobacter sphaeroides. | the core light-harvesting lh1 complex of rhodobactersphaeroides consists of an assembly of membrane-spanning alpha and beta polypeptides, each of which binds one bacteriochlorophyll molecule. in this study we have used site-directed mutagenesis to demonstrate that the b880 bacteriochlorophyll binding site of lh1 shows a high degree of specificity for the residue that provides the ligand to the bchl mg2+ ion. alpha his0 (alphah0) was changed to asn, leu, and tyr, and beta his0 (betah0) to asn, gl ... | 1997 | 9376369 |
| relationship between the oxidation potential and electron spin density of the primary electron donor in reaction centers from rhodobacter sphaeroides. | the primary electron donor in bacterial reaction centers is a dimer of bacteriochlorophyll a molecules, labeled l or m based on their proximity to the symmetry-related protein subunits. the electronic structure of the bacteriochlorophyll dimer was probed by introducing small systematic variations in the bacteriochlorophyll-protein interactions by a series of site-directed mutations that replaced residue leu m160 with histidine, tyrosine, glutamic acid, glutamine, aspartic acid, asparagine, lysin ... | 1997 | 9391069 |
| analysis of the fnrl gene and its function in rhodobacter capsulatus. | the fnr gene encodes a regulatory protein involved in the response to oxygen in a variety of bacterial genera. for example, it was previously shown that the anoxygenic, photosynthetic bacterium rhodobacter sphaeroides requires the fnrl gene for growth under anaerobic, photosynthetic conditions. additionally, the fnrl protein in r. sphaeroides is required for anaerobic growth in the dark with an alternative electron acceptor, but it is not essential for aerobic growth. in this study, the fnrl loc ... | 1997 | 9393689 |
| purification and biochemical characterization of a hydroxyneurosporene desaturase involved in the biosynthetic pathway of the carotenoid spheroidene in rhodobacter sphaeroides. | hydroxyneurosporene desaturase is involved in the carotenoid biosynthetic pathway of rhodobacter species. the gene encoding this enzyme was expressed in escherichia coli, purified, and biochemically characterized. the resulting protein contained an n-terminal six-histidine extension which derived from the cloning vector; this allowed for a one-step purification of the enzyme to homogeneity after solubilization with nonidet p-40. the hydrogen acceptor in the c-3,4 desaturation reaction was molecu ... | 1997 | 9393712 |
| a quorum-sensing system in the free-living photosynthetic bacterium rhodobacter sphaeroides. | rhodobacter sphaeroides is a free-living, photoheterotrophic bacterium known for its genomic and metabolic complexity. we have discovered that this purple photosynthetic organism possesses a quorum-sensing system. quorum sensing occurs in a number of eukaryotic host-associated gram-negative bacteria. in these bacteria there are two genes required for quorum sensing, the luxr and luxi homologs, and there is an acylhomoserine lactone signal molecule synthesized by the product of the luxi homolog. ... | 1997 | 9393720 |
| degradation of p-nitrophenol by the phototrophic bacterium rhodobacter capsulatus. | the phototrophic bacterium rhodobacter capsulatus detoxified p-nitrophenol and 4-nitrocatechol. the bacterium tolerated moderate concentrations of p-nitrophenol (up to 0.5 mm) and degraded it under light at an optimal o2 pressure of 20 kpa. the bacterium did not metabolize the xenobiotic in the dark or under strictly anoxic conditions or high o2 pressure. bacterial growth with acetate in the presence of p-nitrophenol took place with the simultaneous release of nonstoichiometric amounts of 4-nitr ... | 1998 | 9396833 |
| effects of mutation of the conserved lysine-362 in cytochrome c oxidase from rhodobacter sphaeroides. | we describe the effects of a mutation, k362m, of the conserved lysine in cytochrome c oxidase from rhodobacter sphaeroides, a residue located in a putative proton channel that may convey substrate protons to the binuclear center. spectra of the "as prepared", ferricyanide-oxidized, and dithionite-reduced forms of the mutant protein confirm that the redox centers remain intact. ligand binding kinetics of the ferricyanide-oxidized enzyme and of the dithionite-reducible fraction are similar to thos ... | 1997 | 9398164 |
| resonance raman characterization of reaction centers in which bacteriochlorophyll replaces the photoactive bacteriopheophytin. | qy-excitation resonance raman (rr) spectra are reported for two mutant reactions centers (rcs) from rhodobacter sphaeroides in which the photoactive bacteriopheophytin (bphl) is replaced by a bacteriochlorophyll (bchl) molecule, designated by beta l. one mutation, (m)l214h, yields the pigment change via introduction of a histidine residue at position m214. the other mutation, (m)l214h/(l)-e104v, removes the putative hydrogen bond between beta l and the native glutamic acid residue at position l1 ... | 1997 | 9398189 |
| conformation-activated protonation in reaction centers of the photosynthetic bacterium rhodobacter sphaeroides. | kinetics and stoichiometry of proton binding/unbinding induced by intense (1 w cm-2) and continuous illumination were measured in the isolated reaction center (rc) protein from photosynthetic purple bacterium rhodobacter sphaeroides in the absence of an external electron donor. at high ionic strength (100 mm), large proton release (approximately 6 h+ per rc) was observed at ph 6 and substoichiometric h+-ion binding (approximately 0.3 h+ per rc) at ph 8. these observations together with optical s ... | 1997 | 9398255 |
| characterization of genes encoding dimethyl sulfoxide reductase of rhodobacter sphaeroides 2.4.1t: an essential metabolic gene function encoded on chromosome ii. | rhodobacter sphaeroides 2.4.1t is a purple nonsulfur facultative phototrophic bacterium which exhibits remarkable metabolic diversity as well as genomic complexity. under anoxic conditions, in the absence of light and the presence of dimethyl sulfoxide (dmso) or trimethylamine n-oxide (tmao), r. sphaeroides 2.4.1t utilizes dmso or tmao as the terminal electron acceptor for anaerobic respiration, which is mediated by the molybdoenzyme dmso reductase. sequencing of a 13-kb region of chromosome ii ... | 1997 | 9401017 |
| comparison of the bacterial hela protein to the f508 region of the cystic fibrosis transmembrane regulator. | the hela protein of rhodobacter capsulatus is the atp-binding-cassette subunit of an exporter complex required for cytochrome c biogenesis. by primary sequence comparisons the f88 residue of hela is similar to the f508 residue of the cystic fibrosis transmembrane regulator (cftr) protein. previous studies have established that cftr f508delta or f508r proteins are defective but f508c is functional. our results demonstrate that the hela f88 mutants functionally mimic the phenotypes of known cftr f ... | 1997 | 9401049 |
| formation of a long-lived p+ba- state in plant pheophytin-exchanged reaction centers of rhodobacter sphaeroides r26 at low temperature. | femtosecond transient absorption spectroscopy in the range of 500-1040 nm was used to study electron transfer at 5 k in reaction centers of rhodobacter sphaeroides r26 in which the bacteriopheophytins (bphe) were replaced by plant pheophytin a (phe). primary charge separation took place with a time constant of 1.6 ps, similar to that found in native rcs. spectral changes around 1020 nm indicated the formation of reduced bacteriochlorophyll (bchl) with the same time constant, and its subsequent d ... | 1997 | 9405057 |
| redox thermodynamics of the native and alkaline forms of eukaryotic and bacterial class i cytochromes c. | the reduction potentials of beef heart cytochrome c and cytochromes c2 from rhodopseudomonas palustris, rhodobacter sphaeroides, and rhodobacter capsulatus were measured through direct electrochemistry at a surface-modified gold electrode as a function of temperature in nonisothermal experiments carried out at neutral and alkaline ph values. the thermodynamic parameters for protein reduction (deltas degrees rc and deltah degrees rc) were determined for the native and alkaline conformers. enthalp ... | 1997 | 9405059 |
| influence of the protein binding site on the absorption properties of the monomeric bacteriochlorophyll in rhodobacter sphaeroides lh2 complex. | resonance raman spectroscopy was performed on peripheral light-harvesting proteins from rhodobacter sphaeroides in which the residue betaarg-10 has been modified by site-selected mutagenesis. we show that this residue is indeed involved (as proposed by x-ray crystallographic studies on the lh2 complex from rhodopseudomonas acidophila), in an h-bond with the acetyl carbonyl of the 800 nm-absorbing bchl in these proteins (b800), and that the presence of such an h-bond induces a ca. 10 nm red shift ... | 1997 | 9405063 |
| structural study of the response regulator hupr from rhodobacter capsulatus. electron microscopy of two-dimensional crystals on a nickel-chelating lipid. | two-dimensional crystals of the histidine-tagged-hupr protein, a transcriptional regulator from the photosynthetic bacterium rhodobacter capsulatus, were obtained upon specific interaction with a ni2+-chelated lipid monolayer. hupr is a response regulator of the ntrc family; it activates the transcription of the structural genes, hupslc, of the [nife]hydrogenase. the lipid (ni-nta-doga) uses the metal chelator nitrilotriacetic group as the hydrophilic headgroup and contains unsaturated oleyl tai ... | 1997 | 9405151 |
| identification and molecular genetic analysis of multiple loci contributing to high-level tellurite resistance in rhodobacter sphaeroides 2.4.1. | the ability of the facultative photoheterotroph rhodobacter sphaeroides to tolerate and reduce high levels of tellurite in addition to at least 10 other rare earth metal oxides and oxyanions has considerable potential for detoxification and bioremediation of contaminated environments. we report the identification and characterization of two loci involved in high-level tellurite resistance. the first locus contains four genes, two of which, trgab, confer increased tellurite resistance when introd ... | 1997 | 9406390 |
| matrix-assisted laser desorption ionization mass spectrometry of membrane proteins: demonstration of a simple method to determine subunit molecular weights of hydrophobic subunits. | matrix-assisted laser desorption ionization (maldi) mass spectrometry has been used to obtain accurate molecular weight information for each subunit of several hydrophobic integral membrane proteins: cytochrome bo3 (4 subunits) and cytochrome bd (2 subunits) from e. coli, and the bc1 complex (3 subunits) and the cytochrome c oxidase (3 subunits) from rhodobacter sphaeroides. the results demonstrate that the maldi method is a convenient, quick, sensitive and reliable means for obtaining the molec ... | 1997 | 9408163 |
| cell biology and molecular basis of denitrification. | denitrification is a distinct means of energy conservation, making use of n oxides as terminal electron acceptors for cellular bioenergetics under anaerobic, microaerophilic, and occasionally aerobic conditions. the process is an essential branch of the global n cycle, reversing dinitrogen fixation, and is associated with chemolithotrophic, phototrophic, diazotrophic, or organotrophic metabolism but generally not with obligately anaerobic life. discovered more than a century ago and believed to ... | 1997 | 9409151 |
| mg-chelatase of tobacco: identification of a chl d cdna sequence encoding a third subunit, analysis of the interaction of the three subunits with the yeast two-hybrid system, and reconstitution of the enzyme activity by co-expression of recombinant chl d, chl h and chl i. | mg-protoporphyrin ix chelatase catalyzes insertion of the magnesium ion into protoporphyrin ix, the last common intermediate precursor in chlorophyll and heme biosynthesis, to form mg-protoporphyrin ix. in rhodobacter sphaeroides, and synechocystis, the three open reading frames bchd/chid, bchh/chih and bchi/chii encode proteins which are required for in vitro mg-chelatase activity. in higher plants also, three proteins are necessary for the mg chelation, and genes homologous to bchh and bchi ha ... | 1997 | 9418040 |
| bacterial chemotaxis: rhodobacter sphaeroides and sinorhizobium meliloti--variations on a theme? | we are only beginning to understand the mechanisms involved in tactic sensing in the alpha-subgroup of bacteria. it is clear, however, from recent developments that although the central chemosensory pathways are related to those identified in enteric species, the primary signals and the effect on flagellar behaviour are very different. the expression of chemoreceptors is under environmental control, and the strength of a response depends on the metabolic state of the cell. this is very different ... | 1997 | 9421893 |
| transcription of the rhodobacter sphaeroides cyca p1 promoter by alternate rna polymerase holoenzymes. | these experiments sought to identify what form of rna polymerase transcribes the p1 promoter for the rhodobacter sphaeroides cytochrome c2 gene (cyca). in vitro, cyca p1 was recognized by an rna polymerase holoenzyme fraction that transcribes several well-characterized escherichia coli heat shock (sigma32) promoters. the in vivo effects of mutations flanking the transcription initiation site (+1) also suggested that cyca p1 was recognized by an rna polymerase similar to e. coli esigma32. functio ... | 1998 | 9422585 |
| metabolic roles of a rhodobacter sphaeroides member of the sigma32 family. | we report the role of a gene (rpoh) from the facultative phototroph rhodobacter sphaeroides that encodes a protein (sigma37) similar to escherichia coli sigma32 and other members of the heat shock family of eubacterial sigma factors. r. sphaeroides sigma37 controls genes that function during environmental stress, since an r. sphaeroides deltarpoh mutant is approximately 30-fold more sensitive to the toxic oxyanion tellurite than wild-type cells. however, the deltarpoh mutant lacks several phenot ... | 1998 | 9422586 |
| function of a glutathione-dependent formaldehyde dehydrogenase in rhodobacter sphaeroides formaldehyde oxidation and assimilation. | despite its reactivity with many biological molecules, formaldehyde can be commonly encountered by virtually all cells. the widespread existence of glutathione-dependent formaldehyde dehydrogenases (gsh-fdh) in procaryotes and eucaryotes suggests this enzyme plays a central and universal role in biological formaldehyde oxidation. this work sought to determine the role of gsh-fdh in the facultative phototrophic bacterium rhodobacter sphaeroides. growth phenotypes of wild-type and mutant cells, ch ... | 1998 | 9425073 |
| the rhodobacter capsulatus hupslc promoter: identification of cis-regulatory elements and of trans-activating factors involved in h2 activation of hupslc transcription. | the [nife]hydrogenase of the photosynthetic bacterium rhodobacter capsulatus is encoded by the structural hupslc operon, the expression of which is induced by h2. h2 activation was no longer observable in chromosomal hupr mutants, an indication that hupr is implicated directly in the activation by h2 of hups gene expression. the transcriptional start site of the hups promoter, determined by primer extension mapping, was located 55 nucleotides upstream from the translational start codon of the hu ... | 1997 | 9426130 |
| evidence for two chemosensory pathways in rhodobacter sphaeroides. | in contrast to enteric bacteria, chemotaxis in rhodobacter sphaeroides requires transport and partial metabolism of chemoattractants. although a chemotaxis operon has been identified containing homologues of the enteric chea, chew, cher genes and two homologues of the chey gene, deletion of the entire chemotaxis operon had only minor effects on chemotactic behaviour under the conditions tested. responses to sugars were enhanced in tethered cells but in all other chemotaxis assays behaviour of th ... | 1997 | 9426144 |
| the nuoi subunit of the rhodobacter capsulatus respiratory complex i (equivalent to the bovine tyky subunit) is required for proper assembly of the membraneous and peripheral domains of the enzyme. | the nuoi gene that encodes a ferredoxin-like subunit of the rhodobacter capsulatus complex i (a subunit equivalent to the bovine tyky subunit) was mutated by homologous recombination. both a nuoi-deleted mutant (delta nuoi mutant) and a point mutant in which cys74 was replaced by a serine (c74s mutant) proved to be completely deficient in complex i activity. these strains were unable to grow under anaerobic photosynthetic conditions. their cytoplasmic membranes were also characterized by the abs ... | 1997 | 9428698 |
| nucleotide sequences of genes coding for photosynthetic reaction centers and light-harvesting proteins of acidiphilium rubrum and related aerobic acidophilic bacteria. | the nucleotide sequences of the puf operons of the zn-bacteriochlorophyll a (zn-bchl a)-containing photosynthetic aerobic bacteria, acidiphilium rubrum and acidiphilium angustum, were determined. the nucleotide sequences of the pufl and -m of acidiphilium cryptum, acidiphilium multivorum, and acidiphilium organovorum were also determined. the puf operons of a. rubrum and a. angustum contained pufb, -a, -l, -m, and -c as seen in other purple bacteria with an unknown gene directly upstream of pufb ... | 1997 | 9435141 |
| the atp synthase atphagdc (f1) operon from rhodobacter capsulatus. | the atphagdc operon of rhodobacter capsulatus, containing the five genes coding for the f1 sector of the atp synthase, has been cloned and sequenced. the promoter region has been defined by primer extension analysis. it was not possible to obtain viable cells carrying atp deletions in the r. capsulatus chromosome, indicating that genes coding for atp synthase are essential, at least under the growth conditions tested. we were able to circumvent this problem by combining gene transfer agent trans ... | 1998 | 9440534 |
| genetic analysis of chlorophyll biosynthesis. | during this decade, there have been major advancements in the understanding of genetic loci involved in synthesis of the family of mg-tetrapyrroles known as chlorophylls and bacteriochlorophylls. molecular genetic analysis of mg-tetrapyrrole biosynthesis was initiated by the performance of detailed sequence and mutational analysis of the photosynthesis gene cluster from rhodobacter capsulatus. these studies provided the first detailed understanding of genes involved in bacteriochlorophyll a bios ... | 1997 | 9442890 |
| complex i of rhodobacter capsulatus and its role in reverted electron transport. | the activities of nad+-photoreduction and nadh/decyl-ubiquinone reductase in membrane preparations of rhodobacter capsulatus changed to the same extent under different conditions. these results indicated that nadh:ubiquinone oxidoreductase (complex i) catalyzes the electron transport in the downhill direction (respiratory chain) and in the uphill direction (reverted electron flow). this conclusion was confirmed by the characterization of a complex-i-deficient mutant of r. capsulatus. the mutant ... | 1998 | 9446680 |
| demonstration of the key role played by the pufx protein in the functional and structural organization of native and hybrid bacterial photosynthetic core complexes. | the role of a component of the bacterial photosystem, the pufx protein, was examined by heterologous expression of the pufx gene from rhodobacter capsulatus in a strain of r. sphaeroides that lacks the native pufx gene. the strain of r. sphaeroides containing the r. capsulatus pufx protein was capable of efficient transduction of light energy despite a low degree of sequence conservation between the pufx proteins from the two species. the organization of the hybrid reaction center/lh1 photosyste ... | 1998 | 9457869 |
| reconstitution of an active magnesium chelatase enzyme complex from the bchi, -d, and -h gene products of the green sulfur bacterium chlorobium vibrioforme expressed in escherichia coli. | magnesium-protoporphyrin chelatase, the first enzyme unique to the (bacterio)chlorophyll-specific branch of the porphyrin biosynthetic pathway, catalyzes the insertion of mg2+ into protoporphyrin ix. three genes, designated bchi, -d, and -h, from the strictly anaerobic and obligately phototrophic green sulfur bacterium chlorobium vibrioforme show a significant level of homology to the magnesium chelatase-encoding genes bchi, -d, and -h and chli, -d, and -h of rhodobacter sphaeroides and synechoc ... | 1998 | 9457877 |
| grain dust-induced lung inflammation is reduced by rhodobacter sphaeroides diphosphoryl lipid a. | to further determine the importance of endotoxin in grain dust-induced inflammation of the lower respiratory tract, we evaluated the efficacy of pentaacylated diphosphoryl lipid a derived from the lipopolysaccharide of rhodobacter sphaeroides (rsdpla) as a partial agonist of grain dust-induced airway inflammation. rsdpla is a relatively inactive compound compared with lipid a derived from escherichia coli (lps) and has been demonstrated to act as a partial agonist of lps-induced inflammation. to ... | 1998 | 9458797 |
| biosorption of heavy metal ions on rhodobacter sphaeroides and alcaligenes eutrophus h16 | a fundamental study of the application of bacteria to the recovery of toxic heavy metals from aqueous environments was carried out. the biosorption characteristics of cadmium and lead ions were determined with purple nonsulfur bacteria, rhodobacter sphaeroides and hydrogen bacteria, alcaligenes eutrophus h16 that were inactivated by steam sterilization. a simplified version of the metal binding model proposed by plette et al. was used for the description of metal binding data. the results showed ... | 1998 | 9466859 |
| rhodobacter capsulatus genes encoding form i ribulose-1,5-bisphosphate carboxylase/oxygenase (cbbls) and neighbouring genes were acquired by a horizontal gene transfer. | analysis of the nucleotide sequence of the form i ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) genes (cbbl and cbbs) of the non-sulfur purple bacterium rhodobacter capsulatus indicated that the deduced amino acid sequence of the large subunit was not closely homologous to the large subunit from related organisms. indeed, phylogenetic analysis suggested that the large subunit protein (cbbl) more closely resembled the enzyme from alpha/beta/gamma purple bacteria and cyanobacteria and ... | 1998 | 9467914 |
| metabolism is required for chemotaxis to sugars in rhodobacter sphaeroides. | chemotaxis towards carbohydrates is mediated, in enteric bacteria, either by the transport-independent, methylation-dependent chemotaxis pathway or by transport and phosphorylation via the phosphoenolpyruvate (pep)-dependent phosphotransferase system (pts). this study shows that rhodobacter sphaeroides is chemotactic to a range of carbohydrates but the response involves neither the classical methyl-accepting chemotaxis protein (mcp) pathway nor the pts transport pathway. the chemoattractant fruc ... | 1998 | 9467915 |
| synthesis of atypical cyclic and acyclic hydroxy carotenoids in escherichia coli transformants. | a total of eight different hydroxy carotenoids were produced in transformants of the non-carotenogenic bacterium escherichia coli. they include the acyclic 1-hydroxyneurosporene, 1-hydroxylycopene, 1,1'-dihydroxylycopene and demethylspheroidene as well as the cyclic 3-hydroxy-beta-zeacarotene, 7,8-dihydrozeaxanthin, 3 or 3'-7,8-dihydro-beta-carotene and 1'-hydroxy-gamma-carotene. most of these uncommon carotenoids are found only in trace amounts in natural sources. for the synthesis of all the c ... | 1997 | 9470222 |
| isolation and characterization of rhodobacter capsulatus mutants affected in cytochrome cbb3 oxidase activity. | the facultative phototrophic bacterium rhodobacter capsulatus contains only one form of cytochrome (cyt) c oxidase, which has recently been identified as a cbb3-type cyt c oxidase. this is unlike other related species, such as rhodobacter sphaeroides and paracoccus denitrificans, which contain an additional mitochondrial-like aa3-type cyt c oxidase. an extensive search for mutants affected in cyt c oxidase activity in r. capsulatus led to the isolation of at least five classes of mutants. plasmi ... | 1998 | 9473054 |
| characterisation of the mob locus from rhodobacter sphaeroides required for molybdenum cofactor biosynthesis. | a clone carrying the mob locus from rb. sphaeroides ws8 has been isolated from a cosmid library by southern blotting with a probe covering the mob genes of escherichia coli. the mob dna has been subcloned and partially restores molybdoenzyme activities when transformed into e. coli mob strains. dna sequence analysis of the subclone carrying the mob genes predicted at least 2 open reading frames. the moba gene encodes protein fa whilst mobb encodes a nucleotide binding protein which has at least ... | 1998 | 9473631 |
| new roles for co2 in the microbial metabolism of aliphatic epoxides and ketones. | short-chain aliphatic epoxides and ketones are two classes of toxic organic compounds formed biogenically and anthropogenically. in spite of their toxicity, these compounds are utilized as primary carbon and energy sources or are generated as intermediate metabolites in the metabolism of other compounds (e.g., alkenes, alkanes, and secondary alcohols) by a number of diverse bacteria. one bacterium capable of using both classes of compounds is the gram-negative aerobe xanthobacter strain py2. stu ... | 1998 | 9477250 |
| functional evaluation of invariant arginines situated in the mobile lid domain of phosphoribulokinase. | rhodobacter sphaeroides phosphoribulokinase contains four invariant arginines (r49, r168, r173, and r187). the high-resolution structure of this enzyme [harrison, d. h. t., runquist, j. a., holub, a., and miziorko, h. m. (1998) biochemistry (submitted for publication)] reveals that it folds in a manner similar to that of adenylate kinase. three invariant arginines (r168, r173, and r187) as well as arginine-186, which is conserved in prokaryotic phosphoribulokinases, have not been previously func ... | 1998 | 9477947 |