| [isolation of a new strain of eb virus with lytic and transforming properties]. | | 1985 | 3011288 |
| diffuse intestinal ulceration after marrow transplantation: a clinicopathologic study of 13 patients. | the cases of 13 allogeneic marrow transplant recipients who had undergone laparotomy for manifestations of severe enteritis were reviewed to determine the causes of the severe intestinal disease and to assess the relation between clinical, histologic, and microbiologic findings. laparotomies were performed a median of 63 days (range, 11 to 273 days) after transplantation for suspected peritonitis, intestinal obstruction, or bleeding. intestinal tissue was available from small bowel resections in ... | 1986 | 3011641 |
| production of human monoclonal igg and igm antibodies with anti-d (rhesus) specificity using heterohybridomas. | heterohybridomas secreting human igm and igg anti-d antibodies of the rhesus blood group system have been established by fusion of ebv-transformed anti-d secreting cells with the mouse myeloma cells x63-ag8.653. both classes of antibody reacted with all rh-positive cells, some du cells but not with rh-negative or db cells. concentrations of both antibodies reached between 25 micrograms/ml and 50 micrograms/ml in the culture supernatants. the cell lines have been maintained in culture for 14 mont ... | 1986 | 3011653 |
| complement receptors (cr) and cytotoxic responses: monoclonal antibodies directed against cr1 and cr3 inhibit the generation of human allospecific and virus specific cytotoxic cells in vitro. | a variety of cellular immune responses involve complement factors which bind to specific receptors, and modulate or effect a specific reaction. monoclonal antibodies (mab) have been generated against complement receptors (cr) 1 and 3, which were utilized to investigate human allogeneic and epstein-barr virus specific cytotoxic cells in vitro. mab okm1, which binds to the c3bi cr (cr3), and mab m710, which binds to the c3b/4b cr (cr1), inhibited the generation of both allogeneic and virus specifi ... | 1986 | 3011915 |
| epstein-barr virus serology in bone marrow transplantations: a one-year retrospective study with detection of ebv igm-vca-specific antibodies. | the specific antibody response to epstein-barr virus (ebv) antigens of 41 bone marrow transplant recipients with leukemia or aplastic anemia was examined retrospectively by immunofluorescence test (if) over 1 year. we observed high titers (greater than 640) of igg-viral capsid antigen (vca) with emergence of igg-early antigen (ea) and frequent absence or low levels of epstein-barr nuclear antigen (ebna) antibodies. after absorption to remove rheumatoid factor (rf), five of the 41 recipients had ... | 1986 | 3011981 |
| attachment of antinuclear antibodies to nasopharyngeal carcinoma or other cells during preparation of biopsy imprints. | the presence of epstein-barr virus (ebv) genomes in nasopharyngeal and other carcinomas or burkitt's and other b-cell lymphomas can be established by the demonstration of viral nucleic acid sequences in dna extracts from biopsy specimens, the detection of ebv-associated nuclear antigen (ebna) in biopsy imprints, and the inhibition of leukocyte migration by tumor extracts. of these techniques, the detection of ebna-positive tumor cells can be performed most readily in the laboratory. this report ... | 1986 | 3012176 |
| chronic fatigue possibly related to epstein-barr virus--nevada. | | 1986 | 3012308 |
| epstein barr virus-specific immune defects in patients with persistent symptoms following infectious mononucleosis. | in a number of patients recovery from infectious mononucleosis (im) following primary epstein barr virus (ebv) infection, is complicated by the persistence of symptoms for months or years. normally recovery from infectious mononucleosis is associated with the development of ebv-specific antibodies and memory cytotoxic t-cells, which are present in the peripheral blood of all normal seropositive individuals. we studied four patients who had persistent symptoms for more than two years after infect ... | 1986 | 3012622 |
| [activation of latent infections caused by the epstein-barr virus in systemic lupus erythematosus]. | | 1986 | 3012745 |
| near-fatal coagulopathy associated with epstein-barr virus hepatitis. | | 1986 | 3012886 |
| the new world primates as animal models of glucocorticoid resistance. | many new world primate species have greatly increased plasma cortisol concentrations, decreased plasma cortisol binding globulin capacity and affinity, marked resistance of the hypothalamic-pituitary-adrenal axis to suppression by dexamethasone, and no biological evidence of glucocorticoid excess. these primates also have high levels of circulating progesterone, estrogen, mineralocorticoid, androgen and vitamin d. the glucocorticoid target tissues that have been examined (circulating mononuclear ... | 1986 | 3012975 |
| cimetidine, ranitidine, and epstein-barr virus infection. | | 1986 | 3013060 |
| transducing signals involved in the activation of resting tonsillar b cells. | | 1986 | 3013209 |
| [burkitt's disease. apropos of apparently surgical forms]. | | 1985 | 3013513 |
| b cell activation by the nontransforming p3hr-1 substrain of the epstein-barr virus (ebv). | the p3hr-1 substrain of epstein-barr virus does not transform b cells. this defect is known to be determined by the loss of the coding sequence for the nuclear antigen ebna-2. the virus can attach to and enter resting b cells. the initial events after ebv infection are reminiscent of those induced by polyclonal b cell activators. similar to the effect of these, p3hr-1 virus lowers membrane igd expression on b cells and abrogates the transient elevation of activation markers bb-1 and lb-1 induced ... | 1986 | 3013647 |
| increased incidence of iga antibodies to the epstein-barr virus-associated viral capsid antigen and early antigens in patients with chronic lymphocytic leukemia. | antibody titers to epstein-barr virus (ebv)-associated early antigens (ea) and the viral capsid antigen (vca) were determined by elisa on 263 sera obtained from healthy donors, patients with hodgkin's disease (hd), non-hodgkin lymphomas (nhl), infectious mononucleosis (im), burkitt's lymphoma (bl), and nasopharyngeal carcinoma (npc). as expected, most lymphoma patients showed markedly elevated anti-vca igg and anti-ea igg antibody titers. only one patient in the nhl group (n = 56) consisting of ... | 1986 | 3013785 |
| the vector homology problem in diagnostic nucleic acid hybridization of clinical specimens. | nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. the probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pbr322. we suspected that there was material homologous to pbr322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. if the presence of thi ... | 1986 | 3013928 |
| a prospective evaluation of patients with nasopharyngeal carcinoma: an overview. | one hundred and eighty-two patients in north america with nasopharyngeal carcinoma underwent initial and interval estimations of serum viral capsid antigen (vca) and early antigen (ea), and the sera were also titrated for antibody to the epstein-barr virus induced membrane antigen complex by using the antibody-dependent cellular cytotoxicity (adcc) assay. the serologic findings differentiated the world health organization (who) type 1 tumors (keratinizing squamous cell carcinomas) from the who t ... | 1986 | 3014165 |
| the ebv-hybridoma technique. | | 1986 | 3014265 |
| generation of human monoclonal antibodies by fusion of ebv-activated b cells to a human-mouse hybridoma. | | 1986 | 3014266 |
| in vitro immunization for the production of antigen-specific lymphocyte hybridomas. | | 1986 | 3014268 |
| preferential transcription of htlv-i ltr in cell-free extracts of human t cells producing htlv-i viral proteins. | the promoters of the adenovirus 2 major late gene, the mouse beta-globin gene, the mouse immunoglobulin vh gene and the ltr of the human t-lymphotropic retrovirus type i were tested for their transcription activities in cell-free extracts of four cell lines; hela, cess (epstein-barr virus-transformed human b cell line), mt-1 (htlv-i-infected human t cell line without viral protein synthesis), and mt-2 (htlv-i-infected human t cell line producing viral proteins). ltr was preferentially transcribe ... | 1986 | 3014437 |
| [etiopathogenesis of malignant tumors of the otorhinolaryngologic area]. | | 1985 | 3014638 |
| gamma ray-induced mutants as a tool for the production and characterisation of monoclonal antibodies against hla-alloantigens. | to simplify the screening procedure for murine monoclonal antibodies specific for polymorphic hla determinants, spleen cells from a mouse immunized with the human cell line bjab-b95.8.6 were fused with ns1 mouse myeloma cells, and hybridoma supernatants were screened for their reactivity on bjab-b95.8.6 and two gamma ray-induced hla-loss mutants of this line. the use of these hla-loss mutants allowed the rapid identification of two new allospecific moabs designated tu160 and tu161. serological a ... | 1986 | 3014680 |
| inactivation of the aids-causing retrovirus and other human viruses in antihemophilic plasma protein preparations by pasteurization. | heat treatment at 60 degrees c for 10 h in solution (pasteurization) was introduced into the manufacturing process of antihemophilic cryoprecipitate (ahc) and factor viii concentrates (f viii) to reduce the risk of transmission of hepatitis to hemophiliacs. since the acquired immunodeficiency syndrome (aids) may also be transmitted to hemophiliacs by antihemophilic plasma protein preparations, we have investigated inactivation of the aids virus htlv iii by pasteurization in ahc or f viii and inc ... | 1986 | 3014743 |
| the 1986 walter hubert lecture. recent studies on a vaccine to prevent eb virus-associated cancers. | epstein-barr (eb) virus was discovered in 1964 (epstein et al., 1964). in the decades since then an immense body of information has been accumulated on the virus and a great deal is now known about its general biological behaviour, its epidemiology, its molecular biology, the humoral and cellular immunological responses which it evokes, and about its relationship to human cancers. the fact that eb virus was thought from the outset to be a human tumour virus was no doubt responsible for the large ... | 1986 | 3015179 |
| gianotti-crosti syndrome: a study of 26 cases. | we have studied 26 patients presenting with a symmetrical papular or papulovesicular acrolocated eruption of more than 10 days duration. mean age at onset was 2 years (range 10 months to 5.75 years). lymphadenopathy was noted in eight cases, and hepatomegaly in one case. in 12 cases, histopathology and direct immunofluorescence were non-contributory. cytolytic hepatitis occurred in one case and was associated with hbs antigenemia. a history of recent immunization was given in two cases. there wa ... | 1986 | 3015187 |
| [enhanced transformation of human lymphocytes by chinese herbs]. | the enhancing effect of extracts from some chinese herbs on transformation of lymphocytes by epstein-barr (eb) virus was tested in soft agar system. daphne genkwa, wikstroemia chamaedaphne, wikstroemia indica, stellera chamaejasme and sparganium stoloniferum were found to activate early antigen (ea) of eb virus in raji cells and also enhance transformation of lymphocytes by eb virus. but some other herbs, such as abrus cantoniensis and bulbophyllum inconspicuum were not able to activate ea, henc ... | 1985 | 3015528 |
| demonstration of epstein-barr virus dna in a previously healthy boy with fulminant hepatic failure. | a previously healthy 9-year-old boy died from acute liver failure during an acute epstein-barr virus infection. epstein-barr virus dna could be demonstrated in the liver by southern blot--and by in situ hybridization techniques. the identification of the virus in the liver suggests a causal relation between the epstein-barr virus and the acute massive liver cell necrosis. | 1986 | 3015629 |
| regulation of antibody production by an antigen-specific ebv-transformed b-lymphoblastoid cell line: effect of high-dose antigen and antigen-pulsed t cells. | a b-cell line (c1b2) secreting monoclonal igg antibody to influenza virus haemagglutinin (ha3) was obtained by epstein-barr virus (ebv) transformation of human tonsillar b cells activated in vitro to influenza a/x31. antibody secretion by c1b2 was completely inhibited by purified ha3 at concentrations above 100 ng/ml. by contrast, high doses of ha3 had no effect on ebv-transformed b-cell lines making antibody of unrelated specificity. inhibition of specific antibody secretion by ha3 continued fo ... | 1986 | 3015782 |
| epstein barr virus binding induces internalization of the c3d receptor: a novel immunotoxin delivery system. | epstein barr virus (ebv) infection of human b lymphocytes is initiated by selective binding of the virus to the c3d receptor (ebv/c3d receptor) on the cell surface and results in polyclonal proliferation of infected cells. in these studies we examined the fate of the ebv/c3d receptor during viral infection by using an immunotoxin made from a monoclonal antibody (hb5) reactive with the receptor and the potent toxin, gelonin. binding of the hb5-gelonin conjugate to the ebv/c3d receptor before ebv ... | 1986 | 3016095 |
| cytotoxicity of autologous epstein-barr virus-transformed cells mediated by interleukin-2 dependent, long-term t cell cultures is augmented by beta, but not alpha, recombinant interferon. | the immunomodulatory effect of two highly purified recombinant human interferons (ifn) on t cell-mediated cytotoxicity of autologous epstein-barr virus-transformed b cells (ebv-lcl) was assessed. interferon beta ser, but not alpha 76, potentiated the destruction mediated by interleukin-2 (il-2) dependent, long-term t cell cultures. the degree of potentiation of specific cytotoxicity was dependent on the concentration of the exogenously added ifn beta ser. in contrast to the potentiation of t cel ... | 1986 | 3016203 |
| the properties and sequence of glycoprotein h of herpes simplex virus type 1. | the map position of the coding sequence of glycoprotein h of herpes simplex virus type 1 was determined by marker transfer studies in which dna fragments cloned from a virus resistant to neutralisation by an anti-gh monoclonal antibody were used to transfer antibody resistance to wild type virus dna following cotransfection. the gh coding sequence was mapped to the bglii "m" fragment of hsv-1 dna (map coordinates 0.27-0.312), confirming the map position previously determined by intertypic recomb ... | 1986 | 3016991 |
| ultrastructural features of epithelial cell degeneration in rectal crypts of patients with aids. | focal crypt epithelial cell degeneration (apoptosis) of the rectum is a characteristic pathologic feature in aids. the presence of apoptosis usually implies cell-mediated cytolysis, which would be an unexpected finding in this disease. we investigated the ultrastructural features of apoptosis in rectal biopsies from five aids patients (three homosexual males and two females with i.v. drug abuse), three heterosexual controls, and two homosexual male controls. apoptosis was found in all aids patie ... | 1986 | 3017136 |
| epstein-barr virus dna in lymphocytes of patients with the virus-associated hemophagocytic syndrome. | the virus-associated hemophagocytic syndrome (vahs) is a histiocytic proliferative disorder with bone marrow and liver failure for which the connection with a specific virus is often tenuous. epstein-barr virus (ebv) is one candidate for the association, but serologic or culture confirmation may be lacking in a particular case. as a means of directly identifying the presence of ebv in patients' cells, molecular hybridization studies were carried out using a radioactively labeled viral dna segmen ... | 1986 | 3017142 |
| defective epstein-barr virus specific suppressor t cell function in progressive systemic sclerosis. | several immunoregulatory defects of epstein-barr virus (ebv) induced b cell activation have been described in patients with rheumatoid arthritis (ra), suggesting that ebv may have a role in the pathogenesis of ra. we assessed ebv specific t cell regulation in 20 patients with progressive systemic sclerosis (pss) and immune to ebv and in 10 control subjects also immune to ebv by comparing the secretion of igm into supernatants of 16 day cultures of b cells alone and cocultures of b and autologous ... | 1986 | 3017245 |
| vestibular neuronitis--serum and csf virus antibody titer. | the cerebrospinal fluid (csf) findings of patients with vestibular neuronitis were virologically evaluated and discussed in contrast to those of herpes zoster. csf samples obtained from seven patients with vestibular neuronitis, aged 28 to 55 years, were examined. the results were as follows: the csf protein level in the vestibular neuronitis showed the peculiar change; i.e. its level was normal at the onset period of vertigo, but it rose to abnormal levels mostly in the period of two weeks, whi ... | 1986 | 3017280 |
| modulation of epstein-barr virus-induced b-cell activation by concanavalin a. | direct addition of the t-cell mitogen, concanavalin a (con a), to cultures of epstein-barr virus (ebv)-stimulated peripheral blood mononuclear cells (pbmc) resulted in a dose-dependent inhibition of immunoglobulin m (igm) secreted in the supernatant, as measured by an enzyme-linked immunosorbent assay. furthermore, con a inhibited igm secretion of isolated t-depleted cells stimulated with ebv, and both the proliferation and igm secretion of ebv-driven lymphoblastoid cell lines. t-enriched cells, ... | 1985 | 3017572 |
| disturbance of the epstein-barr virus-host balance in rheumatoid arthritis patients: a quantitative study. | rheumatoid arthritis (ra), seronegative spondyloarthropathy (sa) and osteoarthritis (oa) patients receiving no steroid or disease-modifying therapy have been monitored, along with healthy controls, for their prevailing level of epstein-barr virus (ebv) infection using four independent indices of the ebv-host balance, levels of virus shedding in throat washings as measured by a cord-blood transformation assay of improved sensitivity, frequency of virus-infected b cells in the circulating blood as ... | 1986 | 3017620 |
| [correlation between nasopharyngeal carcinoma (npc) and hla in hunan province]. | 24 patients with npc and 49 normal individuals in hunan province were typed for their hla-a and -b antigens. the results showed that the antigen frequencies of hla-a1 and hla-bw63 were significantly higher in npc patient group than in the normal group (p = 0.0098 and p = 0.0028, respectively) and the antigen frequency of hla-a11 was significantly lower in npc patient group than in the normal group (p = 0.0075). in addition, the joint occurrence of a2 and b17 was increased in npc patient group (p ... | 1986 | 3017660 |
| a routine method for the establishment of permanent growing lymphoblastoid cell lines. | permanent lymphoblastoid cell lines are of great practical value in human clinical and experimental genetics. a detailed protocol for routine use is given for the establishment of lymphoblastoid lines from peripheral blood using epstein-barr virus and the immunosuppressivum cyclosporin a. in addition, the biologic basis of this transformation system is briefly summarized. | 1986 | 3017841 |
| association of htlv-iii with epstein-barr virus infection and abnormalities of t lymphocytes in homosexual men. | homosexual men were studied for associations among human t-lymphotropic virus type iii (htlv-iii) infection, epstein-barr virus (ebv) infection, and t cell abnormalities. the presence of igg antibody to ebv capsid antigen and antibody to ebv early antigen was significantly associated with augmented counts of suppressor t cells in healthy htlv-iii-seronegative men. htlv-iii-seropositive asymptomatic subjects had significantly enhanced titers of antibody to ebv and lower ratios of helper to suppre ... | 1986 | 3018092 |
| promiscuous trans activation of gene expression by an epstein-barr virus-encoded early nuclear protein. | we identified an epstein-barr virus (ebv) gene product which functions in transient-expression assays as a nonspecific trans activator. in vero cells, cotransfection of the bglii j dna fragment of ebv together with recombinant constructs containing the bacterial chloramphenicol acetyltransferase (cat) gene gave up to a 100-fold increased expression of cat activity over that in cells transfected with the recombinant cat constructs alone. the bglii j fragment acted promiscuously, in that increased ... | 1986 | 3018281 |
| identification and mapping of epstein-barr virus early antigens and demonstration of a viral gene activator that functions in trans. | the bamhi m dna fragment of the epstein-barr virus (ebv) genome was inserted in two orientations into a simian virus 40-based expression vector, and the ebv-specific proteins produced in cos-7 monkey cells were examined. in one orientation, termed bamhi-m rightward reading frame 1 (bmrf1), a set of phosphoproteins ranging in size from 47,000 to 54,000 daltons was synthesized. these proteins reacted with monoclonal and polyclonal antisera, defining them as components of the ebv early antigen diff ... | 1986 | 3018282 |
| b cells from leukemic patients are relatively resistant to in-vitro ebv transformation. | samples of peripheral blood mononuclear cells (pbmc) from normal donors or from leukemic patients were used to obtain epstein-barr virus (ebv)-transformed lymphoblastoid cell lines (lcl). whereas the rate of transformation was around 85% with normal donors, it was only around 20% with leukemic patients. however no explanation for this resistance of b cells from leukemic patients to in-vitro ebv transformation could be found. indeed no correlation exists between this ebv resistance and the age, s ... | 1986 | 3018384 |
| a putative origin of replication of plasmids derived from epstein-barr virus is composed of two cis-acting components. | a genetic element of epstein-barr virus, orip, when present on recombinant plasmids allows those plasmids to replicate and to be maintained in cells that express the epstein-barr virus-encoded nuclear antigen ebna-1. here we define the dna sequences required for orip activity. two noncontiguous regions of orip are required in cis for activity. one consists of approximately 20 tandem, imperfect copies of a 30-base-pair (bp) sequence. the other required region, approximately 1,000 bp away, is at m ... | 1985 | 3018528 |
| defective regulation of epstein-barr virus infection in patients with aids or aids-related disorders. | | 1986 | 3018563 |
| the use of epstein-barr virus transformation for the establishment of class ii positive cord blood cells for use in analysis of maternal sera. | the use of epstein-barr virus transformed cord blood cells to detect maternal antibodies to neonatal class ii dr and dq antigens and to allotype the reacting cells is described. | 1986 | 3018958 |
| geographical prevalence of two types of epstein-barr virus. | the jijoye ebv strain is characterized by a substitution of 1.8 kb in the c-terminal part of the ebna 2 gene compared to b95-8 or m-aba virus. this made it possible to construct hybridization probes specific for m-aba (type a) and jijoye viruses (type b), which have been used to type the ebv genomes in 38 spontaneously established cell lines. type a is more prevalent being found in 31 of 38 cases; type b virus was found in five cell lines (jijoye, ly 67, qimr-gor, bl 16, and bl 29); and two cell ... | 1986 | 3019008 |
| [rational microanalysis technic in the detection of antibodies to htlv-iii, cmv and ebv with indirect immunofluorescence]. | | 1986 | 3019301 |
| demonstration of epstein-barr virus-specific dna polymerase in chemically induced raji cells and its antibody in serum from patients with nasopharyngeal carcinoma. | epstein-barr virus (ebv) has been found to be associated with nasopharyngeal carcinoma (npc), and antibodies with high frequency and titer to ebv proteins have been found in sera from npc patients. raji cells, an ebv genome-carrying nonproducer cell line, treated with 12-o-tetradecanoylphorbol-13-acetate and n-butyrate induced a unique ebv dna polymerase which has properties similar to the ebv dna polymerase induced by 12-o-tetradecanoylphorbol-13-acetate in p3hr-1 cells, an ebv producer cell li ... | 1986 | 3019519 |
| recurrent chromosome changes at 3p21 in epstein-barr virus-transformed cells derived from human prolymphocytic leukemia. | cytogenetic studies of epstein-barr virus-transformed lymphoblastoid cells obtained from a patient with prolymphocytic leukemia revealed the cells to contain recurrent chromosome aberrations involving band 3p21. the in vivo leukemic cells from which the cell lines originated contained a der(3)t(3;17?)(p21;q11?) and a der(13)t(13;3)(q34;p21), as well as numerical (-y, -8, and -17) and other structural [8p- and der(8)t(8;?)(q13?;?)] changes. the cells in established culture showed additional chrom ... | 1986 | 3019524 |
| differential recognition of tumor-derived and in vitro epstein-barr virus-transformed b-cell lines by fetal calf serum-specific t4-positive cytotoxic t-lymphocyte clones. | two interleukin-2 (il-2)-dependent cytotoxic t-cell clones were obtained by limiting dilution from a lymphocyte culture stimulated in vitro with the autologous epstein-barr virus-transformed lymphoblastoid cell line (lcl) in the presence of fetal calf serum (fcs). both clones uniformly had a t3+, t4+, dr+ phenotype and lysed autologous b blasts, the autologous lcl, and allogeneic b cell lines sharing major histocompatibility complex (mhc) class ii antigens. the cytotoxic function was triggered b ... | 1986 | 3019570 |
| presentation of candida albicans and purified protein derivative soluble antigens by epstein-barr virus-transformed human lymphoblastoid b-cell lines. | cells other than the macrophage can function as antigen-presenting cells (apcs). these class ii-bearing accessory cells include dendritic cells, epidermal langerhans cells, b cells, murine b-cell tumors, and human epstein-barr virus-transformed lymphoblastoid cell lines (ebv-lcl). we investigated the ability of ebv-lcl to present two soluble antigens, candida albicans and purified protein derivative of tuberculin (ppd). the ebv-lcl derived from b cells of two different individuals can present bo ... | 1986 | 3019572 |
| identification of an epstein-barr virus-coded thymidine kinase. | we have demonstrated the presence of an epstein-barr virus (ebv)-coded thymidine kinase (tk) by producing biochemically transformed, tk-positive mammalian cell lines using either microinjection of whole ebv virions or calcium phosphate-mediated transfection of the sali-b restriction endonuclease fragment of ebv dna. analysis of these cell lines showed that: (i) ebv dna was present in the cell lines, (ii) sequences from the sali-b restriction endonuclease fragment of ebv were expressed, (iii) a t ... | 1986 | 3019675 |
| high-level expression of the epstein-barr virus ebna1 protein in cv1 cells and human lymphoid cells using a sv40 late replacement vector. | to construct a recombinant plasmid designed to yield large amounts of the epstein-barr virus (ebv) nuclear antigen, ebna1, the ebv bamhi-k fragment (b95-8 strain) was inserted into an expression vector composed of sv40 and pbr322 dna. the vector replicates in both escherichia coli and eukaryotic cells. introduction of such a bamhi-k-containing vector into cv1 monkey cells (using deae-dextran, glycerol and chloroquine diphosphate) gave high yields of the correct size ebna1 protein in 40-50% of th ... | 1986 | 3019836 |
| identification of a cell-surface glycoprotein mediating cell adhesion in ebv-immortalized normal b cells. | phorbol ester treatment markedly enhanced aggregation of epstein-barr virus (ebv)-immortalized normal b cells. monoclonal antibody (mab) 60.3, recognizing a leukocyte common antigen, completely inhibited intracellular adhesion, whereas mabs reacting with leukocyte common antigen t200, c3b receptor, t-cell-associated antigen ta-i, c3d (ebv) receptor, brain-granulocyte/t-lymphocyte antigen, transferrin receptor, surface immunoglobulin, class-i or class-ii transplantation antigens or a b-cell-speci ... | 1986 | 3019901 |
| epstein-barr virus-related ultrastructural modifications of plasma membrane during b-cell transformation. | ultrastructural modifications are described in the plasma membrane of in vitro established human b cells. by the freeze-fracture technique, intramembrane particles (imps) are quantified in b lymphocytes following epstein-barr virus (ebv) transformation in vitro, and in b-lymphoma (burkitt-type) cells, either positive or negative for ebv genome. analysis shows an overall increase in imp density as compared to normal controls. differences are observed between the protoplasmic and exoplasmic faces ... | 1986 | 3019902 |
| epstein-barr virus infection and depression. | | 1986 | 3020010 |
| autoantibodies to alzheimer and normal brain structures from virus-transformed lymphocytes. | b-lymphocytes from two patients with alzheimer's disease and one healthy subject were transformed into lymphoblastoid cells by exposure to epstein-barr virus. in culture, more than 50% of these cells secreted sufficient igm or igg antibody (mainly igm) to allow immunohistochemical screening against cryostat sections of normal and alzheimer temporal cortex. more than 30% of the igm antibodies from each subject recognised brain components, namely: neurons, astrocytes, nuclei, nucleoli, and alzheim ... | 1986 | 3020088 |
| case records of the massachusetts general hospital. weekly clinicopathological exercises. case 42-1986. a 28-year-old man with a renal transplant and recent disorientation. | | 1986 | 3020405 |
| epstein-barr virus mrnas produced by alternative splicing. | the structure of epstein-barr virus mrnas transcribed in b95-8 cells has been studied by cdna cloning and sequencing. we present here the analysis of four cdnas. the corresponding mrnas are probably transcribed from a single promoter located in the us region. they are produced by alternative splicing of exons transcribed from the us, ir and ul regions. the exons are spread over 100 kbp. the exons from the ir region constitute a unit which is repeated several times. the cdnas share the exons from ... | 1986 | 3020506 |
| mystery disease at lake tahoe challenges virologists and clinicians. | | 1986 | 3020689 |
| interleukin 1 alpha mrna in virus-transformed t and b cells. | il-1 alpha cdna clone was isolated from a t cell line infected by the human t lymphotropic retrovirus type-i (htlv-i/atlv). we found significant amounts of mrna hybridizing to il-1 alpha cdna not only in htlv-i-transformed t cells but also in epstein-barr virus-transformed b cells. a part of il-2 receptor inducing activity in adult t cell leukemia (atl) cell line seems to be due to il-1 alpha. | 1986 | 3021130 |
| treatment of chronic epstein-barr virus disease with h2 blockers. | | 1986 | 3021713 |
| the selection and characterization of human monoclonal antibodies to human cytomegalovirus. | this communication describes the application of epstein-barr virus lymphocyte transformation technology to the production of human monoclonal antibodies specific for human cytomegalovirus. a group of such igg antibodies have been characterized in terms of subclass, light-chain composition, specificity for particular viral proteins and neutralizing capacity. these results have shown that the production of antibodies by transformed lymphocytes is representative of the in vivo human immune response ... | 1986 | 3021800 |
| kaposi's sarcoma and htlv-iii: a study in nigerian adult males. | sera from 37 adult nigerian men with kaposi's sarcoma (ks), 30 contemporaneous controls bearing primary cell carcinoma of the liver (pcl), and 150 healthy non-tumour-bearing negative controls were tested for antibody to human t-cell lymphotropic virus type iii/lymphadenopathy associated virus (htlv-iii/lav) by enzyme-linked immunosorbent assays (elisa). certain immunocellular functions were also measured: the chemotactic locomotion of peripheral blood monocytes towards casein, delayed-type cutan ... | 1986 | 3021963 |
| detection by monoclonal antibodies of an early membrane protein induced by epstein-barr virus. | two monoclonal antibodies, e8b3 and e8d2, were raised against epstein-barr virus (ebv)-producing cells and were shown to immunoprecipitate a protein with an approximate molecular weight of 105,000 (p105). the protein was detectable only in ebv-containing cells which were supporting the virus lytic cycle, and its synthesis increased after cells were induced with phorbol esters. the molecule was radiolabeled and immunoprecipitated from virus-producing cells that had been extrinsically labeled with ... | 1986 | 3021971 |
| [monoclonal antibody against human hla class ii antigens. i. analysis of sero-reactive patterns]. | | 1986 | 3022023 |
| monoclonal antibody to the epstein-barr virus receptor induces human b lymphocyte activation and differentiation. | | 1985 | 3022444 |
| inhibition of epstein-barr virus infection in vitro by recombinant human interferons alpha and gamma. | the inhibitory effects of pure recombinant human interferons alpha a and gamma (reifn-alpha a and -gamma) on epstein-barr virus (ebv) infection of a human ebv-negative b cell line, bjab, and of normal adult b lymphocytes were studied. with pretreatment for 24 h, both types of reifns were effective in suppressing the production of ebv specific nuclear antigen (ebna-1) in bjab cells 24 h after ebv-infection, as determined by the immunoblotting technique. reifn-alpha a was, however, a much more pot ... | 1986 | 3022498 |
| the structure of the termini of the epstein-barr virus as a marker of clonal cellular proliferation. | the linear virion form of epstein-barr virus (ebv) dna has variable numbers of direct tandem 500 bp repeats at each terminus. the terminal restriction endonuclease fragments and the fused terminal fragments in the intracellular episomal form are heterogeneous in size, and vary by increments of 500 bp. the structure of the termini of ebv in carcinomas of the nasopharynx and the parotid gland was compared with the ebv termini in monoclonal and polyclonal tissues or cell lines. a single band repres ... | 1986 | 3022942 |
| genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus dna polymerase gene. | the human cytomegalovirus (hcmv)-induced dna polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. to identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (hsv-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced dna polymerases to the hcmv dna polymerase. a cosmid and plasmid library of the entire hcmv genome was screened with the bamhi q fragment ... | 1987 | 3023689 |
| stimulatory and inhibitory influences of human immunodeficiency virus on normal b lymphocytes. | b-lymphocyte dysfunction is a characteristic feature of the acquired immunodeficiency syndrome (aids) and of the aids-related complex. the aim of the present study was to further examine the influences exercised by the human immunodeficiency virus (hiv; formerly called human t-lymphotropic virus type iii or lymphadenopathy-associated virus, htlv-iii/lav) on normal human b lymphocytes. an unfractionated protein preparation, made from hiv purified by density gradient centrifugation, was previously ... | 1986 | 3024167 |
| serum antibodies to epstein-barr virus in patients with major depressive disorder. | to determine whether major depressive disorder might be associated with serologic evidence for a chronic active epstein-barr virus infection, viral-specific antibodies were measured in two separate groups of depressed patients (n=43) and in 46 appropriately matched healthy volunteers. no evidence that depression affects cellular immunity to the point that a persistent epstein-barr virus carrier state becomes activated was found. there was also no evidence that depression results from an unrecogn ... | 1986 | 3024514 |
| epstein-barr virus induced differentiation of early b-lineage cells. | | 1986 | 3024917 |
| ebv-activation of human b-lymphocytes. | | 1986 | 3024919 |
| ebv-negative and -positive burkitt cell lines variably express receptors for b-cell activation and differentiation. | the expression of receptors for proliferation and differentiation factors was analyzed by indirect immunofluorescence on 29 burkitt lymphoma (bl) cell lines previously classified into 3 groups on the basis of their reactivity with 8 monoclonal antibodies (mabs), including anti-calla, bl13 and tu1. bl13 and hb5 antibodies recognize different epitopes of the ebv/cr2 receptors. the determinant recognized by bl13 has been previously shown to be expressed only on cell lines of the first two groups, s ... | 1986 | 3025106 |
| reactive t cells in the immune repertoire: self-restricted and allo-restricted helper t-cell clones to epstein-barr virus. | helper t-cell clones were generated by stimulation with autologous or allogeneic lymphoblastoid b cells (b-lcl) transformed by the epstein-barr virus (ebv). some of these t-cell clones were allo-reactive and others were specific to ebv-transformed b-lcl. helper t-cell clones specific to ebv-transformed b-lcl were restricted either by class-i or by class-ii hla molecules of self. t-cell clones restricted by class-i hla molecules were stained by okt3 and okt8 monoclonal antibodies (mabs), whereas ... | 1987 | 3025108 |
| aids and antibodies to human immunodeficiency virus (hiv) in children and their families. | infection with human immunodeficiency virus (hiv, previously known as htlv-iii/lav) documented by a sensitive, specific immunoblotting (western blot) technique is described in 14 children with symptoms of aids or aids-related complex. for serodiagnosis of hiv infection, immunoblots blocked with milk were more sensitive than enzyme-linked immunosorbent assays or immunoblots blocked with gelatin. one or both parents of 13 of these children abused intravenous drugs. sixteen of 17 parents of the aff ... | 1987 | 3025309 |
| autoantibodies to neurofibrillary tangles and brain tissue in alzheimer's disease. establishment of epstein-barr virus-transformed antibody-producing cell lines. | multiple ebv-transformed b cell lines were established from five patients with a clinical diagnosis of alzheimer's disease (ad) and six age-matched controls. the supernatants were screened for antibody activity against sds-treated isolated neurofibrillary tangles (nft). reactive supernatants were identified from both the ad and control group. the frequencies of anti-nft antibody-secreting lines were 6.3 and 1.6% for the ad and the control groups, respectively. a proportion of these supernatants ... | 1987 | 3025332 |
| the frequency of non-a, non-b hepatitis in acute and chronic liver disease. | | 1985 | 3025569 |
| activated v-myc and v-ras oncogenes do not transform normal human lymphocytes. | activated v-myc (psv v-myc) and v-ha-ras (gt10) oncogenes were introduced into normal human lymphocytes, nih 3t3 fibroblasts, b-lymphoblastoid cells, and human epithelial cells, using a reconstituted sendai virus envelope-mediated gene transfer technique. efficient transfer of the plasmid in each cell type was demonstrable within 1.5 h of transfection by southern blotting of extrachromosomal dna extracts, which unexpectedly revealed that v-myc plasmid dna was unstable in normal lymphocytes but n ... | 1986 | 3025592 |
| antibody responses to epstein-barr virus-determined nuclear antigen (ebna)-1 and ebna-2 in acute and chronic epstein-barr virus infection. | five distinct epstein-barr virus (ebv)-determined nuclear antigens (ebna-1 to ebna-5) were recently identified. antibody responses to these antigens could conceivably differ, and thus prove of serodiagnostic value, in ebv-associated disease processes. as a first step, murine or human cell lines transfected with appropriate ebv dna fragments and stably expressing either ebna-1 or ebna-2 were used to determine the frequency and time of emergence of antibodies to these two antigens in the course of ... | 1987 | 3025881 |
| a monoclonal antibody detecting a novel antigen expressed in the htlv-i-infected cells. | a monoclonal antibody, ftf 148, was prepared by hybridizing murine myelomal cells (ns-1) and spleen cells of balb/c mice immunized with cultured cells derived from an adult t cell leukemia (atl) patient (kut-2 cells). this monoclonal antibody reacted with all of the human t cell leukemia virus i (htlv-i)-infected cell lines tested but did not react with other t cell lines derived from acute lymphocytic leukemia, epstein-barr virus-transformed b cell lines, or an erythroleukemic cell line. this m ... | 1987 | 3026522 |
| sixth sapporo cancer seminar. | | 1987 | 3026620 |
| differential activation of cytotoxic responses by burkitt's lymphoma (bl)-cell lines: relationship to the bl-cell surface phenotype. | epstein-barr (eb) virus-positive burkitt's lymphoma (bl) cell lines, recently established from tumour biopsies and displaying chromosomal translocations indicative of their malignant origin, can be classified into two broad sets: (i) lines growing predominantly as single cells/small clumps whose cell surface markers remain close to those of the original tumour cells, and (ii) lines whose growth pattern and cell surface markers have progressed closer to the more "lymphoblastoid" phenotype display ... | 1986 | 3026651 |
| progenitor and pre-b lymphocytes transformed by epstein-barr virus. | by rosetting with srbc coupled to rabbit-anti-human igm, the surface igm-negative cells of human fetal bone marrow were enriched, and subsequently infected and transformed by epstein-barr virus (ebv). single clones of the transformed cells were obtained. ninety percent of the resulting cell clones were surface-immunoglobulin-negative, and of 8 clones which were further studied, 5 lacked intracellular, cytoplasmic ig as measured by immunofluorescence. control cell clones derived from the same mat ... | 1987 | 3026970 |
| specific purification of monoclonal anti-dna antibodies from culture medium using a dna-coupled sepharose 4b affinity column. | human monoclonal antibodies against dna were specifically purified from the culture medium of an ebv transformant of sle patients' lymphocytes using a dna-coupled sepharose 4b affinity column. the monoclonal antibodies were eluted from the column with 5% dimethylsulfoxide (ph 10.7) containing 0.5 m nacl without loss of immunological activity and without contamination by other proteins. | 1987 | 3027184 |
| epstein-barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single dna-binding site. | a bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28k-ebna of epstein-barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic dna-binding site 5' gatctaggatagcatatgctaccccgggg 3' 3' atcctatcgtatacgatggggccccctag 5' in bacterial plasmids. the rate of the binding reaction is independent of the number of sites, but dependent upon the length of the dna containing the sites. these data are consistent with 28k-ebna loc ... | 1987 | 3027376 |
| posttranslational processing of an epstein-barr virus-encoded membrane protein expressed in cells transformed by epstein-barr virus. | the bamhi nhet fragment of the b958 strain of epstein-barr virus (ebv) encodes a membrane protein (bnlf-1) that is present in cells transformed by ebv. we made a hybrid protein in which a polypeptide sequence from the carboxyl-terminal part of bnlf-1 is fused to escherichia coli beta-galactosidase. this hybrid protein was used to immunize rabbits, and the resulting antiserum was purified by immunoaffinity chromatography. the antiserum was able to immunoprecipitate bnlf-1 from cell lysates. we fo ... | 1987 | 3027413 |
| b-cell maturation stages of burkitt's lymphoma cell lines according to epstein-barr virus status and type of chromosome translocation. | this study addressed the possible relationship between b-cell maturation stage of burkitt's lymphoma (bl) cell lines and epstein-barr virus (ebv) status, ethnic group, or type of chromosome translocation. fifty-seven cell lines obtained at the international agency for research on cancer from 51 patients were studied. cytogenetic analyses of 54 cells lines were available. cell size, surface immunoglobulins (sigs), cytoplasmic immunoglobulins (cigs), mouse red blood cell receptors, and reactivity ... | 1987 | 3027441 |
| a case of virus-associated haemophagocytic syndrome with hypoplastic anaemia. | a 4-year-old girl with virus-associated haemophagocytic syndrome is described, suffering from fever, jaundice, rectal bleeding and a loss of consciousness. severe pancytopenia was a prominent finding. the bone marrow biopsy showed hypocellularity, and bone marrow aspiration revealed proliferation of histiocytes containing many erythrocytes and thrombocytes. the patient recovered within several weeks of supportive therapy. viral studies demonstrated a recent infection with epstein-barr virus. | 1986 | 3028807 |
| early events in human b cell activation: metabolic pathways vary according to the first signal used. | the effects of the calcium channel blocking drug verapamil and of palmitoyl-carnitine (ptc), an inhibitor of protein-kinase c activity, on human b cell activation were measured. both verapamil and ptc inhibited the b cell proliferation induced by costimulation with anti-mu antibody and with 3 different growth factors: interleukin 2, 20-kda b cell growth factor and 50-kda b cell growth factor. both uridine and thymidine incorporation induced by costimulation with ionomycin and phorbol 12-myristat ... | 1986 | 3028818 |
| requirements for growth of epstein-barr virus-transformed cells at low cell densities. | we investigated the requirements for growth of epstein-barr virus-transformed cells at low cell densities in a homotypic system: only epstein-barr virus-transformed cells or their products were used to supply feeder activity. the cloning efficiency was increased markedly under conditions favouring close cell-to-cell contact: culture in round-bottomed rather than in flat-bottomed wells or the addition of irradiated epstein-barr virus-transformed cells. further enhancement was obtained by the addi ... | 1987 | 3028938 |
| identification of viral molecules recognized by influenza-specific human cytotoxic t lymphocytes. | human cytotoxic t cells specific for influenza a virus were tested for recognition of each of the ten influenza a virus proteins expressed in target cells using recombinant vaccinia viruses. they recognized the matrix m1, polymerase pb2, and nucleoproteins of influenza virus in association with mhc class i antigens. these internal viral proteins were seen by ctl in conjunction with one or more of the available dependent hla gene products. there was no detectable recognition of influenza virus su ... | 1987 | 3029268 |
| macaque monkey type d retrovirus replicates in vitro in a distinct subpopulation of b lymphocytes. | type d retroviruses have recently been shown to induce a wasting syndrome with associated lymphadenopathy, thymic atrophy and transient decreased peripheral blood lymphocyte blastogenic responsiveness in juvenile macaque monkeys. the replication in vitro of d/new england virus was assessed in various lymphocyte subpopulations to determine the possible pathogenesis of the immune dysfunction induced by this virus. while d/new england did not replicate in cultured t lymphocytes or induce any demons ... | 1987 | 3029291 |
| [characteristics of antibody production in tonsillar b-cells stimulated by epstein-barr virus (ebv) infection]. | | 1986 | 3029359 |
| herpes simplex virus, cytomegalovirus and epstein-barr virus antibody titres in sera from schizophrenic patients. | serum antibody titres to herpes-simplex (hsv-1, 2), cytomegalovirus (cmv), and epstein-barr virus capsid antigen (ebv-vca) were determined in 38 unrelated chronic schizophrenic patients, 11 nuclear families with at least 2 schizophrenic members, and 2 control groups. the distributions of antibody titres to herpes simplex and cytomegalovirus were similar among all groups. patients had higher anti-ebv-vca titres than non-hospitalized controls; however, hospital staff members in contact with the pa ... | 1986 | 3029788 |
| a restricted component of the epstein-barr virus early antigen complex is structurally related to ribonucleotide reductase. | the 85-kda polypeptide previously shown to be associated with the restricted (r) component of the ebv-induced early antigen (ea) complex was subjected to amino acid sequencing analysis. this was accomplished by cyanogen bromide cleavage and by separation of individual peptides by high-pressure liquid chromatography employing reversed-phase c18 column techniques. two of the isolated peptides, f11 and f13, were subjected to amino acid sequencing and both were found to have significant homology to ... | 1987 | 3029960 |