| newer directions in vaccine development and utilization. | the gradually evolving technology for vaccine development from jenner to recombinant genetics has provided both solid accomplishment and possible bases for prophylactic control of essentially all the infectious diseases of humans. the present review gives a prospective view of future vaccines and the new biotechnology as illustrated mainly in the examples of vaccines for control of hepatitis and of herpesvirus infections. although vaccines offer great benefit for human health, their use is restr ... | 1985 | 2982958 |
| use of enzyme-labeled antigen for the detection of immunoglobulin m and a antibody to herpes simplex virus in serum and cerebrospinal fluid. | a direct enzyme-linked immunosorbent assay (elisa that used peroxidase-labeled antigen) was developed for detection of igm and iga antibody to herpes simplex virus (hsv). the assay uses immuno-affinity-purified antihuman igm or iga antibody-coated wells of microtiter plates to separate igm or iga from other classes of antibody in serum or cerebrospinal fluid (csf). the presence of specific igm or iga is detected by subsequent, consecutive incubation with peroxidase-labeled antigen and substrate. ... | 1985 | 2983012 |
| long-term persistence of intrathecal virus-specific antibody responses after herpes simplex virus encephalitis. | paired sera and cerebrospinal fluids (csf) from nine surviving patients were collected 4.5 to 8 years after acute herpes simplex (hs) virus encephalitis. oligoclonal bands of igg were detected in the csf of all, and seven patients had an elevated csf igg index. antibodies to hs, varicella-zoster (vz), measles, and cytomegalo viruses were analysed by enzyme-linked immunosorbent assay (elisa) and by imprint immunofixation (iif) of specimens separated by electrophoresis and by thin-layer electrofoc ... | 1985 | 2983032 |
| structural analysis of the varicella-zoster virus gp98-gp62 complex: posttranslational addition of n-linked and o-linked oligosaccharide moieties. | varicella-zoster virus specifies the formation of several glycoproteins, including the preponderant gp98-gp62 glycoprotein complex in the outer membranes of virus-infected cells. these viral glycoproteins are recognized and precipitated by a previously described monoclonal antibody designated monoclone 3b3. when an immunoblot analysis was performed, only gp98 was reactive with monoclone 3b3 antibody; likewise, titration in the presence of increased concentrations of sodium dodecyl sulfate during ... | 1985 | 2983087 |
| human leukocytes kill varicella-zoster virus-infected fibroblasts in the presence of murine monoclonal antibodies to virus-specific glycoproteins. | seven murine monoclonal antibodies reacting with major glycoproteins of varicella-zoster virus were tested for functional activity in assays for antibody-dependent cellular cytotoxicity (adcc) and antibody-plus-complement-mediated lysis. human peripheral blood mononuclear cells killed varicella-zoster virus-infected fibroblasts in the presence of three of four monoclonal antibodies directed against gp98/62 and a single monoclonal antibody directed against gp118. neither of two monoclonal antibod ... | 1985 | 2983124 |
| zoster after exposure to varicella-zoster virus. | | 1985 | 2983129 |
| prophylactic oral acyclovir after renal transplantation. | in a double-blind, controlled study 35 herpes simplex virus (hsv) antibody-positive patients were randomized to receive oral acyclovir 200 mg x 4 daily or placebo for 28 days following renal transplantation. the incidence of herpes virus infection was compared in both groups by weekly virus demonstration/isolation testing from throat swabs and urine, and by serum antibody demonstration. none of the 18 patients allocated to acyclovir showed any signs of hsv or varicella zoster virus (vzv) infecti ... | 1985 | 2983461 |
| detection of viral and chlamydial antigens in open-lung biopsy specimens. | the recovery of viruses and chlamydia trachomatis from cell cultures and the detection of their antigens in impression smears prepared from open-lung biopsy (olb) specimens from immunocompromised adults were compared. touch impression smears were prepared on three slides, each containing eight wells. olb tissue was homogenized (stomacher) and inoculated into mrc-5, primary monkey kidney, and mccoy cell cultures. the direct and indirect immunofluorescence (if) tests were used to detect antigens t ... | 1985 | 2983526 |
| [varicella-zoster virus infection and the serologic determination of first-infection immunity]. | the infection rate of varicella-zoster virus was determined by three tests--complement fixation reaction, enzyme-immune test and indirect immunofluorescence. the results of the three tests largely agreed with one another in demonstrating that infection starts relatively late in young children, but reaches 60%-70% at the end of the first decade of life, 90% at the end of the second decade. results of both the enzyme immune and the indirect immunofluorescence tests indicated persistence of first-i ... | 1985 | 2983965 |
| [latent persistent infection caused by herpes simplex and varicella zoster virus]. | | 1985 | 2984134 |
| identification and typing of herpes simplex virus types 1 and 2 by monoclonal antibodies, sensitivity to the drug (e)-5-(2-bromovinyl)-2'-deoxyuridine, and restriction endonuclease analysis of viral dna. | with development of antiviral drugs, the need to identify a virus as to drug sensitivity becomes increasingly of importance. the compound (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) has been shown to be much more inhibitory to the replication of herpes simplex virus type 1 (hsv-1) and varicella-zoster virus as opposed to herpes simplex virus type 2 (hsv-2). we have typed over 170 isolates, using an immunofluorescent technique and sensitivity to the drug bvdu. these results were then compared to ... | 1985 | 2984324 |
| [clinical features and application of enzyme immunoassay in a herpes zoster meningitis series]. | | 1985 | 2984486 |
| long-term protective immunity of recipients of the oka strain of live varicella vaccine. | in spite of close contacts with patients who had varicella, 101 of 106 (95%) healthy and sick children (142 of 147 (97%) exposures of these children) who had received the oka strain of live varicella vaccine 7 to 10 years earlier were protected against the disease completely. among them, 37 of 38 (97%) vaccine recipients who received immunologic testing had varicella-zoster virus (vzv) antibodies tested by fluorescent antibody to membrane antigen method with a geometric mean titer of 1:9.3, and ... | 1985 | 2984636 |
| use of sonication for viral isolation. | a viral passage method using sonication to obtain cell-free virus was compared with the conventional viral cell culture passage technic. the recovery of 121 varicella zoster virus and cytomegalovirus isolates in human fibroblast vials from sonicated versus nonsonicated passage suspensions was studied. these fibroblast vials with cytopathic effect were identified using monoclonal fluorescent antisera. twenty-eight (29%) of cytomegalovirus isolates were recovered only from sonicated passages, and ... | 1985 | 2984919 |
| herpes simplex virus vaccines--where are we? | | 1985 | 2985314 |
| sensitive analytic elisas for subclass herpes virus igg. | the subclass distribution of antiviral antibodies to three herpes viruses was studied in a population of healthy blood donors. subclassification by monoclonal antibodies led to the identification of certain viral igg patterns. igg1 appeared to be formed in response to almost all cmv, hsv-1 and vzv infections. a higher frequency of virus-specific igg3 to cmv and hsv-1 suggested that these infections may be reactivated subclinically more often than vzv. the presence of cmv and vzv igg4 showed a fa ... | 1985 | 2985640 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| a clinicopathological and virological study of interstitial cystitis. | we studied 41 patients with chronic interstitial cystitis. histological examination of bladder lesions revealed mucosal ulceration, pancystitis and perineural inflammatory infiltrates. perineural cell infiltration is related probably to the characteristic symptoms of the disease. a search for a viral etiology, particularly herpes simplex virus, rendered negative results. | 1985 | 2985831 |
| herpes virus infection prevalence in regular haemodialysis patients--a comparative evaluation of complement fixation, indirect immunofluorescence and elisa tests. | the presence and titres of specific serum igg and igm antibodies to cytomegalovirus, herpes simplex virus and varicella-zoster virus were evaluated in 50 haemodialysis patients by complement fixation, immunofluorescence and elisa tests. a second serum sample was tested in 24 patients after four weeks. specific serum igg antibodies to epstein-barr virus were also measured by immunofluorescence in 26 patients. by immunofluorescence and elisa tests, the prevalence of cytomegalovirus, herpes simplex ... | 1985 | 2986100 |
| [herpes simplex and varicella-zona viral disorders. virologic review]. | | 1985 | 2986294 |
| [prevention and therapy of herpesvirus infections]. | the group of the human-pathogenic herpesviruses comprises five subgroups: herpes simplex virus type 1 (hsv-1), herpes simplex virus type 2 (hsv-2), varicella zoster virus (vzv), cytomegalovirus (cmv), and epstein-barr virus (ebv). primary infection with these ubiquitous herpesviruses usually occurs in childhood or during adolescence and frequently remains inapparent. however, it can also give rise to a variety of clinical pictures. important clinical manifestations of herpesvirus infections are ... | 1985 | 2986378 |
| [mechanisms of antiherpes drugs and drug resistant virus--effect of bvdu on varicella zoster virus replication]. | | 1985 | 2987573 |
| varicella encephalitis. | | 1985 | 2987592 |
| prevalence of antibodies to varicella zoster virus in healthy adults. | a serological study of immunity to varicella zoster was carried out using an enzyme-linked immunosorbent assay (elisa) in 244 healthy adult laboratory staff members. the overall immunity was 90%, with a progressive increase from 81% at 20-29 years to 100% at 60 years. approximately one-third of serologically immune individuals had no certain history of varicella. as the serological test is simple, rapid and reliable, screening for immunity should be carried out in at-risk individuals such as imm ... | 1985 | 2988141 |
| drugs recently released in belgium: ceftazidime, flecaïnide acetate and varicella oka-strain vaccine. | | 1985 | 2988245 |
| a case of herpes zoster associated encephalitis treated with acyclovir. | the case of a 67 year old male who developed severe encephalitis associated with herpes zoster ophthalmicus is described. encephalitis occurred in the absence of cutaneous dissemination and recovery followed treatment with acyclovir. | 1985 | 2988489 |
| 2'-nor-cgmp: a seco-cyclic nucleotide with powerful anti-dna-viral activity. | as part of our study of antiherpetic acyclonucleosides, we synthesized a cyclic gmp analog, 9-[(2-hydroxy-1,3,2-dioxaphosphorinan-5-yl)oxymethyl]guanine p-oxide, sodium salt (2'-nor-cgmp), and discovered its potent and broad spectrum anti-dna-viral activities. 2'-nor-cgmp inhibits the replication of many dna viruses, including herpes simplex virus, human cytomegalovirus, vaccinia, sv40, and adenovirus, but does not inhibit rna viruses. in plaque reduction studies this potent antiviral agent is a ... | 1985 | 2988534 |
| lysis of varicella zoster virus infected cells by lymphocytes from normal humans and immunosuppressed pediatric leukaemic patients. | varicella zoster virus (vzv) is an important cause of morbidity and mortality in immunosuppressed children but little is known of the cellular mechanisms of vzv immunity. we therefore developed a clinically applicable system to study responses to vzv infected cells. fresh blood mononuclear cells (mnc) from vzv immune donors killed vzv infected fibroblasts in an 18 h 51cr release assay. the specificity for virus was confirmed by cold target inhibition. an enhancing role for hla matching was demon ... | 1985 | 2988834 |
| delayed contralateral hemiplegia following herpes zoster ophthalmicus: should antiviral therapy be used? | we review clinical virological studies in the syndrome of delayed contralateral hemiplegia following herpes zoster ophthalmicus. virus could not be isolated from the cerebrospinal fluid (csf) of the present case, nor was antiviral antibody found in the csf. there appear to have been no reports of successful virus isolation from the csf although there are reports of antibody in the spinal fluid. thus the evidence for ongoing viral replication in the central nervous system is marginal. it is sugge ... | 1985 | 2988963 |
| varicella pneumonia in a bone marrow-transplanted, immune-reconstituted adenosine deaminase-deficient patient with severe combined immunodeficiency disease. | bone marrow transplantation provides an important modality for "enzyme replacement" and the immune reconstitution of patients with adenosine deaminase (ada) deficiency and severe combined immunodeficiency disease. we report a patient with ada deficiency who develops severe varicella pneumonia 6 years after successful bone marrow transplantation and immune reconstitution. marked abnormalities in t-cell mitogen responsiveness and pokeweed mitogen-induced polyclonal immunoglobulin synthesis occurre ... | 1985 | 2989324 |
| enzyme immunoassay versus plaque neutralization and other methods for determination of immune status to measles and varicella-zoster viruses and versus complement fixation for serodiagnosis of infections with those viruses. | results by an enzyme immunoassay method (eia) performed at one serum dilution and results by indirect immunofluorescence (ifa) and hemagglutination inhibition (hi) tests performed at step dilutions were correlated with results by a neutralization test (50% plaque neutralization [pn]) performed at step dilutions on single serum samples for serologic evaluation of immunity status to measles virus. pn results were taken as true indicators of immunity, and the other tests were evaluated on that basi ... | 1985 | 2989325 |
| the significance of specific iga antibodies in the serum in the early diagnosis of zoster. | | 1985 | 2989386 |
| intrathecal synthesis of igg antibodies to varicella-zoster virus in two cases of acute aseptic meningitis syndrome with no cutaneous lesions. | igg antibodies to varicella-zoster virus (vzv) were detected by indirect enzyme-immunoassay (eia) in csf of two patients with acute aseptic meningitis syndrome (aams) not associated with evident cutaneous lesion or recent history of zoster infection. their characteristic features and serological data are compared with those observed in two patients with aams and zoster cutaneous lesions, and in 13 patients with aams of unknown or other etiology. according to several indexes applied to assess the ... | 1985 | 2989422 |
| dna-binding proteins present in varicella-zoster virus-infected cells. | dna-binding proteins present in varicella-zoster virus-infected cells were identified by dna-cellulose chromatography of radioactively labeled cell extracts. seven virus-specific proteins, ranging in molecular weight from approximately 175,000 to 21,000, showed affinity for single- or double-stranded dna or both. these proteins include the varicella-zoster virus major capsid protein, a phosphorylated tegument protein, and a 125,000-molecular-weight species which may be analogous to the major dna ... | 1985 | 2989559 |
| varicella-zoster virus envelope glycoproteins: biochemical characterization and identification in clinical material. | varicella-zoster virus (vzv)-infected human foreskin fibroblasts synthesize viral glycoproteins of 125,000 (gp125), 118,000 (gp118), 92,000 (gp92), 63,000 (gp63), 59,000 (gp59), and 47,000 (gp47) da. in biochemical studies, all of these vzv glycoproteins were shown to contain asparagine-linked (n-linked) oligosaccharide chains and, except for gp125 and gp47, to be sialoglycoproteins. experiments with endo-beta-n-acetylglucosaminidase h (endo h) demonstrated that gp92 contained only complex type ... | 1985 | 2990103 |
| biotransformation and elimination of [2-14c]-1-(2-deoxy-2'-fluoro-beta-d -arabinofuranosyl)-5-iodocytosine in immunosuppressed patients with herpesvirus infections. | the metabolism of the drug [2-14c]-1-(2'-deoxy-2'-fluoro-beta-d -arabinofuranosyl)-5-iodocytosine (fiac), a potent inhibitor of herpesvirus replication, was studied in immunosuppressed patients with herpesvirus infections. fiac was administered intravenously by 15-min infusion and by mouth 24 h later to four patients at doses of 50 or 100 mg/m2. fiac was cleared from the plasma primarily by biotransformation in liver, kidney, and peripheral blood, with a terminal-phase half-life of 0.92 to 1.80 ... | 1985 | 2990323 |
| prevention and control of herpesvirus diseases. part 1. clinical and laboratory diagnosis and chemotherapy. a who meeting. | the herpesvirus diseases are increasing in importance as a public health problem throughout the world. members of the human herpesvirus family are global in distribution and infect 60-95% of the world's population, both in developed and in developing countries. illnesses associated with herpesviral infections vary from simple blisters to deadly encephalitis. in numerical terms, primary cytomegalovirus infection is a more common cause of congenitally acquired disease than primary rubella and resu ... | 1985 | 2990748 |
| antibody response to varicella-zoster virus surface glycoproteins in chickenpox and shingles. | varicella-zoster virus (vzv)-infected cell surface proteins were investigated using extrinsic radiolabelling of the cell surface, immunoprecipitation of detergent-solubilized extract of the same cell surface and fractionation of the immunoprecipitates using sds-page. glycosylated proteins were identified by their affinity for ricinus communis lectin. six glycoproteins with apparent mol. wt. of 170k, 105k, 93k, 81k, 53k and 45k were identified. the 170k glycoprotein was shown to be disulphide-lin ... | 1985 | 2991441 |
| affinity-purified varicella-zoster virus glycoprotein gp1/gp3 stimulates the production of neutralizing antibody. | varicella-zoster virus glycoprotein gp1/gp3 was purified by affinity chromatography using anti-gp1/gp3 monoclonal antibody 19.1 linked to cnbr-activated sepharose cl-4b. rabbits immunized with purified glycoprotein gp1/gp3 developed mono-specific neutralizing antibody. | 1985 | 2991442 |
| immunity to varicella-zoster virus in a normal adult population. | sera from 489 trainee nurses were examined, by the elisa technique, for the presence of varicella-zoster virus specific antibody; antibody was found in 446 (91.2%). in more detailed investigations of specific immunity in 33 healthy adults with a past history of chickenpox, 32 (97%) showed a positive lymphocyte transformation test, but only 11 out of 23 examined (48%) demonstrated mononuclear cell production of specific antibody in vitro; serum antibody was found in 30 (91%) by the elisa and in 2 ... | 1985 | 2991523 |
| antivirus antibodies in myasthenia gravis. | serum antibodies to influenza a, measles, rubella, cytomegalovirus, varicella zoster, herpes simplex type 1, and mumps have been assayed in 104 patients with myasthenia gravis, grouped according to clinical features plus thymus pathology, and compared with matched controls. no significant differences in incidence or antibody titer were detected. in 37 patients with recent onset of symptoms, the incidence of antibody to coxsackieviruses b1-b6 was less than in controls. juvenile-onset cases also d ... | 1985 | 2991819 |
| prevention of pertussis, haemophilus and varicella infections. | | 1985 | 2991868 |
| comparison of the in vitro and in vivo antiherpes virus activities of the acyclic nucleosides, acyclovir (zovirax) and 9-[(2-hydroxy-1-hydroxymethylethoxy)methyl]guanine (bwb759u). | the antiherpes virus activities of acyclovir and its close analogue 3-[(2-hydroxy-1-hydroxymethylethoxy)methyl]guanine (bwb759u) were compared in vitro and in vivo. the activities of both compounds against herpes simplex virus and varicella-zoster virus were similar in the majority of cell lines. however, in mouse-derived and hela cells, bsb759u was more effective than acyclovir against herpes simplex virus. mutants of herpes simplex virus deficient in thymidine kinase and resistant to acyclovir ... | 1985 | 2992369 |
| [comparative study of the prevalence of herpesviridae in an african population and a european population]. | we have looked for long-term antibodies to herpesviridae (hsv, vzv, cmv, ebv) in an african population (suburban area of dakar, senegal, west africa) and in a european population (urban area of bordeaux, france) in order to determine the prevalence of these viruses. the studied sera have been dispatched into 5 age-groups: 6 months to 4 years, 5 years to 9 years, 10 years to 14 years, 15 years to 44 years and greater than 45 years. we note that primary infection with herpesviridae occurs sooner i ... | 1985 | 2992828 |
| a simple method to detect intrathecal production of specific antimeasles antibodies in cerebrospinal fluid during subacute sclerosing panencephalitis. | the intrathecal production of antimeasles antibodies was studied using the enzyme-linked immunosorbent assay in eight specimens of serum and cerebrospinal fluid (csf) from patients with clinical signs of subacute sclerosing panencephalitis (sspe). the test was performed using a 1:5 dilution of csf and a 1:2000 dilution of serum (ratio 1:400) in order to nullify the physiological gradient of immunoglobulins across the blood brain barrier (bbb). this procedure allowed a rapid and accurate assessme ... | 1985 | 2992867 |
| evaluation of oral acyclovir therapy. | acyclovir is a specific antiviral agent. the triphosphate form inhibits viral dna replication by competing for incorporation into the replicating dna chain or by inhibiting viral dna polymerase. cells not infected with herpesvirus are generally unaffected. oral acyclovir inhibits most herpes simplex virus types 1 and 2, and varicella-zoster virus at concentrations used clinically. oral acyclovir has an average plasma half-life of three hours and is eliminated primarily by renal mechanisms. peak ... | 1985 | 2992899 |
| hemichorea associated with varicella-zoster reinfection and endocarditis. a case report. | a 20-year-old woman developed transient right-sided hemichoreatic movements after household exposure to varicella-zoster. some days before the appearance of involuntary movements a vesicular rash had occurred. about 6 months later an elevated igg serum titer against varicella virus was found and two-dimensional echocardiography showed signs of an endocarditis. during the following 2 months the igg value returned to within the normal range and the choreatic movements disappeared almost totally. t ... | 1985 | 2992991 |
| evaluation of a skin test for chicken pox. | results with a vzv skin test as a marker of past infection were compared with histories of chicken pox and specific antibody detected by elisa in 100 individuals--25 of whom were pediatric patients with malignant diseases. a negative or uncertain history was not reliable, neither were the skin test results among the oncology patients. however, among the normal individuals, the skin test when compared with the elisa had a sensitivity of 85%, a specificity of 100%, and a positive predictive value ... | 1985 | 2993188 |
| challenges in clinical virology (1958-1974): a personal viewpoint. | some of the main challenges i encountered in clinical virology from 1958-1974 are described. in the earlier years there were two main areas of exploration, namely, neurological and respiratory infections. later, tests for hepatitis and for rubella were developed and these diseases became of increasing importance. | 1985 | 2993426 |
| human monoclonal antibodies neutralizing varicella-zoster virus. | hybridomas secreting human monoclonal antibodies to varicella-zoster virus were produced by fusing b cells of a patient recovering from acute varicella infection with a human-mouse cell line. two hybrid lines have continued to secrete igg1, one with kappa and the other with lambda chains, for at least 12 months. each antibody neutralizes virus infectivity between 1-5 micrograms of partially purified immunoglobulin/ml, each shows a different pattern of immunofluorescent staining of virus-infected ... | 1985 | 2993433 |
| persistence of serum iga antibodies to herpes simplex, varicella-zoster, cytomegalovirus, and rubella virus detected by enzyme-linked immunosorbent assays. | enzyme-linked immunosorbent assays were used to detect igg and iga antibodies to herpes simplex virus (hsv), varicella-zoster virus (vzv), cytomegalovirus (cmv), and rubella virus in sera from 68 adult female gynaecological patients. of the patients who had virus-specific igg antibodies, the proportion who also had virus-specific iga was 98% for hsv, 75% for vzv, 73% for rubella virus, and 42% for cmv. iga antibodies to all four viruses were only found when specific igg antibodies were also dete ... | 1985 | 2993502 |
| inversion and circularization of the varicella-zoster virus genome. | the genome of varicella-zoster virus (vzv) is a linear, double-stranded molecule of dna composed of a long (l) region covalently linked to a short (s) region. the s region is capable of inverting relative to a fixed orientation of the l region, giving rise to two equimolar populations. we have investigated other forms of the vzv genome which are present in infected cells and packaged into nucleocapsids. that a small proportion of nucleocapsid dna molecules also possess inverted l regions has bee ... | 1985 | 2993650 |
| cross-reactivity between herpes simplex virus glycoprotein b and a 63,000-dalton varicella-zoster virus envelope glycoprotein. | cross-reactive monoclonal antibodies recognizing both herpes simplex virus (hsv) glycoprotein b and a major 63,000-dalton varicella-zoster virus (vzv) envelope glycoprotein were isolated and found to neutralize vzv infection in vitro. none of the other vzv glycoproteins was recognized by any polyclonal anti-hsv serum tested. these results demonstrate that hsv glycoprotein b and the 63,000-dalton vzv glycoprotein share antigenic epitopes and raise the possibility that these two proteins have a si ... | 1985 | 2993665 |
| errant processing and structural alterations of genomes present in a varicella-zoster virus vaccine. | five minority populations of aberrant, varicella-zoster virus (vzv)-derived genomes were identified among the encapsidated dnas obtained from the nuclear and cytoplasmic fractions of an in vitro infection initiated with a lyophilized sample of the biken vzv vaccine (strain oka). these were (i) vzv genomes, present within nuclear but not cytoplasmic viral capsids, which had been cleaved at a specific site within the short segment and which were, therefore, 3.15 megadaltons (approximately 4% of th ... | 1985 | 2993670 |
| effect of cyclosporin a on natural killer cells' response during viral infections. | in the this study the modification of lymphocyte subsets (t3, t4, t8) and natural killer (nk) cells in organ transplanted patients treated with cyclosporin a (cya) in the course of viral infection, have been analyzed. different subsets have been studied with the monoclonal antibody method and infective processes have been verified by serological data of seroconversion. our study has shown that cya at the adopted doses does not alter nk response to viral infection; in fact, in patients with seroc ... | 1985 | 2993825 |
| t lymphocyte responses to coxsackie b4 and mumps virus. i. influence of hla-dr restriction elements. | the proliferative t lymphocyte responses to coxsackie b4-, mumps- and varicella-zoster viral antigens were characterized. no significant difference in responsiveness was found between healthy individuals and patients with type 1 (insulin-dependent) diabetes mellitus. theophyllamine and verapamil decreased antigen-stimulated proliferation, whereas indomethacin in physiologic concentrations (1 microgram/ml) slightly increased proliferation. a major part of the response seemed to be restricted by h ... | 1985 | 2994251 |
| [sero-epidemiological results in subjects receiving a renal transplant]. | in this study a sero-epidemiological investigation on 127 renal allograft recipients was examined. in these patients, treated with cyclosporine a or conventional drugs, antibody response to various antigens (cytomegalovirus, herpes simplex, varicellae/zoster and mycoplasma pneumoniae) was examined. the data were compared to the healthy population and dialyzed subjects. | 1985 | 2994693 |
| serum and csf antibody titres to seven common viruses in schizophrenic patients. | csf and matched serum antibody titres to seven common viruses were measured in 20 chronic schizophrenic patients, and 17 of these were age and sex-matched with orthopaedic controls. ct scans were carried out in patients and age and sex-matched radiological controls. there was a trend for csf viral antibody titres (except cmv, hsv and vzv) to be decreased in the patients compared to controls, statistically significant for mumps and igg. the csf/serum ratios showed a reduction in the patients, com ... | 1985 | 2994792 |
| recombinant vaccinia viruses as live virus vectors for vaccine antigens: memorandum from a who/usphs/nibsc meeting. | a scientific workshop sponsored by the world health organization, the us public health service, and the national institute for biological standards and control, london, was held in bethesda, md, usa, on 13 and 14 november 1984 to review progress in research relevant to the development of genetically and antigenically modified vaccinia viruses as live vaccines for human and veterinary use. the meeting was followed by an informal consultation convened by who to consider the advantages and disadvan ... | 1985 | 2994898 |
| hla-dr3 and -dr4 control t-lymphocyte responses to mumps and coxsackie b4 virus: studies on patients with type 1 (insulin-dependent) diabetes and healthy subjects. | to study the relationships between the responses to viral antigens and the hla-dr3 and -dr4 associations in type 1 (insulin-dependent) diabetes mellitus, the frequency of t-lymphocyte proliferating in response to mumps, coxsackie b4 and varicella-zoster antigens was determined. a decreased frequency was found in t lymphocytes able to respond to mumps or coxsackie b4 when presented together with dr3, as compared with the frequency of t lymphocytes able to respond to these viruses together with ot ... | 1985 | 2995183 |
| studies on antiviral agents. ii. synthesis and in vitro antiviral activity on new kanamycin a derivatives having higher acyl group at n-1 position. | the synthesis and antiviral activity of 3''-n-trifluoroacetylkanamycin a derivatives (6) having higher acyl group at the n-1 position are described. on the basis of the structure-activity relationships between antiviral activity and alkyl chain length in an acyl group at the n-1 position, analogs (6f approximately i) having higher alkylcarbonyl group exhibited antiviral activity against not only hsv-i but also influenza virus. analogs (6q approximately v) having higher alkyloxycarbonyl group sho ... | 1985 | 2995293 |
| live attenuated varicella vaccine. | | 1985 | 2995509 |
| viral replication and immunologic responses in children naturally infected with varicella-zoster virus and in varicella vaccine recipients. | replication of varicella-zoster virus (vzv) and immunologic responses to vzv were examined by a sensitive culture technique for viral isolation and standard immunologic assays in children after close exposure to wild-type vzv or after inoculation with strain oka varicella vaccine. naturally infected children who developed clinical varicella had viremia between five days before and one day after clinical onset of disease, with the highest isolation rate one and two days before onset, and seroconv ... | 1985 | 2995510 |
| determination of immunity to varicella-zoster virus by means of an intradermal skin test. | an intradermal varicella skin test, utilizing heat-inactivated noninfectious viral antigen, was evaluated in 16 adults known to be immune or susceptible to varicella and in 109 adults with no history of varicella. the skin test was well tolerated, compared favorably with established methods of determining immunity to varicella, and accurately predicted which subjects would develop clinical varicella after close exposure. | 1985 | 2995511 |
| identification of the products of a varicella-zoster virus glycoprotein gene. | two of the genes identified from the previously published dna sequence of the us component of the varicella-zoster virus (vzv) genome were predicted to encode membrane proteins with polypeptide molecular weights of 39000 (39k) and 70k. a rabbit antiserum directed against a unique peptide containing the seven amino acid residues at the carboxy terminus of the 39k gene product specifically precipitated glycoproteins with apparent molecular weights of 55k and 45k from vzv-infected cells labelled wi ... | 1985 | 2995558 |
| live oka/merck varicella vaccine in healthy children. further clinical and laboratory assessment. | a clinical trial among 137 healthy children, ages 1 to 12 years, was conducted with four different doses (4,350, 870, 435, and 43 plaque-forming units [pfu]) of live oka/merck varicella vaccine to evaluate clinical reactions and selected laboratory parameters and to determine the minimum effective dose and induction time of antibody. the vaccine was well tolerated with no significant difference in the rate of reported symptoms by dose. the frequency of varicellalike rash was 3% (4/137); all rash ... | 1985 | 2995697 |
| varicella-zoster virus (vzv)-specific polypeptides detected in cells treated with metabolic inhibitors. | | 1985 | 2995771 |
| clinical manifestations of herpesvirus infections in pediatric renal transplant recipients. | we report our experience with 29 symptomatic herpesvirus infections occurring during the course of 87 pediatric transplant procedures performed over the 10-year period, 1973 to 1982. the yearly attack rate ranged from 0.05 to 0.40 case per cumulative patient years at risk. a greater proportion (9 of 14) of children who received more than 10 units of whole blood or packed red blood cells prior to transplantation developed a viral infection compared with those given 10 transfusions or fewer (8 of ... | 1985 | 2995934 |
| interaction between polymorphonuclear leukocytes and varicella-zoster virus-infected cells. | the addition of polymorphonuclear leukocytes (pmnl) to human fibroblasts infected with varicella-zoster virus (vzv) resulted in a reduced virus yield. the reduction was greater when antibodies specific for vzv were added to the system. addition of vzv-specific antibodies without pmnl also reduced virus yield, but a 10-fold greater concentration of antibodies was required to effect the same reduction. pmnl adhered to and formed rosettes around vzv-infected cells. by electron microscopy, it was po ... | 1985 | 2997077 |
| immunological cross-reactivities among three herpesviruses. | sixty adults were tested for humoral and cell-mediated immunity to varicella zoster virus (vzv), type 1 herpes simplex virus (hsv-1) and the human cytomegalovirus (cmv). since herpesviruses share common antigens, we compared results in these individuals to assess whether our tests gave false positives due to cross-reactions. of the 60, igg antibody to vzv, hsv-1, cmv tested by elisa was detected in 51 (85%), 34 (57%) and 20 (33%) respectively. all possible permutations of results were obtained a ... | 1985 | 2997331 |
| analysis of the genomic termini of tupaia herpesvirus dna by restriction mapping and nucleotide sequencing. | a recombinant plasmid harboring both genomic termini of tupaia herpesvirus (thv) dna was characterized by restriction enzyme analysis and by determination of the nucleotide sequence. a unique noti cleavage site was found that is located approximately 19 base pairs upstream of the thv terminal junction. thv dna fragments from virion dna were analyzed by using the same restriction enzymes as for the recombinant plasmid. the comparative fine mapping of virion thv dna revealed heterogeneous molecule ... | 1985 | 2997469 |
| transcription mapping of the varicella-zoster virus genome. | rna was isolated from varicella-zoster virus-infected flow 5000 cells (diploid fibroblasts) at late times after infection. with the use of overlapping dna probes representing all regions of the varicella-zoster genome, an extensive northern blot analysis of the rna was carried out. the analysis revealed at least 58 discrete transcripts ranging in size from approximately 0.8 to 6.5 kilobases. rnas were found to be homologous to all probes used except for those mapping at approximately map unit 0. ... | 1985 | 2997479 |
| [development of live varicella vaccine]. | | 1985 | 2997506 |
| [active immunization of children exposed to varicella infection in hospitals, using subcutaneous and intradermal attenuated live vaccine]. | | 1985 | 2997687 |
| [varicella and pregnancy]. | two recent cases of varicella in pregnant women are reported. a fortuitous review of fetal and neonatal risks is made that serves as a guide to therapy: elective abortion if the infection occurs early on in pregnancy; diagnosis of congenital varicella if it occurs some time after delivery; avoidance of delivery two days before and five days following eruption of rash by reason of the high neonatal mortality. | 1985 | 2997902 |
| processing of virus-specific glycoproteins of varicella zoster virus. | monoclonal antibodies to varicella zoster virus (vzv) glycoproteins were used to study the processing of three glycoproteins with molecular weights of 83k-94k (gp 2), 64k (gp 3), and 55k (gp 5). immunoprecipitation experiments performed with vzv-infected cells, pulse labeled with [3h]glucosamine in the presence of tunicamycin, suggest that o-linked oligosaccharide is present on the glycoprotein of gp 2. use of the enzyme endo-beta-n-acetylglucosaminidase h revealed that the fully processed form ... | 1985 | 2998004 |
| an algorithm for the control of nosocomial varicella-zoster virus infection. | inadvertent or uncontrolled introduction of varicella-zoster virus into the hospital environment occurs commonly and must be investigated in a systematic and efficient manner to minimize secondary spread to patients (particularly the immunocompromised) or hospital personnel. on the basis of a review of the literature and our practical experience with 11 such exposures to varicella-zoster virus during a 2-year period, we have developed a working algorithm for such investigations. index cases most ... | 1985 | 2998229 |
| [large necrotic ulcerations caused by varicella-zona virus in an immunosuppressed patient]. | | 1985 | 2998258 |
| psychologic modulation of the human immune response to varicella zoster. | psychoimmunology, the interrelationship between the brain/mind/psyche and the immune system, is now an established area of scientific research. based on prior investigations we hypothesized that an experienced meditator could affect her delayed hypersensitivity reaction by a psychological process. a single-case study design was employed in which the subject was skin tested weekly with varicella zoster skin test reagent. after baseline immunologic studies, she was able, as hypothesized, to signif ... | 1985 | 2998295 |
| determination of infection and immunity to varicella-zoster virus with an enzyme-linked immunosorbent assay. | | 1985 | 2999261 |
| [changes in the serum anti-virus antibody titer following open-heart surgery and the effect of human immune globulin]. | | 1985 | 2999491 |
| [chickenpox prevention in patients at risk with a special immunoglobulin]. | chickenpox, which normally is an innocuous disease in children, may cause serious sequelae in immunocompromised hosts. an open prospective study is presented, that comprised 96 of such patients. they were treated with 0,2 ml/kg varicella-zoster-immunoglobulin (vzig) prophylactically or after exposure. the immunoglobulin was given in between 72 hours after known contact, newborns received the injection at the day of delivery. after that the patients were followed for six weeks for documentation a ... | 1985 | 2999501 |
| replication of epstein-barr virus within the epithelial cells of oral "hairy" leukoplakia, an aids-associated lesion. | we conducted a study to identify the viruses in tissue specimens of oral "hairy" leukoplakia, a lesion that is found in immunosuppressed male homosexuals and that is associated with the subsequent development of the acquired immunodeficiency syndrome. when stained for papillomavirus core antigen, 49 of 67 biopsy specimens (73 per cent) yielded positive results in epithelial-cell nuclei. electron microscopy showed papillomavirus-like particles in all of 25 specimens, and the herpes-type virus des ... | 1985 | 2999595 |
| dna sequence of the herpes simplex virus type 1 gene whose product is responsible for transcriptional activation of immediate early promoters. | previous work has shown that transcriptional activation of herpes simplex virus type 1 (hsv-1) immediate early genes is mediated by a protein species (vmw65) present in the tegument of infecting virions. this paper describes dna sequence analysis and mrna mapping of the vmw65 gene in hsv-1 strain 17. the vmw65 coding region was identified as a 490 codon sequence encoding a polypeptide of molecular weight 54,342 and characterised by a high proportion of charged amino acid residues. a homologue to ... | 1985 | 2999707 |
| recovery of herpesviruses from cerebrospinal fluid of immunodeficient homosexual men. | over a one-year period the cerebrospinal fluid (csf) obtained from a series of homosexual men immunocompromised with either hodgkin's disease or acquired immune deficiency syndrome (aids) was cultured to assess the frequency with which infectious viruses could be recovered. of 58 patients examined, 4 (6.9%) had csf cultures that showed a cytopathology consistent with a virus infection. all isolates proved to be herpesviruses. cytomegalovirus (cmv) and varicella-zoster virus were isolated from cs ... | 1985 | 3000285 |
| effect of hla on the cellular immune response to varicella-zoster virus. | the effect of hla on varicella-zoster virus (vzv)-specific lymphocyte transformation (ltf) was studied in 100 normal immune adults and 64 children who were immunized with live attenuated varicella vaccine. in the normal adults, a statistically significant association was observed between low responsiveness and the presence of a2 (p less than 0.025), and also between high responsiveness and the presence of aw24 (p less than 0.05). a similar but clearer association, i.e. low responsiveness with a2 ... | 1985 | 3000347 |
| virus-specific polymeric immunoglobulin a antibodies in serum from patients with rubella, measles, varicella, and herpes zoster virus infections. | more than 85% of the immunoglobulin a (iga) antibodies in normal adult serum are monomeric (m-iga). by contrast, virus-specific iga is mainly polymeric (p-iga) in sera from patients with rubella, measles, and varicella. specific m-iga antibodies only reach quantitative significance in late convalescence. in patients with herpes zoster, on the other hand, a varying response was observed: in three of six sera, specific iga was absent or at a very low titer, whereas in the remaining three cases, a ... | 1985 | 3001129 |
| seroepidemiology of varicella. | | 1986 | 3001191 |
| varicella-zoster virus p32/p36 complex is present in both the viral capsid and the nuclear matrix of the infected cell. | varicella-zoster virus (vzv) directs the synthesis of numerous glycosylated and nonglycosylated infected-cell-specific proteins, many of which are later incorporated into the virion as structural components. in this study, we characterized a nonglycosylated polypeptide complex with the aid of a vzv-specific murine monoclonal antibody clone, 251d9. as detected by indirect immunofluorescence, the antibody bound mainly to antigens located within the nuclei of infected cells and did not attach to an ... | 1986 | 3001341 |
| treatment of varicella-zoster virus infection in severely immunocompromised patients. a randomized comparison of acyclovir and vidarabine. | in a prospective, randomized trial, we compared intravenous acyclovir and vidarabine in the treatment of varicella-zoster virus infection in severely immunocompromised patients who presented within 72 hours of onset of the infection. eleven patients were treated in each group. cutaneous dissemination of infection occurred in none of the 10 acyclovir recipients and in 5 of the 10 vidarabine recipients who had presented with localized dermatomal disease (p = 0.016). as compared with vidarabine, ac ... | 1986 | 3001523 |
| oral acyclovir in the therapy of acute herpes zoster ophthalmicus. an interim report. | a prospective, randomized, double-masked, placebo-controlled clinical trial was conducted to study the effects of oral acyclovir on 55 patients with acute herpes zoster ophthalmicus. treatment with oral acyclovir resulted in more prompt resolution of signs and symptoms, particularly in patients treated within 72 hours after onset of skin rash (p less than 0.05), and shortened the duration of viral shedding (p = 0.02). vesicular skin lesions involving other dermatomes (microdissemination) occurre ... | 1985 | 3001610 |
| rapid detection of herpes simplex- and varicella-zoster virus antigens from clinical specimens by enzyme immunoassay. | | 1985 | 3002249 |
| 5-(2-chloroethyl)-2'-deoxyuridine: a potent and selective inhibitor of herpes viruses in vitro and in vivo. | | 1985 | 3002256 |
| booster vaccination of healthy adults with vzv antibody but without a vzv-specific cell-mediated immune response. | | 1985 | 3002261 |
| therapy of varicella-zoster virus infection--mechanism of action of (e)-5-(2-bromovinyl)-2'-deoxyuridine. | | 1985 | 3002264 |
| congenital varicella. | | 1985 | 3003006 |
| varicella-zoster viral glycoprotein envelopment: ultrastructural cytochemical localization. | the periodate-thiocarbohydrazide silver proteinate (pa-tch-sp) method was used to study the envelopment process in varicella-zoster virus-infected human melanoma cells. viral envelopment could be seen at two sites, the nuclear membrane and at virus-induced intracytoplasmic vacuoles. virus-associated glycoconjugates were detected by the pa-tch-sp method at the plasmalemma and on the inner membrane of the intracytoplasmic vacuoles. virion envelopes acquired at the nuclear membrane were pa-tch-sp n ... | 1986 | 3003184 |
| age-specific prevalence of antibodies to pyrimidine kinase enzymes of herpes simplex virus types 1 and 2, and of varicella zoster virus. | the age-specific prevalence of antibodies to pyrimidine kinase enzymes of herpes simplex virus types 1 (hsv-1) and 2 (hsv-2) and of varicella zoster virus (vzv) was measured in serum specimens from 360 persons. specific inhibition of viral enzyme activity by the serum was used as an indication of the presence of antibodies to the enzyme. for hsv-1 and hsv-2 together the overall prevalence of positive sera increased with age and reached about 50% in the older age groups, the major part of the pos ... | 1986 | 3003247 |
| [active chickenpox vaccination of children with acute leukemia or other neoplastic diseases]. | 26 patients with acute leukemia and other malignancies susceptible to varicella were vaccinated during maintenance chemotherapy. vaccination was done with oka strain of live attenuated varicella vaccine developed by takahashi 1974. all recipients showed no adverse clinical reactions. there was no spread of vaccine virus to others. seroconversion was 94% in seronegative patients. in those having low antibody titers before vaccination in 56% booster effect was demonstrable. none of the seroconvert ... | 1985 | 3003449 |
| formation of varicella-zoster virus antigens in infected vero cells. | the formation of varicella-zoster (v-z) virus-associated antigens was studied in v-z virus-infected vero cells by means of indirect immunofluorescence. early antigen (ea) was first detected inside v-z virus-infected vero cells 4 to 6 hr after infection, whereas surface membrane antigen (sma) was expressed on the outer surface of infected cells 2 to 3 hr later than ea, and intranuclear late antigen (la) was detected several hours later than sma antigen. ea expression was not inhibited by cytosine ... | 1985 | 3003545 |