| isolation and biological activities of endotoxin from leptospira interrogans. | endotoxins extracted with ethylenediaminetetraacetate (edta) from leptospira interrogans serovars icterohaemorrhagiae and canicola and leptospira biflexa serovar patoc were tested for various biological activities characteristic of endotoxins. the presence of lipopolysaccharide biological activity was demonstrated by the limulus amoebocyte lysate test, pyrogenicity in rabbits, complement interaction inhibiting the erythrocyte lysis, and chicken-embryo lethality. the lipopolysaccharides did not i ... | 1992 | 1611553 |
| temperature-dependent hypermutational phenotype in reca mutants of thermus thermophilus hb27. | the reca gene from thermus thermophilus hb27 was cloned and engineered to obtain insertion (reca::kat) and deletion (deltareca) derivatives. transcription of reca in this extreme thermophile was induced by mitomycin c, leading to the synthesis of a monocistronic mrna. this dna damage-mediated induction was dependent on the integrity of reca. in addition to uv sensitivity, the reca mutants of t. thermophilus showed severe pleiotropic defects, ranging from irregular nucleoid condensation and segre ... | 2003 | 12897010 |
| sequence of the leptospira biflexa serovar patoc reca gene. | the nucleotide (nt) sequence of the reca gene of leptospira biflexa serovar patoc strain patoc i has been determined. the deduced amino acid (aa) sequence of the reca protein is 387 aa long with a predicted molecular mass of 42,355 da. the aa sequence has a high degree of identity to the aa sequences of many bacterial reca, including pseudomonas fluorescens, escherichia coli and bacillus subtilis. this is the first reca sequence reported for a bacterium in the order spirochaetales. | 1995 | 8566806 |
| standardization and stabilization of an extract from leptospira biflexa and its use in the hemolytic test for leptospirosis. | | 1957 | 13475879 |
| isolation and characterization of muramic acid from two spirochaetes: borrelia duttoni and leptospira biflexa. | | 1963 | 14043185 |
| differentiation of pathogenic and saprophytic leptospires with 8-azaguanine. | johnson, russell c. (university of minnesota, minneapolis), and palmer rogers. differentiation of pathogenic and saprophytic leptospires with 8-azaguanine. j. bacteriol. 88:1618-1623. 1964.-the use of the purine analogue, 8-azaguanine, as a differential agent for the separation of pathogenic and saprophytic leptospires was investigated. growth of strains of the saprophyte leptospira biflexa was almost insensitive to the bacteriostatic action of 8-azaguanine at concentrations varying from 25 to 6 ... | 1964 | 14244050 |
| [demarcation of saprophytic and pathogenic properties of leptospira biflexa]. | | 1964 | 14266480 |
| chromosomal rearrangement and serovar conversion in leptospira biflexa strains. | a bacterial population change involving chromosomal rearrangement and phenotypic changes in antigens, proteins and lipopolysaccharides is described for strains of leptospira biflexa that were previously grown in media containing homologous oligoclonal antibodies. the chromosomal rearrangement phenomenon showed that the variants differed from the parent strains, yet they were similar to phenotypically related serovars already occurring in nature. accordingly, in vitro serovar conversion mediated ... | 1993 | 8353321 |
| transamination in leptospira biflexa. | | 1959 | 14421278 |
| host-inducible immunogenic sphingomyelinase-like protein, lk73.5, of leptospira interrogans. | leptospira interrogans causes a variety of clinical syndromes in animals and humans. although much information has accumulated on the importance of leptospiral lipopolysaccharide in protective antibody responses, relatively little is known about proteins that participate in immune responses. identification of those proteins induced only in the host is particularly difficult. using a novel double-antibody screen designed to identify clones in a gene library of l. interrogans serovar pomona expres ... | 2004 | 14742516 |
| [distribution of virulence associated genes among strains of leptospira]. | to analyze factors related to the virulence associated genes of leptospires. | 2003 | 14761630 |
| [amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr]. | based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ... | 1993 | 8288193 |
| transgenic expression of reca of the spirochetes borrelia burgdorferi and borrelia hermsii in escherichia coli revealed differences in dna repair and recombination phenotypes. | after unsuccessful attempts to recover a viable reca-deficient mutant of the lyme borreliosis agent borrelia burgdorferi, we characterized the functional activities of reca of b. burgdorferi, as well as reca of the relapsing fever spirochete borrelia hermsii and the free-living spirochete leptospira biflexa, in a reca mutant of escherichia coli. as a control, e. coli reca was expressed from the same plasmid vector. dna damage repair activity was assessed after exposure of the transgenic cells to ... | 2004 | 15060027 |
| functional properties of borrelia burgdorferi reca. | functions of the borrelia burgdorferi reca protein were investigated in escherichia coli reca null mutants. complementation with b. burgdorferi reca increased survival of e. coli reca mutants by 3 orders of magnitude at a uv dose of 2,000 microj/cm(2). the viability at this uv dose was about 10% that provided by the homologous reca gene. expression of b. burgdorferi reca resulted in survival of e. coli at levels of mitomycin c that were lethal to noncomplemented hosts. b. burgdorferi reca was as ... | 2004 | 15060028 |
| new approach for serological testing for leptospirosis by using detection of leptospira agglutination by flow cytometry light scatter analysis. | leptospirosis is considered an important reemerging infectious disease worldwide. the standard and most widespread method for the diagnosis of leptospirosis is the microscopic agglutination test (mat). this test is laborious and time-consuming, and the interpretation of the results is subjective. in the present work we describe an application of flow cytometry (fcm) as a tool for the serological diagnosis of leptospirosis. the analysis is based on the sensitivity of fcm to the size and shape of ... | 2004 | 15071025 |
| molecular evolution and mosaicism of leptospiral outer membrane proteins involves horizontal dna transfer. | leptospires belong to a genus of parasitic bacterial spirochetes that have adapted to a broad range of mammalian hosts. mechanisms of leptospiral molecular evolution were explored by sequence analysis of four genes shared by 38 strains belonging to the core group of pathogenic leptospira species: l. interrogans, l. kirschneri, l. noguchii, l. borgpetersenii, l. santarosai, and l. weilii. the 16s rrna and lipl32 genes were highly conserved, and the lipl41 and ompl1 genes were significantly more v ... | 2004 | 15090524 |
| environmental exposure and leptospirosis, peru. | human infection by leptospires has highly variable clinical manifestations, which range from subclinical infection to fulminant disease. we conducted a population-based, cross-sectional seroepidemiologic study in peru to determine potential relationships of environmental context to human exposure to leptospira and disease associated with seroconversion. three areas were studied: a flooded, urban slum in the peruvian amazon city of iquitos; rural, peri-iquitos villages; and a desert shantytown ne ... | 2004 | 15207052 |
| isoleucine biosynthesis in leptospira interrogans serotype lai strain 56601 proceeds via a threonine-independent pathway. | three leua-like protein-coding sequences were identified in leptospira interrogans. one of these, the cima gene, was shown to encode citramalate synthase (ec 4.1.3.-). the other two encoded alpha-isopropylmalate synthase (ec 4.1.3.12). expressed in escherichia coli, the citramalate synthase was purified and characterized. although its activity was relatively low, it was strictly specific for pyruvate as the keto acid substrate. unlike the citramalate synthase of the thermophile methanococcus jan ... | 2004 | 15292141 |
| expression of leptospiral immunoglobulin-like protein by leptospira interrogans and evaluation of its diagnostic potential in a kinetic elisa. | the search for novel antigens suitable for improved vaccines and diagnostic reagents against leptospirosis led to the identification of liga and ligb. liga and ligb expression were not detectable at the translation level but were detectable at the transcription level in leptospires grown in vitro. lig genes were present in pathogenic serovars of leptospira, but not in non-pathogenic leptospira biflexa. the conserved and variable regions of liga and ligb (con, vara and varb) were cloned, expresse ... | 2004 | 15358819 |
| [evaluation of the counterimmunoelectrophoresis technique for the serologic diagnosis of leptospirosis]. | the counterimmunoelectrophoresis (cie) technic was assessed for leptospirosis serological diagnosis by using an antigenic preparation from leptospira biflexa patoc i strain. it was showed that the cie technic had 82% sensitivity and 100% specificity. the antigen used showed a gender-specific reactivity on detecting antibodies in patients infected by different leptospirosis serogroups by microagglutination test. antigen stability for cie technic was 6 months without loss of titre. | 1993 | 7800895 |
| clinical spectrum of pulmonary involvement in leptospirosis in a region of endemicity, with quantification of leptospiral burden. | pulmonary involvement in leptospirosis remains poorly recognized in regions where it is endemic, despite reports of recent outbreaks and epidemic disease. | 2005 | 15668855 |
| characterization of leptospiral catalase and peroxidase. | peroxidase from leptospira biflexa strain b-16 ad catalase from leptospira interrogans canicola hond utrecht were characterized and compared and both appeared to be heme enzymes as judged by their inhibition profiles and rapid inactivation during catalysis. neither enzyme exhibited monovalent or divalent cation requirements. dialysis of cell-free extracts resulted in loss of peroxidase activity but catalase was unaffected by this procedure. peroxidase had a km for h2o2 of 12.5 microm while catal ... | 1980 | 7407701 |
| immunosuppression in bovine trypanosomiasis. the establishment of "memory" in cattle infected with t. congolense and the effect of post infection serum on in vitro (3h)-thymidine uptake by lymphocytes and on leucocyte migration. | cattle infected with trypanosoma congolense were intravenously immunized with leptospira biflexa 15 days after trypanosomal infection. the primary immune response to l. biflexa was considerably reduced as compared to uninfected controls. the infected cattle mounted a secondary response when they were cured of trypanosomes by treatment with berenil 25 days after infection and re-immunized 8 days later. the mean secondary response in these previously infected animals was lower tha, but not signifi ... | 1980 | 7376244 |
| isolation and characterization of feca- and feob-mediated iron acquisition systems of the spirochete leptospira biflexa by random insertional mutagenesis. | the specific mechanisms by which leptospira spp. acquire iron from their ecological niches are unknown. a major factor contributing to our ignorance of spirochetal biology is the lack of methods for genetic analysis of these organisms. in this study, we have developed a system for random transposon mutagenesis of leptospira biflexa using a mariner transposon, himar1. to demonstrate the validity of himar1 in vivo transposon mutagenesis in l. biflexa, a screen of mutants for clones impaired in ami ... | 2005 | 15838052 |
| random insertional mutagenesis of leptospira interrogans, the agent of leptospirosis, using a mariner transposon. | the recent availability of the complete genome sequences of leptospira interrogans, the agent of leptospirosis, has allowed the identification of several putative virulence factors. however, to our knowledge, attempts to carry out gene transfer in pathogenic leptospira spp. have failed so far. in this study, we show that the himar1 mariner transposon permits random mutagenesis in the pathogen l. interrogans. we have identified genes that have been interrupted by himar1 insertion in 35 l. interro ... | 2005 | 15838053 |
| complete nucleotide sequence of the le1 prophage from the spirochete leptospira biflexa and characterization of its replication and partition functions. | the first and, to date, only extrachromosomal circular replicon identified in the spirochete leptospira is the le1 prophage from leptospira biflexa. the 74-kb le1 genome has a gc content of 36%, which is similar to the gc content of leptospira spp. most of the 79 predicted open reading frames (orfs) showed no similarities to known orfs. however 21 orfs appeared to be organized in clusters that could code for head and tail structural proteins and immunity repressor proteins. in addition, the patt ... | 2005 | 15937155 |
| protection against leptospira interrogans sensu lato challenge by dna immunization with the gene encoding hemolysin-associated protein 1. | the use of dna constructs encoding leptospiral proteins is a promising new approach for vaccination against leptospirosis. in previous work we determined that immunization with hemolysis-associated protein 1 (hap1) (lipl32) expressed by adenovirus induced significant protection against a virulent leptospira challenge in gerbils. to avoid the use of the adenovirus vector, we checked for clinical protection against lethal challenge by dna vaccination. a dna vaccine expressing hap1 was designed to ... | 2005 | 15972494 |
| identification of genes of vsh-1, a prophage-like gene transfer agent of brachyspira hyodysenteriae. | vsh-1 is a mitomycin c-inducible prophage of the anaerobic spirochete brachyspira hyodysenteriae. purified vsh-1 virions are noninfectious, contain random 7.5-kb fragments of the bacterial genome, and mediate generalized transduction of b. hyodysenteriae cells. in order to identify and sequence genes of this novel gene transfer agent (gta), proteins associated either with vsh-1 capsids or with tails were purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. the n-terminal amino ... | 2005 | 16109929 |
| lrua and lrub, novel lipoproteins of pathogenic leptospira interrogans associated with equine recurrent uveitis. | recurrent uveitis as a sequela to leptospira infection is the most common infectious cause of blindness and impaired vision of horses worldwide. leptospiral proteins expressed during prolonged survival in the eyes of horses with lesions of chronic uveitis were identified by screening a phage library of leptospira interrogans dna fragments with eye fluids from uveitic horses. inserts of reactive phages encoded several known leptospiral proteins and two novel putative lipoproteins, lrua and lrub. ... | 2005 | 16239521 |
| enzyme patterns in the study of leptospira. | an analysis of intracellular and extracellular leptospiral enzymes was made by use of starch-gel electrophoresis with natural and synthetic substrates. of 37 serotypes examined for extracellular exterase, all had activity of varying mobility and degree. all extracellular preparations were negative for catalase, phosphatase, and naphthylamidase. intracellularly, five serotypes were examined, including leptospira biflexa patoc i, l. biflexa waz, l. canicola moulton, l. icterohaemorrhagiae rga, and ... | 1967 | 16349726 |
| the scc spirochetal coiled-coil protein forms helix-like filaments and binds to nucleic acids generating nucleoprotein structures. | the analysis of the genome of leptospira spp., a group of bacteria of the phylum of spirochetes with several unique evolutionary and morphological features, has allowed the identification of a gene encoding a coiled-coil protein, called scc, which is completely unrelated to any other eukaryotic or prokaryotic protein. since coiled-coil proteins are often key elements of the cytoskeleton, we analyzed the protein scc, which is a 24-kda protein composed of a n-terminal coiled-coil domain, a proline ... | 2006 | 16385037 |
| mage: a microbial genome annotation system supported by synteny results. | magnifying genomes (mage) is a microbial genome annotation system based on a relational database containing information on bacterial genomes, as well as a web interface to achieve genome annotation projects. our system allows one to initiate the annotation of a genome at the early stage of the finishing phase. mage's main features are (i) integration of annotation data from bacterial genomes enhanced by a gene coding re-annotation process using accurate gene models, (ii) integration of results o ... | 2006 | 16407324 |
| mutations conferring aminoglycoside and spectinomycin resistance in borrelia burgdorferi. | we have isolated and characterized in vitro mutants of the lyme disease agent borrelia burgdorferi that are resistant to spectinomycin, kanamycin, gentamicin, or streptomycin, antibiotics that target the small subunit of the ribosome. 16s rrna mutations a1185g and c1186u, homologous to escherichia coli nucleotides a1191 and c1192, conferred >2,200-fold and 1,300-fold resistance to spectinomycin, respectively. a 16s rrna a1402g mutation, homologous to e. coli a1408, conferred >90-fold resistance ... | 2006 | 16436695 |
| leptospirosis in the tropics and in travelers. | leptospirosis, caused by spirochetes of the genus leptospira, has increasingly been recognized to affect travelers and residents in tropical settings. a zoonotic disease, leptospirosis is transmitted to humans through environmental surface waters contaminated by the urine of chronically infected mammals. outcome of infection varies, ranging from acute febrile illness (including self-resolving undifferentiated fever) to aseptic meningitis to a fulminant syndrome of jaundice, oliguric renal failur ... | 2006 | 16448601 |
| lfha, a novel factor h-binding protein of leptospira interrogans. | the early phase of leptospiral infection is characterized by the presence of live organisms in the blood. pathogenic leptospira interrogans is resistant to the alternative pathway of complement mediated-killing, while nonpathogenic members of the genus are not. consistent with that observation, only pathogenic leptospires bound factor h, a host fluid-phase regulator of the alternative complement pathway. ligand affinity blot analyses revealed that pathogenic l. interrogans produces at least two ... | 2006 | 16622202 |
| a newly identified leptospiral adhesin mediates attachment to laminin. | pathogenic leptospires have the ability to survive and disseminate to multiple organs after penetrating the host. several pathogens, including spirochetes, have been shown to express surface proteins that interact with the extracellular matrix (ecm). this adhesin-mediated binding process seems to be a crucial step in the colonization of host tissues. this study examined the interaction of putative leptospiral outer membrane proteins with laminin, collagen type i, collagen type iv, cellular fibro ... | 2006 | 16954400 |
| major role for feob in campylobacter jejuni ferrous iron acquisition, gut colonization, and intracellular survival. | to assess the importance of ferrous iron acquisition in campylobacter physiology and pathogenesis, we disrupted and characterized the fe2+ iron transporter, feob, in campylobacter jejuni nctc 11168, 81-176, and atcc 43431. the feob mutant was significantly affected in its ability to transport 55fe2+. it accumulated half the amount of iron than the wild-type strain during growth in an iron-containing medium. the intracellular iron of the feob mutant was localized in the periplasmic space versus t ... | 2006 | 16988218 |
| identification of potential virulence determinants by himar1 transposition of infectious borrelia burgdorferi b31. | lyme disease borrelia organisms are highly invasive spirochetes that alternate between vertebrate and arthropod hosts and that establish chronic infections and elicit inflammatory reactions in mammals. although progress has been made in the targeted mutagenesis of individual genes in infectious borrelia burgdorferi, the roles of the vast majority of gene products in pathogenesis remain unresolved. in this study, we examined the feasibility of using transposon mutagenesis to identify infectivity- ... | 2006 | 17015459 |
| species-specific identification of leptospiraceae by 16s rrna gene sequencing. | the genus leptospira is classified into 13 named species and 4 genomospecies based upon dna-dna reassociation studies. phenotypic tests are unable to distinguish between species of leptospira, and there is a need for a simplified molecular approach to the identification of leptospires. 16s rrna gene sequences are potentially useful for species identification of leptospira, but there are a large number of sequences of various lengths and quality in the public databases. 16s rrna gene sequences of ... | 2006 | 17021075 |
| application of multilocus variable-number tandem-repeat analysis for molecular typing of the agent of leptospirosis. | leptospirosis is a worldwide-distributed zoonosis, endemic in tropical areas. epidemiologic investigations of leptospirosis still rely on tedious serological identification tests. recently, molecular typing systems based on variable-number tandem-repeat (vntr) analysis have been described and have been used to identify leptospira interrogans strains. although l. interrogans is the most common leptospira species encountered in human infections around the world, other pathogenic species, such as l ... | 2006 | 17088367 |
| in silico and microarray-based genomic approaches to identifying potential vaccine candidates against leptospira interrogans. | currently available vaccines against leptospirosis are of low efficacy, have an unacceptable side-effect profile, do not induce long-term protection, and provide no cross-protection against the different serovars of pathogenic leptospira. the current major focus in leptospirosis research is to discover conserved protective antigens that may elicit longer-term protection against a broad range of leptospira. there is a need to screen vaccine candidate genes in the genome of leptospira interrogans. | 2006 | 17109759 |
| a genomic island of the pathogen leptospira interrogans serovar lai can excise from its chromosome. | an examination of the two leptospira interrogans genomes sequenced so far reveals few genetic differences, including an extra dna region, 54 kb in length, in l. interrogans serovar lai. this locus contains 103 predicted coding sequences that are absent from the genome of l. interrogans serovar copenhageni, of which only 20% had significant blastp hits in genbank. by analyzing the l. interrogans serovar lai genome by pulsed-field gel electrophoresis, we also found that this 54-kb dna fragment exi ... | 2007 | 17118975 |
| a genomic island of the pathogen leptospira interrogans serovar lai can excise from its chromosome. | an examination of the two leptospira interrogans genomes sequenced so far reveals few genetic differences, including an extra dna region, 54 kb in length, in l. interrogans serovar lai. this locus contains 103 predicted coding sequences that are absent from the genome of l. interrogans serovar copenhageni, of which only 20% had significant blastp hits in genbank. by analyzing the l. interrogans serovar lai genome by pulsed-field gel electrophoresis, we also found that this 54-kb dna fragment exi ... | 2007 | 17118975 |
| aminopeptidase activity of leptospira strains. | a total of 15 cultures of leptospira were examined for aminopeptidase activity using 22 aminoacyl-beta-naphthylamde substrates. activity was demonstrated in each of the cultures. extracts from serovars of leptospira interrogans preferentially hydrolysed the same range of substrates. the level of hydrolysis of the preferred substrates for the seven strains of l. interrogans was distinctively higher than that demonstrated for the six leptospira biflexa strains. extracts from cultures of leptospira ... | 1983 | 6842179 |
| interaction of leptospires with human polymorphonuclear neutrophils. | the role of the polymorphonuclear neutrophils (pmn) in defense against leptospires has not been adequately studied, in part, because of difficulty in quantitating pathogenic leptospires. by using pour plates to quantitate nonpathogenic leptospires and the most-probable-number procedure to quantitate the pathogenic leptospires, we examined the interactions of nonpathogenic leptospira biflexa and pathogenic leptospira interrogans serovar icterohemorrhagiae with human neutrophils. phase-contrast, s ... | 1984 | 6715045 |
| cloning of a gene required for tryptophan biosynthesis from leptospira biflexa serovar patoc into escherichia coli. | a clone bank, consisting of approx. 8100 colonies, has been created for the spirochete leptospira biflexa serovar patoc in escherichia coli using pbr322 as the vector. one of these clones contains the genetic information needed to complement a defect in the trpe gene of e. coli. the information resides on a 20.5-kb plasmid designated pyc1, which carries a 16-kb insert consisting of three hindiii fragments. it does not complement defects in other genes needed for the biosynthesis of tryptophan in ... | 1984 | 6376283 |
| purification of polysaccharide antigen from leptospira biflexa strain urawa. | serologically active polysaccharide was isolated from the cells of leptospira biflexa strain urawa and purified. the constituents of this polysaccharide were characterized, and its serological specificity was partially examined. | 1972 | 4637612 |
| use of immunoblotting as an alternative method for serogrouping leptospira. | leptospirosis is a worldwide zoonotic disease caused by a spirochaete bacterium, leptospira. serological detection of this micro-organism basically relies on a conventional microscopic agglutination test (mat), which has some limitations and disadvantages. in the present study, immunoblotting has been applied as an alternative method for differentiating serogroups and serovars of leptospires. leptospiral whole-cell lysates from a total of 26 serovars were subjected to immunoblotting using rabbit ... | 2007 | 17446278 |
| control of immunologically crossreactive leptospiral infection by administration of lipopolysaccharides from a nonpathogenic strain of leptospira biflexa. | in our previous paper (matsuo, k., isogai, e., and araki, y., carbohydr. res., 328: 517-524, 2000), antigenic polysaccharides obtained from the lipopolysaccharide (lps) fraction of a nonpathogenic leptospira, leptospira biflexa patoc patoc i, are shown to be broadly crossreactable with most rabbit antisera elicited by immunization with various pathogenic leptospires. the result led us to test a protective effect of the same lps in a hamster model system by heterologously challenging with a patho ... | 2000 | 11145268 |
| analysis of a ferric uptake regulator (fur) mutant of desulfovibrio vulgaris hildenborough. | previous experiments examining the transcriptional profile of the anaerobe desulfovibrio vulgaris demonstrated up-regulation of the fur regulon in response to various environmental stressors. to test the involvement of fur in the growth response and transcriptional regulation of d. vulgaris, a targeted mutagenesis procedure was used for deleting the fur gene. growth of the resulting deltafur mutant (jw707) was not affected by iron availability, but the mutant did exhibit increased sensitivity to ... | 2007 | 17630305 |
| use of locally isolated saprophytic leptospira strain for serological testing of human leptospirosis. | a saprophytic leptospira isolate recovered from tap water was utilized for serological testing. one hundred-twenty serum samples comprising 55 cases from puo/febrile jaundice and 65 samples from apparently healthy individuals were tested by mat and ha using this environmental saprophytic strain and the results compared with that of leptospira biflexa semaranga patoc, the standard saprophytic strain commonly employed for sero-diagnosis of leptospirosis. the mat data showed 96.4 per cent correlati ... | 2000 | 11407004 |
| iron-regulated proteins (irps) of leptospira biflexa serovar patoc strain patoc i. | iron deficiency has been shown to induce the expression of siderophores and their receptors, the iron-regulated membrane proteins in a number of bacterial systems. in this study, the response of leptospira biflexa serovar patoc strain patoc i to conditions of iron deprivation was assessed and the expression of siderophores and iron-regulated proteins is reported. | 2004 | 17642703 |
| identification of leptospiral isolates by bacterial restriction endonuclease analysis (brenda). | dna samples from 19 reference serovars belonging to 19 different serogroups of leptospira interrogans and two serovars belonging to leptospira biflexa were examined by bacterial restriction endonuclease analysis using ecor i and hae iii enzymes. all the serovars gave unique restriction patterns that differed from each other. dna from 10 local isolates digested with these enzymes produced patterns which on comparison with the standard patterns produced by reference strains could be identified to ... | 2001 | 17664802 |
| first evidence for a restriction-modification system in leptospira sp. | the le1 leptophage exhibited a host range restricted to the saprophytic leptospira biflexa [saint girons et al., res. microbiol. 141 (1990) 1131-1133] and mainly to the patoc 1 strain (hereafter called pfra) kept in the paris, france collection. results of titration of le1 lysates indicated the presence of a host-controlled modification and restriction system within pusa (patoc 1 strain maintained in the morgantown, wv, usa collection) that was absent in pfra. because genomic dna of pital (patoc ... | 2001 | 11470352 |
| identification of the hemolysis-associated protein 1 as a cross-protective immunogen of leptospira interrogans by adenovirus-mediated vaccination. | new vaccine strategies are needed for the prevention of leptospirosis, a widespread human and animal disease caused by pathogenic leptospires. our previous work determined that a protein leptospiral extract conferred cross-protection in a gerbil model of leptospirosis. the 31- to 34-kda protein fraction of leptospira interrogans serovar autumnalis was shown sufficient for this purpose. in the present study, n-terminal sequencing of a 32-kda fraction and southern blotting of genomic dna with corr ... | 2001 | 11598056 |
| natural rifampin resistance in treponema spp. correlates with presence of n531 in rpob rif cluster i. | | 2001 | 11702716 |
| novel 45-kilodalton leptospiral protein that is processed to a 31-kilodalton growth-phase-regulated peripheral membrane protein. | leptospiral protein antigens are of interest as potential virulence factors and as candidate serodiagnostic and immunoprotective reagents. we identified leptospiral protein antigens by screening a genomic expression library with serum from a rabbit hyperimmunized with formalin-killed, virulent leptospira kirschneri serovar grippotyphosa. genes expressing known outer membrane lipoproteins lipl32 and lipl41, the heat shock protein groel, and the alpha, beta, and beta' subunits of rna polymerase we ... | 2002 | 11748198 |
| peripheral blood mononuclear cell activation induced by leptospira interrogans glycolipoprotein. | leptospira interrogans glycolipoprotein (glp) has been implicated in pathological and functional derangement seen in leptospirosis. the goal of this study was to evaluate glp's ability to induce cellular activation, as assessed by cytokine production and expression of surface activation markers. glp extracted from either pathogenic l. interrogans serovar copenhageni or nonpathogenic leptospira biflexa serovar patoc (glpp) was used to stimulate peripheral blood mononuclear cell cultures from heal ... | 2002 | 11895929 |
| heme rescues a two-component system leptospira biflexa mutant. | heme is typically a major iron source for bacteria, but little is known about how bacteria of the leptospira genus, composed of both saprophytic and pathogenic species, access heme. | 2008 | 18234085 |
| genome sequence of the saprophyte leptospira biflexa provides insights into the evolution of leptospira and the pathogenesis of leptospirosis. | leptospira biflexa is a free-living saprophytic spirochete present in aquatic environments. we determined the genome sequence of l. biflexa, making it the first saprophytic leptospira to be sequenced. the l. biflexa genome has 3,590 protein-coding genes distributed across three circular replicons: the major 3,604 chromosome, a smaller 278-kb replicon that also carries essential genes, and a third 74-kb replicon. comparative sequence analysis provides evidence that l. biflexa is an excellent mode ... | 2008 | 18270594 |
| [alignment of dna sequences of ompl1 genes of insert fragment of recombinant plasmid, pdc38 of l. interrogans serovar lai and l. kirschneri]. | in a previous study a genomic library of l. interrogans serovar lai was constructed by the present authors. hybridization analysis (in situ, dot blot, southern blot) with the dna fragment containing ompl1 (alpha-32p labeled) was performed. one of positive clones designated pdc38, was analyzed with 9 restriction enzymes (ecori, bam hi, hind iii, bgl, xbali, scai, kpni, psti, dra ii). dna hybridization was applied to analyze the homology of the recombinant fragment of ompl1 with the dna of 18 stra ... | 1999 | 12212270 |
| household transmission of leptospira infection in urban slum communities. | leptospirosis, a spirochaetal zoonotic disease, is the cause of epidemics associated with high mortality in urban slum communities. infection with pathogenic leptospira occurs during environmental exposures and is traditionally associated with occupational risk activities. however, slum inhabitants reside in close proximity to environmental sources of contamination, suggesting that transmission during urban epidemics occurs in the household environment. | 2008 | 18357340 |
| identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of leptospira interrogans serovar lai. | dna microarray analysis was used to compare the differential gene expression profiles between leptospira interrogans serovar lai type strain 56601 and its corresponding attenuated strain ipav. a 22-kb genomic island covering a cluster of 34 genes (i.e., genes la0186 to la0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of ipav. reverse transcription-pcr assays proved that the gene cluster comprised five transcripts. gene annotation of ... | 2008 | 18362131 |
| in vitro susceptibilities of seven leptospira species to traditional and newer antibiotics. | human leptospirosis is generally treated with penicillin or doxycycline. we studied the susceptibilities of 11 serovars (seven species) of leptospira to 14 antibiotics. with the exception of chloramphenicol, all tested agents were at least as potent as penicillin and doxycycline, with the macrolide and ketolide drugs producing the lowest mics (and minimal bactericidal concentrations). | 2003 | 12878533 |
| lrua and lrub antibodies in sera of humans with leptospiral uveitis. | uveitis can be a serious complication of leptospirosis. previous studies indicated that the leptospiral lipoproteins lrua and lrub are expressed in the eyes of uveitic horses and that antibodies directed against those proteins show in vitro cross-reactivity with components of equine lens, ciliary body, and/or retina. we now demonstrate that sera from a significant proportion of humans who have leptospiral uveitis also contain antibodies against lrua and lrub. different categories of nonleptospir ... | 2008 | 18400972 |
| lsa21, a novel leptospiral protein binding adhesive matrix molecules and present during human infection. | it has been well documented over past decades that interaction of pathogens with the extracellular matrix (ecm) plays a primary role in host cell attachment and invasion. adherence to host tissues is mediated by surface-exposed proteins expressed by the microorganisms during infection. the mechanisms by which pathogenic leptospires invade and colonize the host remain poorly understood since few virulence factors contributing to the pathogenesis of the disease have been identified. whole-genome s ... | 2008 | 18445272 |
| borrelia burgdorferi vlse antigenic variation is not mediated by reca. | reca is a key protein linking genetic recombination to dna replication and repair in bacteria. previous functional characterization of borrelia burgdorferi reca indicated that the protein is mainly involved in genetic recombination rather than dna repair. genetic recombination may play a role in b. burgdorferi persistence by generation of antigenic variation. we report here the isolation of a reca null mutant in an infectious b. burgdorferi strain. comparison of the in vitro growth characteristi ... | 2008 | 18606826 |
| conservation of the s10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus leptospira. | s10-spc-alpha is a 17.5 kb cluster of 32 genes encoding ribosomal proteins. this locus has an unusual composition and organization in leptospira interrogans. we demonstrate the highly conserved nature of this region among diverse leptospira and show its utility as a phylogenetically informative region. comparative analyses were performed by pcr using primer sets covering the whole locus. correctly sized fragments were obtained by pcr from all l. interrogans strains tested for each primer set ind ... | 2008 | 18648538 |
| [homology study of leptospires in china with the ompl1 gene]. | southern hybridization analysis with the ompl1 gene was performed. the results of probing ecori-restricted genomic dna from 18 strains in china showed that the homology fragments of ompl1 gene were presented in 12 pathogenic leptospira strains: sero-group icterohaemorrhagiae (2 strains), canicola, ballum, pyrogenes, autumnalis, australis, pomona, grip-potyphosa, hebdomadis, bataviae, and sejroe, but they were not presented in the nonpathogenic leptospira biflexa strain patoc i, leptonema illini ... | 1995 | 8586385 |
| inducible siphoviruses in superficial and deep tissue isolates of propionibacterium acnes. | propionibacterium acnes is a commensal of human skin but is also known to be involved in certain diseases, such as acne vulgaris and infections of orthopaedic implants. treatment of these conditions is complicated by increased resistance to antibiotics and/or biofilm formation of p. acnes bacteria. p. acnes can be infected by bacteriophages, but until recently little has been known about these viruses. the aim of this study was to identify and characterize inducible phages from p. acnes on a gen ... | 2008 | 18702830 |
| genetic manipulation of leptospira biflexa. | the genus leptospira belongs to the order spirochaetales and is composed of both saprophytic and pathogenic members, such as leptospira biflexa and l. interrogans, respectively. a major factor contributing to our ignorance of spirochetal biology has been the lack of methods available for genetic analysis of these organisms. in recent years, an e. coli-l. biflexa shuttle vector has been constructed and a system for targeted mutagenesis and random transposon mutagenesis of the saprophyte l. biflex ... | 2007 | 18770609 |
| development and initial evaluation of an indirect enzyme-linked immunosorbent assay for the detection of leptospira interrogans serovar hardjo antibodies in bovine sera. | outer sheath antigen from leptospira interrogans serovar hardjo type hardjoprajitno and acetic acid extracted antigens from serovar hardjo types hardjoprajitno and hardjobovis were evaluated in an immunoassay for ability to detect hyperimmune rabbit serum to serovar hardjo. the degree of cross-reactivity with hyperimmune rabbit sera to l. interrogans serovars pomona, copenhageni, grippotyphosa, canicola and sejroe, and leptospira biflexa serovar patoc was also measured for each antigen. all of t ... | 1997 | 9342449 |
| a simple and rapid nested polymerase chain reaction-restriction fragment length polymorphism technique for differentiation of pathogenic and nonpathogenic leptospira spp. | a rapid and specific nested polymerase chain reaction-restriction fragment length polymorphism (pcr-rflp) has been developed to detect and differentiate pathogenic and nonpathogenic leptospira spp. leptospiral genomic dna was extracted from suspected human sera using an improved method of standard phenol-chloroform, and specific primers have been used to amplify 16s ribosomal rna from all pathogenic and nonpathogenic leptospira spp. the pcr products of all nonpathogenic species were digested wit ... | 2009 | 19097839 |
| major surface protein lipl32 is not required for either acute or chronic infection with leptospira interrogans. | leptospira interrogans is responsible for leptospirosis, a zoonosis of worldwide distribution. lipl32 is the major outer membrane protein of pathogenic leptospires, accounting for up to 75% of total outer membrane protein. in recent times lipl32 has become the focus of intense study because of its surface location, dominance in the host immune response, and conservation among pathogenic species. in this study, an lipl32 mutant was constructed in l. interrogans using transposon mutagenesis. the l ... | 2009 | 19103763 |
| major surface protein lipl32 is not required for either acute or chronic infection with leptospira interrogans. | leptospira interrogans is responsible for leptospirosis, a zoonosis of worldwide distribution. lipl32 is the major outer membrane protein of pathogenic leptospires, accounting for up to 75% of total outer membrane protein. in recent times lipl32 has become the focus of intense study because of its surface location, dominance in the host immune response, and conservation among pathogenic species. in this study, an lipl32 mutant was constructed in l. interrogans using transposon mutagenesis. the l ... | 2009 | 19103763 |
| genome sequence of the pathogenic intestinal spirochete brachyspira hyodysenteriae reveals adaptations to its lifestyle in the porcine large intestine. | brachyspira hyodysenteriae is an anaerobic intestinal spirochete that colonizes the large intestine of pigs and causes swine dysentery, a disease of significant economic importance. the genome sequence of b. hyodysenteriae strain wa1 was determined, making it the first representative of the genus brachyspira to be sequenced, and the seventeenth spirochete genome to be reported. the genome consisted of a circular 3,000,694 base pair (bp) chromosome, and a 35,940 bp circular plasmid that has not p ... | 2009 | 19262690 |
| rapid and accurate diagnosis of human intestinal spirochetosis by fluorescence in situ hybridization. | human intestinal spirochetosis (his) is associated with overgrowth of the large intestine by spirochetes of the genus brachyspira. the microbiological diagnosis of his is hampered by the fastidious nature and slow growth of brachyspira spp. in clinical practice, his is diagnosed histopathologically, and a significant portion of cases may be missed. fluorescence in situ hybridization (fish) is a molecular method that allows the visualization and identification of single bacteria within tissue sec ... | 2009 | 19279178 |
| the genome of bacillus subtilis bacteriophage spo1. | we report the genome sequence of bacillus subtilis phage spo1. the unique genome sequence is 132,562 bp long, and dna packaged in the virion (the chromosome) has a 13,185-bp terminal redundancy, giving a total of 145,747 bp. we predict 204 protein-coding genes and 5 trna genes, and we correlate these findings with the extensive body of investigations of spo1, including studies of the functions of the 61 previously defined genes and studies of the virion structure. sixty-nine percent of the encod ... | 2009 | 19285085 |
| identification of pathogenic leptospira genospecies by continuous monitoring of fluorogenic hybridization probes during rapid-cycle pcr. | partial sequences of 23s rrna gene pcr products from 23 strains of 6 pathogenic leptospira genospecies and from 8 strains of the saprophytic leptospira biflexa were determined. sequence analyses enabled leptospira genus-specific amplification primers and pathogen-specific fluorogenic adjacent hybridization probes to be designed and synthesized. a pcr protocol was developed in which changes in fluorescence emission resulting from specific annealing of fluorogenic adjacent hybridization probes to ... | 1997 | 9399509 |
| identification of leptospira biflexa by real-time homogeneous detection of rapid cycle pcr product. | sequence analysis of 16s rrna genes extracted from nucleic acids databases enabled the identification of a leptospira biflexa (l. biflexa) signature sequence, against which a reverse primer designated l613, was designed. this primer, when used in conjunction with a universal bacterial specific forward primer designated fd1, enabled the development of a lightcycler-based pcr protocol in which fluorescence emission due to binding of sybr green i dye to amplified products could be detected and moni ... | 1999 | 10076627 |
| international multicenter evaluation of the clinical utility of a dipstick assay for detection of leptospira-specific immunoglobulin m antibodies in human serum specimens. | we performed a multicenter evaluation of a robust and easily performed dipstick assay for the serodiagnosis of human leptospirosis. the assay is aimed at the detection of leptospira-specific immunoglobulin m (igm) antibodies. the study involved 2,665 serum samples collected from 2,057 patients with suspected leptospirosis in 12 countries on five continents with different levels of endemicity and different surveillance systems. the patients were grouped as laboratory-confirmed leptospirosis case ... | 1999 | 10449473 |
| borrelia burgdorferi resistance to a major skin antimicrobial peptide is independent of outer surface lipoprotein content. | we hypothesize a potential role for borrelia burgdorferi ospc in innate immune evasion at the initial stage of mammalian infection. we demonstrate that b. burgdorferi is resistant to high levels (>200 microg/ml) of cathelicidin and that this antimicrobial peptide exhibits limited binding to the spirochetal outer membrane, irrespective of ospc or other abundant surface lipoproteins. we conclude that the essential role of ospc is unrelated to resistance to this component of innate immunity. | 2009 | 19651916 |
| the use of leptospira biflexa patoc antigen in field investigations of leptospirosis. | hitherto the laboriousness of serological procedures for the laboratory diagnosis of leptospirosis has somewhat limited their usefulness. the authors of this paper report on a simple and sensitive genus-specific serological test for this disease that is within the capabilities of ordinary diagnostic laboratories. they describe the organization and results of a trial carried out in romania in 1962 of a complement-fixation (cf) test in leptospirosis in which an antigen derived from the patoc i str ... | 1964 | 14267745 |
| bioinformatics and functional analysis define four distinct groups of alkb dna-dioxygenases in bacteria. | the iron(ii)- and 2-oxoglutarate (2og)-dependent dioxygenase alkb from escherichia coli (ecalkb) repairs alkylation damage in dna by direct reversal. ecalkb substrates include methylated bases, such as 1-methyladenine (m(1)a) and 3-methylcytosine (m(3)c), as well as certain bulkier lesions, for example the exocyclic adduct 1,n(6)-ethenoadenine (epsilona). ecalkb is the only bacterial alkb protein characterized to date, and we here present an extensive bioinformatics and functional analysis of ba ... | 2009 | 19786499 |
| determination of the genus-specific antigens in outer membrane proteins from the strains of leptospira interrogans and leptospira biflexa with different virulence. | to determine the existence of genus-specific antigens in outer membrane proteins (omps) of leptospira with different virulence. | 2004 | 14994438 |
| direct chemical synthesis of the beta-mannans: linear and block syntheses of the alternating beta-(1-->3)-beta-(1-->4)-mannan common to rhodotorula glutinis, rhodotorula mucilaginosa, and leptospira biflexa. | two stereocontrolled syntheses of a methyl glycoside of an alternating beta-(1-->4)-beta-(1-->3)-mannohexaose, representative of the mannan from rhodotorula glutinis, rhodotorula mucilaginosa, and leptospira biflexa, are described. both syntheses employ a combination of 4,6-o-benzylidene- and 4,6-o-p-methoxybenzylidene acetal-protected donors to achieve stereocontrolled formation of the beta-mannoside linkage. the first synthesis is a linear one and proceeds with a high degree of stereocontrol t ... | 2004 | 15548005 |
| cohesion group approach for evolutionary analysis of aspartokinase, an enzyme that feeds a branched network of many biochemical pathways. | aspartokinase (ask) exists within a variable network that supports the synthesis of 9 amino acids and a number of other important metabolites. lysine, isoleucine, aromatic amino acids, and dipicolinate may arise from the ask network or from alternative pathways. ask proteins were subjected to cohesion group analysis, a methodology that sorts a given protein assemblage into groups in which evolutionary continuity is assured. two subhomology divisions, ask(alpha) and ask(beta), have been recognize ... | 2009 | 19946135 |
| evaluation of lig-based conventional and real time pcr for the detection of pathogenic leptospires. | leptospirosis is globally important infectious disease affecting almost all mammals. pathogenic leptospira encodes immunoglobulin-like protein (lig) that is found to express only during infection. we report the development of conventional and real time pcr assays targeting lig genes of leptospires for the early diagnosis of leptospirosis. sensitivity of the newly designed lig1/lig2 primers for conventional pcr was compared with previously published primers lp1/lp2 and g1/g2. g1/g2 primers amplif ... | 2004 | 15680212 |
| whole-genome analysis of leptospira interrogans to identify potential vaccine candidates against leptospirosis. | leptospirosis is an important global human and veterinary health problem. humans can be infected by exposure to chronically infected animals and their environment. an important focus of the current leptospiral research is the identification of outer membrane proteins (omps). due to their location, leptospiral omps are likely to be relevant in host-pathogen interactions, hence their potential ability to stimulate heterologous immunity. the existing whole-genome sequence of leptospira interrogans ... | 2005 | 15766783 |
| evidence that two atp-dependent (lon) proteases in borrelia burgdorferi serve different functions. | the canonical atp-dependent protease lon participates in an assortment of biological processes in bacteria, including the catalysis of damaged or senescent proteins and short-lived regulatory proteins. borrelia spirochetes are unusual in that they code for two putative atp-dependent lon homologs, lon-1 and lon-2. borrelia burgdorferi, the etiologic agent of lyme disease, is transmitted through the blood feeding of ixodes ticks. previous work in our laboratory reported that b. burgdorferi lon-1 i ... | 2009 | 19956677 |
| use of rpsl as a counterselectable marker in borrelia burgdorferi. | we have demonstrated that rpsl, encoding the s12 protein of the small ribosomal subunit, can be used as a counterselectable marker in borrelia burgdorferi, the causative agent of lyme disease. mutations in rpsl confer streptomycin resistance. streptomycin susceptibility is dominant in an rpsl merodiploid, and streptomycin selects for the loss of wild-type rpsl carried in trans. this is the first description of a counterselectable marker in b. burgdorferi. | 2010 | 19966024 |
| use of rpsl as a counterselectable marker in borrelia burgdorferi. | we have demonstrated that rpsl, encoding the s12 protein of the small ribosomal subunit, can be used as a counterselectable marker in borrelia burgdorferi, the causative agent of lyme disease. mutations in rpsl confer streptomycin resistance. streptomycin susceptibility is dominant in an rpsl merodiploid, and streptomycin selects for the loss of wild-type rpsl carried in trans. this is the first description of a counterselectable marker in b. burgdorferi. | 2010 | 19966024 |
| a highly coordinated cell wall degradation machine governs spore morphogenesis in bacillus subtilis. | how proteins catalyze morphogenesis is an outstanding question in developmental biology. in bacteria, morphogenesis is intimately linked to remodeling the cell wall exoskeleton. here, we investigate the mechanisms by which the mother cell engulfs the prospective spore during sporulation in bacillus subtilis. a membrane-anchored protein complex containing two cell wall hydrolases plays a central role in this morphological process. we demonstrate that one of the proteins (spoiip) has both amidase ... | 2010 | 20159959 |
| a comprehensive survey on isoleucine biosynthesis pathways in seven epidemic leptospira interrogans reference strains of china. | previous studies have indicated that different species of leptospira synthesize isoleucine via either pyruvate and/or threonine pathways. seven epidemic leptospira interrogans reference strains from china belonging to different serovars, together with three saprophytic strains of leptospira biflexa and leptospira meyeri, were analysed. the isoleucine biosynthesis properties were studied firstly by measuring the key enzymes of the two pathways, citramalate synthase (cima, ce4.1.3.-) and threonine ... | 2007 | 17227461 |
| response of leptospira interrogans to physiologic osmolarity: relevance in signaling the environment-to-host transition. | transmission of pathogenic leptospira between mammalian hosts usually involves dissemination via soil or water contaminated by the urine of carrier animals. the ability of leptospira to adapt to the diverse conditions found inside and outside the host is reflected in its relatively large genome size and high percentage of signal transduction genes. an exception is leptospira borgpetersenii serovar hardjo, which is transmitted by direct contact and appears to have lost genes necessary for surviva ... | 2007 | 17371863 |
| the complete genome sequence of the pathogenic intestinal spirochete brachyspira pilosicoli and comparison with other brachyspira genomes. | the anaerobic spirochete brachyspira pilosicoli colonizes the large intestine of various species of birds and mammals, including humans. it causes "intestinal spirochetosis", a condition characterized by mild colitis, diarrhea and reduced growth. this study aimed to sequence and analyse the bacterial genome to investigate the genetic basis of its specialized ecology and virulence. | 2010 | 20625514 |
| deriving enzymatic and taxonomic signatures of metagenomes from short read data. | we propose a method for deriving enzymatic signatures from short read metagenomic data of unknown species. the short read data are converted to six pseudo-peptide candidates. we search for occurrences of specific peptides (sps) on the latter. sps are peptides that are indicative of enzymatic function as defined by the enzyme commission (ec) nomenclature. the number of sp hits on an ensemble of short reads is counted and then converted to estimates of numbers of enzymatic genes associated with di ... | 2010 | 20649951 |
| obstacles of multiplex real-time pcr for bacterial 16s rdna: primer specifity and dna decontamination of taq polymerase. | background: the detection of a broad range of bacteria by pcr is applied for the screening of blood and blood products with special attention to platelet concentrates. for practical use it is desirable that detection systems include gram-positive, gram-negative and non-gram-stainable bacteria. it is quite challenging to achieve high sensitivity along with a clear negative control with pcr reagents, because especially taq polymerase is contaminated with traces of bacterial dna. methods: bacterial ... | 2010 | 20737013 |
| transcriptional response of leptospira interrogans to iron limitation and characterization of a perr homolog. | leptospirosis is a globally significant zoonosis caused by leptospira spp. iron is essential for growth of most bacterial species. since iron availability is low in the host, pathogens have evolved complex iron acquisition mechanisms to survive and establish infection. in many bacteria, expression of iron uptake and storage proteins is regulated by fur. l. interrogans encodes four predicted fur homologs; we have constructed a mutation in one of these, la1857. we conducted microarray analysis to ... | 2010 | 20805337 |
| risk factors for clinical leptospirosis from western jamaica. | a retrospective, matched case-control study was conducted in jamaica's western regional health authority (wrha). forty-three individuals developing clinical leptospirosis between january 2005 and december 2007 (i.e., cases) were age and neighborhood matched to 89 controls. odds ratios (or) and associated 95% confidence intervals (cis) and the relative excess risk due to interaction (reri) were calculated. cases had increased odds of contact with rodents or 3.52, goats or 3.38, and being engaged ... | 2010 | 20810831 |