molecular epidemiological study of enteroviruses associated with encephalitis in children from hangzhou, china. | enterovirus (ev) has over 100 serotypes of species a-d, which can cause various symptoms in infants. enterovirus encephalitis (eve) is serve disease with high morbidity and mortality in children. to well define the epidemiology of eve, we wanted to know more about ev and ev molecular typing by conducting this study in hangzhou.cerebrospinal fluid samples were collected from children with diagnosis of encephalitis. meanwhile, one-step real-time rt-pcr was used for the detection of ev, and we also ... | 2016 | 27749541 |
high incidence of mammalian orthoreovirus identified by environmental surveillance in taiwan. | wild poliovirus (wpv) persists in diverse locales worldwide, spreading outward from endemic areas. in response to the international threat of wpv transmission and changes in the national vaccination policy, we established an environmental surveillance system to monitor the circulation of wild and vaccine-related poliovirus in taiwan. from july 2012 to december 2013, we collected sewage specimens every month from 10 sewage treatment plants located throughout taiwan. the specimens were concentrate ... | 2015 | 26555962 |
formononetin inhibits enterovirus 71 replication by regulating cox- 2/pge₂ expression. | the activation of erk, p38 and jnk signal cascade in host cells has been demonstrated to up-regulate of enterovirus 71 (ev71)-induced cyclooxygenase-2 (cox-2)/ prostaglandins e2 (pge₂) expression which is essential for viral replication. so, we want to know whether a compound can inhibit ev71 infection by suppressing cox-2/pge₂ expression. | 2015 | 25890183 |
cardiac function remains impaired despite reversible cardiac remodeling after acute experimental viral myocarditis. | background. infection with coxsackievirus b3 induces myocarditis. we aimed to compare the acute and chronic phases of viral myocarditis to identify the immediate effects of cardiac inflammation as well as the long-term effects after resolved inflammation on cardiac fibrosis and consequently on cardiac function. material and methods. we infected c57bl/6j mice with coxsackievirus b3 and determined the hemodynamic function 7 as well as 28 days after infection. subsequently, we analyzed viral burden ... | 2017 | 28352641 |
pa28 modulates antigen processing and viral replication during coxsackievirus b3 infection. | the function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. during coxsackievirus b3 (cvb3) myocarditis, ifn-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. the function of the ifn-γ-inducible proteasome regulator subunits pa28 α and β, however, in this context was unknown. during viral myocarditis, we found an increased abundance of pa28β subunits in heart tissue. ... | 2017 | 28278207 |
microrna-20b suppresses the expression of zfp-148 in viral myocarditis. | viral myocarditis is a common cardiovascular disease, which seriously endangers the health of people and even leads to sudden unexpected death. micrornas play very important roles in various physical and pathological processes including cardiogenesis and heart diseases. in recent years, mir-20b has been implicated in various diseases such as breast cancer, gastric cancer, hepatocellular carcinoma, cardiovascular diseases. however, the function of mir-20b in the pathological progress of viral myo ... | 2017 | 28247213 |
genetic variation in chromosome y regulates susceptibility to influenza a virus infection. | males of many species, ranging from humans to insects, are more susceptible than females to parasitic, fungal, bacterial, and viral infections. one mechanism that has been proposed to account for this difference is the immunocompetence handicap model, which posits that the greater infectious disease burden in males is due to testosterone, which drives the development of secondary male sex characteristics at the expense of suppressing immunity. however, emerging data suggest that cell-intrinsic ( ... | 2017 | 28242695 |
il-37 ameliorates coxsackievirus b3-induced viral myocarditis by modulating the th17/treg immune response. | myocarditis is a heterogeneous group of disorders defined by inflammation of the heart muscle with an excessively activated immune response. numerous interventions have been investigated for the treatment of myocarditis while success is limited. interleukin-37 (il-37), a novel member of the il-1 cytokine family, is a natural inhibitor of innate immunity associated with autoimmune diseases. however, the modulatory effect of il-37 in myocarditis is unknown. in this study, we investigated the immun ... | 2017 | 28207428 |
right cervical vagotomy aggravates viral myocarditis in mice via the cholinergic anti-inflammatory pathway. | the autonomic nervous system dysfunction with increased sympathetic activity and withdrawal of vagal activity may play an important role in the pathogenesis of viral myocarditis. the vagus nerve can modulate the immune response and control inflammation through a 'cholinergic anti-inflammatory pathway' dependent on the α7-nicotinic acetylcholine receptor (α7nachr). although the role of β-adrenergic stimulation on viral myocarditis has been investigated in our pervious studies, the direct effect o ... | 2017 | 28197102 |
mesenchymal stromal cells modulate monocytes trafficking in coxsackievirus b3-induced myocarditis. | mesenchymal stromal cell (msc) application in coxsackievirus b3 (cvb3)-induced myocarditis reduces myocardial inflammation and fibrosis, exerts prominent extra-cardiac immunomodulation, and improves heart function. although the abovementioned findings demonstrate the benefit of msc application, the mechanism of the msc immunomodulatory effects leading to a final cardioprotective outcome in viral myocarditis remains poorly understood. monocytes are known to be a trigger of myocardial tissue infla ... | 2017 | 28186704 |
transmissible endoplasmic reticulum stress from myocardiocytes to macrophages is pivotal for the pathogenesis of cvb3-induced viral myocarditis. | infiltrating macrophages have been proven as a pivotal pathological inflammatory cell subset in coxsackievirus b3 (cvb3) induced viral myocarditis. however, the mechanisms underlying the initiation and promotion of macrophage pro-inflammatory responses are still blur. we previously reported that cardiac er stress contributed to cvb3-induced myocarditis by augmenting inflammation. in this study, we focused on the influence of er stress on the macrophage inflammatory responses in the viral myocard ... | 2017 | 28176833 |
profiling subcellular protein phosphatase responses to coxsackievirus b3 infection of cardiomyocytes. | cellular responses to stimuli involve dynamic and localized changes in protein kinases and phosphatases. here, we report a generalized functional assay for high-throughput profiling of multiple protein phosphatases with subcellular resolution and apply it to analyze coxsackievirus b3 (cvb3) infection counteracted by interferon signaling. using on-plate cell fractionation optimized for adherent cells, we isolate protein extracts containing active endogenous phosphatases from cell membranes, the c ... | 2017 | 28174228 |
incorporation of a bi-functional protein fimh enhances the immunoprotection of chitosan-pvp1 vaccine against coxsackievirus b3-induced myocarditis. | viral myocarditis is a common clinical cardiovascular disease mainly induced by coxsackievirus b3 (cvb3) with no effective therapeutic measures. induction of efficient mucosal immune responses is very critical against cvb3-induced myocarditis. fimh is an escherichia coli (e. coli)-derived protein, which possesses an m cell-targeting property and functions as a tlr4 agonist. in this study, we introduced the recombinant fimh protein, into our previously developed cvb3 mucosal vaccine chitosan (cs) ... | 2017 | 28137624 |
inhibition of drp1 attenuates mitochondrial damage and myocardial injury in coxsackievirus b3 induced myocarditis. | viral myocarditis (vmc) is closely related to apoptosis, oxidative stress, innate immunity, and energy metabolism, which are all linked to mitochondrial dysfunction. a close nexus between mitochondrial dynamics and cardiovascular disease with mitochondrial dysfunction has been deeply researched, but there is still no relevant report in viral myocarditis. in this study, we aimed to explore the role of dynamin-related protein 1 (drp1)-linked mitochondrial fission in vmc. mice were inoculated with ... | 2017 | 28131843 |
oxymatrine provides protection against coxsackievirus b3-induced myocarditis in balb/c mice. | oxymatrine is the primary pharmacological component of sophora flavescens ait. in the present study, we investigated the protective effect of oxymatrine against coxsackievirus b3-induced myocarditis in mice. coxsackievirus b3-infected hela cells were treated with oxymatrine and the viral titer, as well as the degree of cellular proliferation were determined. additionally, balb/c mice were infected with coxsackievirus b3 and received differing concentrations of oxymatrine. on days 5 and 12 follow ... | 2017 | 28115196 |
sex-dependent intestinal replication of an enteric virus. | coxsackievirus is an enteric virus that initiates infection in the gastrointestinal tract before disseminating to peripheral tissues to cause disease, but intestinal factors that influence viral replication are understudied. furthermore, a sex bias for severe sequelae from coxsackievirus infections has been observed in humans. while mouse models mimicking human pathogenesis have been well characterized, many of these experiments use intraperitoneal injection of coxsackievirus to infect mice, byp ... | 2017 | 28100612 |
heat shock protein 70 promotes coxsackievirus b3 translation initiation and elongation via akt-mtorc1 pathway depending on activation of p70s6k and cdc2. | we previously demonstrated that coxsackievirus b3 (cvb3) infection upregulated heat shock protein 70 (hsp70) and promoted cvb3 multiplication. here, we report the underlying mechanism by which hsp70 enhances viral rna translation. by using an hsp70-overexpressing cell line infected with cvb3, we found that hsp70 enhanced cvb3 vp1 translation at two stages. first, hsp70 induced upregulation of vp1 translation at the initiation stage via upregulation of internal ribosome entry site trans-acting fa ... | 2017 | 28095607 |
coxsackievirus b3 directly induced th17 cell differentiation by inhibiting nup98 expression in patients with acute viral myocarditis. | th17 cells play a key role in the progression of coxsackievirus b3 (cvb3)-induced acute viral myocarditis (avmc). however, the direct effect of virus on th17 cell differentiation is still unknown. recently, nucleoporin (nup) 98 has been proved to be associated with lymphocyte differentiation. therefore, we investigated whether nup98 mediated th17 cell differentiation in avmc. in our study, patients with avmc and healthy controls were recruited. the results showed that cvb3 could enter into the c ... | 2016 | 28018858 |
rational design of novel highly potent and selective phosphatidylinositol 4-kinase iiiβ (pi4kb) inhibitors as broad-spectrum antiviral agents and tools for chemical biology. | phosphatidylinositol 4-kinase iiiβ (pi4kb) is indispensable for the replication of various positive-sense single stranded rna viruses, which hijack this cellular enzyme to remodel intracellular membranes of infected cells to set up the functional replication machinery. therefore, the inhibition of this pi4k isoform leads to the arrest of viral replication. here, we report on the synthesis of novel pi4kb inhibitors, which were rationally designed based on two distinct structural types of inhibito ... | 2017 | 28004945 |
mops and coxsackievirus b3 stability. | study of coxsackievirus b3 strain 28 (cvb3/28) stability using mops to improve buffering in the experimental medium revealed that mops (3-morpholinopropane-1-sulfonic acid) increased cvb3 stability and the effect was concentration dependent. over the ph range 7.0-7.5, virus stability was affected by both ph and mops concentration. computer-simulated molecular docking showed that mops can occupy the hydrophobic pocket in capsid protein vp1 where the sulfonic acid head group can form ionic and hyd ... | 2017 | 27940223 |
coxsackievirus b3 protease 3c: expression, purification, crystallization and preliminary structural insights. | viral proteases are proteolytic enzymes that orchestrate the assembly of viral components during the viral life cycle and proliferation. here, the expression, purification, crystallization and preliminary x-ray diffraction analysis are presented of protease 3c, the main protease of an emerging enterovirus, coxsackievirus b3, that is responsible for many cases of viral myocarditis. polycrystalline protein precipitates suitable for x-ray powder diffraction (xrpd) measurements were produced in the ... | 2016 | 27917835 |
reply to the letter to the editor "is colchicine really harmful in viral myocarditis?" | | 2017 | 27916345 |
vγ1(+)γδt, early cardiac infiltrated innate population dominantly producing il-4, protect mice against cvb3 myocarditis by modulating ifnγ(+) t response. | viral myocarditis (vmc) is an inflammation of the myocardium closely associated with coxsackievirus b3 (cvb3) infection. vγ1(+)γδt cells, one of early cardiac infiltrated innate population, were reported to protect cvb3 myocarditis while the precise mechanism not fully addressed. to explore cytokine profiles and kinetics of vγ1(+)γδt and mechanism of protection against vmc, flow cytometry was conducted on cardiac vγ1 cells in c57bl/6 mice following cvb3 infection. the level of cardiac inflammati ... | 2017 | 27886550 |
a novel 72-kda leukocyte-derived osteoglycin enhances the activation of toll-like receptor 4 and exacerbates cardiac inflammation during viral myocarditis. | viral myocarditis can severely damage the myocardium through excessive infiltration of immune cells. osteoglycin (ogn) is part of the small leucine-rich repeat proteoglycan (slrp) family. slrp's may affect inflammatory and fibrotic processes, but the implication of ogn in cardiac inflammation and the resulting injury upon viral myocarditis is unknown. | 2017 | 27878326 |
protease-activated receptor 1 enhances poly i:c induction of the antiviral response in macrophages and mice. | the coagulation cascade is activated during viral infections as part of the host defense system. coagulation proteases activate cells by cleavage of protease-activated receptors (pars). recently, we reported that the activation of par-1 enhanced interferon (ifn)β and cxcl10 expression in cardiac fibroblasts and in the hearts of mice infected with coxsackievirus b3. in this study, we used the double-stranded rna mimetic polyinosinic:polycytidylic acid (poly i:c) to induce an antiviral response in ... | 2017 | 27820939 |
green tea polyphenol epigallocatechin-3-gallate-alleviated coxsackievirus b3-induced myocarditis through inhibiting viral replication but not through inhibiting inflammatory responses. | viral myocarditis, which is mainly caused by coxsackievirus b3 (cvb3), affects about 5%-20% of the world population and still lacks efficient treatments. green tea, a tonic and healthful beverage that was originated in ancient china, has been receiving considerable attention for its protective effect on cardiovascular diseases in recent years. in the present investigation, we aimed to explore the effect of green tea polyphenol epigallocatechin-3-gallate (egcg) on cvb3-induced myocarditis and its ... | 2017 | 27753702 |
coxsackievirus b3 induces the formation of autophagosomes in cardiac fibroblasts both in vitro and in vivo. | coxsackievirus group b (cvb) is one of the common pathogens that cause myocarditis and cardiomyopathy. evidence has shown that cvb replication in cardiomyocytes is responsible for the damage and loss of cardiac muscle and the dysfunction of the heart. however, it remains largely undefined how cvb would directly impact cardiac fibroblasts, the most abundant cells in human heart. in this study, cardiac fibroblasts were isolated from balb/c mice and infected with cvb type 3 (cvb3). increased double ... | 2016 | 27793649 |
a new monoclonal antibody (cox mab 31a2) detects vp1 protein of coxsackievirus b3 with high sensitivity and specificity. | human enteroviruses, e.g. coxsackieviruses, induce a variety of severe acute and chronic forms of disease, including myocarditis, meningitis and diabetes mellitus type 1. to visualize enterovirus infection with a diagnostic intent, many studies have applied a commercially available antibody (anti-cvb5 vp1, clone 5-d8/1, dako, hamburg, germany) that identifies vp1 of different enteroviral serotypes. many antibodies, however, have been found to bind non-specifically to proteins of cardiomyocytes a ... | 2016 | 27566306 |
il-9 inhibits viral replication in coxsackievirus b3-induced myocarditis. | myocardial injuries in viral myocarditis (vmc) are caused by viral infection and related autoimmune disorders. recent studies suggest that il-9 mediated both antimicrobial immune and autoimmune responses in addition to allergic diseases. however, the role of il-9 in viral infection and vmc remains controversial and uncertain. in this study, we infected balb/c mice with coxsackievirus b3 (cvb3), and found that il-9 was enriched in the blood and hearts of vmc mice on days 5 and 7 after virus infec ... | 2016 | 27766098 |
cinnamaldehyde derivatives inhibited coxsackievirus b3-induced viral myocarditis. | the chemical property of cinnamaldehyde is unstable in vivo, although early experiments have shown its obvious therapeutic effects on viral myocarditis (vmc). to overcome this problem, we used cinnamaldehyde as a leading compound to synthesize derivatives. five derivatives of cinnamaldehyde were synthesized: 4-methylcinnamaldehyde (1), 4-chlorocinnamaldehyde (2), 4-methoxycinnamaldehyde (3), α-bromo-4-methylcinnamaldehyde (4), and α-bromo-4-chlorocinnamaldehyde (5). neonatal rat cardiomyocytes a ... | 2016 | 27737525 |
valproic acid ameliorates coxsackievirus-b3-induced viral myocarditis by modulating th17/treg imbalance. | viral myocarditis, which is often caused by coxsackievirus b3 (cvb3), is a serious clinical disorder characterized by excessive myocardial inflammation. valproic acid (vpa) is described as a histone deacetylase inhibitor that has anti-inflammatory effects in several inflammatory diseases. however, the role and the detailed mechanism of vpa in viral myocarditis remain unclear. | 2016 | 27724948 |
microarray analysis reveals altered circulating microrna expression in mice infected with coxsackievirus b3. | coxsackievirus b3 (cvb3) is a common causative agent in the development of inflammatory cardiomyopathy. however, whether the expression of peripheral blood micrornas (mirnas) is altered in this process is unknown. the present study investigated changes to mirna expression in the peripheral blood of cvb3-infected mice. utilizing mirna microarray technology, differential mirna expression was examined between normal and cvb3-infected mice. the present results suggest that specific mirnas were diffe ... | 2016 | 27698715 |
detection and identification of coxsackievirus b3 from sera of an indonesian patient with undifferentiated febrile illness. | coxsackievirus b3 (cvb3) virus has been implicated as the causative agent of various outbreaks of clinical disease, including hand, foot, and mouth diseases, aseptic meningitis, acute myocarditis, and inflammatory cardiomyopathy. | 2016 | 27580335 |
the novel asymmetric entry intermediate of a picornavirus captured with nanodiscs. | many nonenveloped viruses engage host receptors that initiate capsid conformational changes necessary for genome release. structural studies on the mechanisms of picornavirus entry have relied on in vitro approaches of virus incubated at high temperatures or with excess receptor molecules to trigger the entry intermediate or a-particle. we have induced the coxsackievirus b3 entry intermediate by triggering the virus with full-length receptors embedded in lipid bilayer nanodiscs. these asymmetric ... | 2016 | 27574701 |
fructus amomi cardamomi extract inhibit coxsackievirus-b3 induced myocarditis in murine myocarditis model. | coxsackievirus b3 (cvb3) is the main cause of acute myocarditis and dilated cardiomyopathy. plant extracts are considered as useful materials to develop new antiviral drugs. we had previously selected candidate plant extracts, which showed anti-inflammatory effects. we examined the antiviral effects by using a hela cell survival assay. among these extracts, we chose the amomi cardamomi (amomi) extract, which showed strong antiviral effect and preserved cell survival in cvb3 infection. we investi ... | 2016 | 27558433 |
effectiveness of the consecutive alternating administration course of a triple antiviral combination in coxsackievirus b3 infections in mice. | anti-enteroviral chemotherapeutics for clinical use are not registered so far, mainly due to the rapid development of drug-resistance. one of the possible approaches to overcome this problem is the use of combined chemotherapy. however, its application consisting of simultaneously given drugs, is not efficacious because of the development of multiple resistance. here we present a novel approach for combined application of anti-enteroviral compounds, consisting of a consecutive alternating admini ... | 2016 | 27552486 |
a case of epidemic myalgia with symptoms resembling acute purulent spondylitis and discitis. | epidemic myalgia is a disease that presents with fever and extreme myalgia of the trunk due to an acute enterovirus infection. the trunk pain is mainly in the chest or in the epigastrium. we aimed to highlight a case of epidemic myalgia where initial diagnosis needed differentiation from acute purulent spondylitis and discitis. | 2016 | 27491355 |
dual roles of calpain in facilitating coxsackievirus b3 replication and prompting inflammation in acute myocarditis. | viral myocarditis (vmc) treatment has long been lacking of effective methods. our former studies indicated roles of calpain in vmc pathogenesis. this study aimed at verifying the potential of calpain in coxsackievirus b3 (cvb3)-induced myocarditis treatment. | 2016 | 27472894 |
major persistent 5' terminally deleted coxsackievirus b3 populations in human endomyocardial tissues. | we performed deep sequencing analysis of the enterovirus 5' noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. results displayed a mix of deleted and full-length coxsackievirus b3, characterized by a low viral rna load (8.10(2) copies/μg of nucleic acids) and a low viral rna positive-sense to rna negative-sense ratio of 4.8. | 2016 | 27434549 |
illuminating the sites of enterovirus replication in living cells by using a split-gfp-tagged viral protein. | like all other positive-strand rna viruses, enteroviruses generate new organelles (replication organelles [ros]) with a unique protein and lipid composition on which they multiply their viral genome. suitable tools for live-cell imaging of enterovirus ros are currently unavailable, as recombinant enteroviruses that carry genes that encode ro-anchored viral proteins tagged with fluorescent reporters have not been reported thus far. to overcome this limitation, we used a split green fluorescent pr ... | 2017 | 27390781 |
atp is an allosteric inhibitor of coxsackievirus b3 polymerase. | the rna-dependent rna polymerases from positive-strand rna viruses, such as picornaviruses and flaviviruses, close their active sites for catalysis via a unique ntp-induced conformational change in the palm domain. combined with a fully prepositioned templating nucleotide, this mechanism is error-prone and results in a distribution of random mutations in the viral progeny often described as a quasi-species. here we examine the extent to which noncognate ntps competitively inhibit single-cycle el ... | 2016 | 27319576 |
domain i of the 5' non-translated genomic region in coxsackievirus b3 rna is not required for productive replication. | domain i is a cloverleaf-like secondary structure at the 5' termini of all enterovirus genomes, comprising part of a cis-acting replication element essential for efficient enteroviral replication. 5' genomic terminal deletions up to as much as 55% of domain i can occur without lethality following coxsackie b virus infections. we report here that the entire cvb structural domain i can be deleted without lethality. | 2016 | 27289561 |
effect of amp-activated protein kinase activation on cardiac fibroblast proliferation induced by coxsackievirus b3. | excessive fibroblast proliferation and collagen production are the major pathogenic mechanisms in the progression of viral myocarditis, which is most frequently associated with infection by coxsackievirus b3 (cvb3). amp-activated protein kinase (ampk) has been confirmed to be involved in the progression of myocardial remodeling. however, it remains unclear whether ampk has an effect on cvb3-induced cardiac fibroblast proliferation. in the present study, the effects of ampk on cardiac fibroblast ... | 2016 | 27284347 |
[effect of total flavonoids of astragalus on endoplasmic reticulum chaperone, calumenin and connecxin 43 in suckling mouse myocardium with myocarditis caused by coxsackievirus b3]. | to investigate the effect of total flavonoids of astragalus on the expression of endoplasmic reticulum chaperone, calumenin and connecxin 43 (cx43) in suckling mouse myocardium with myocarditis caused by coxsackievirus b3 (cvb3). | 2016 | 27255042 |
perinatal coxsackievirus b3 infection with transient thrombocytopenia. | coxsackievirus (cox) b is the second common picornaviruses, after echovirus, detected from children younger than 2 months of age. neonates who present with cox b3 infection in the first week are known to have severe illness such as myocarditis or menigoencephalitis. severity is commonly associated with perinatal vertical transmission. here, we report a neonatal case of cox b3 infection with severe thrombocytopenia through horizontal transmission. the patient was a preterm infant born without asp ... | 2016 | 27250900 |
complete genome sequence of a coxsackievirus b3 recombinant isolated from an aseptic meningitis outbreak in eastern china. | coxsackievirus b3 (cv-b3) has frequently been associated with aseptic meningitis outbreaks in china. to identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08tc170, a representative strain isolated from cerebrospinal fluid (csf) samples from an outbreak in shandong in 2008, was determined, and the coding regions for p1-p3 and vp1 were aligned. the first 21 and last 20 residues were "ttaaaacagcctgtgggttgt" and "attctccgcattcggtgcgg", ... | 2016 | 27236460 |
coxsackievirus b3 infection induces autophagic flux, and autophagosomes are critical for efficient viral replication. | autophagy is an intrinsic cellular process that can degrade cytoplasmic components. it has been reported that several pathogens hijack this process to facilitate their replication. coxsackievirus b3 (cvb3), a member of the family picornaviridae, induces autophagy upon infection. however, the details of cvb3-induced autophagy remain a subject of debate. this study applied a combination of multiple assays for the measurement of autophagy and demonstrated that cvb3 induces a complete autophagic flu ... | 2016 | 27224983 |
activation of amp-activated protein kinase reduces collagen production via p38 mapk in cardiac fibroblasts induced by coxsackievirus b3. | collagen deposition is the major cause of myocardial fibrosis, contributing to impaired cardiac contractile function in coxsackie virus b3 (cvb3)-infected hearts. adenosine monophosphate-activated protein kinase (ampk) has been considered as a cellular fuel gauge and super metabolic regulator, however, whether ampk has an effect on collagen production in cvb3‑infected heart remains to be elucidated. in the present study, the association between ampk activation and cvb3‑infected neonatal rat card ... | 2016 | 27221787 |
antiviral activity of oroxylin a against coxsackievirus b3 alleviates virus-induced acute pancreatic damage in mice. | the flavonoids mosloflavone, oroxylin a, and norwogonin, which were purified from scutellaria baicalensis georgi, significantly protected vero cells against coxsackievirus b3 (cvb3)-induced cell death. to investigate the in vivo antiviral activity of oroxylin a, we intraperitoneally inoculated cvb3 into 4-week-old balb/c mice. body weights and blood glucose levels of the mice were decreased after cvb3 infection, and these changes were attenuated by the administration of oroxylin a. importantly, ... | 2016 | 27195463 |
2,3,4-trihydroxybenzyl-hydrazide analogues as novel potent coxsackievirus b3 3c protease inhibitors. | human coxsackievirus b3 (cvb3) 3c protease plays an essential role in the viral replication of cvb3, which is a non-enveloped and positive single-stranded rna virus belonging to picornaviridae family, causing acute viral myocarditis mainly in children. during optimization based on sar studies of benserazide (3), which was reported as a novel anti-cvb3 3c(pro) agent from a screening of compound libraries, the 2,3,4-trihydroxybenzyl moiety of 3 was identified as a key pharmacophore for inhibitory ... | 2016 | 27191615 |
protein 2b of coxsackievirus b3 induces autophagy relying on its transmembrane hydrophobic sequences. | coxsackievirus b (cvb) belongs to enterovirus genus within the picornaviridae family, and it is one of the most common causative pathogens of viral myocarditis in young adults. the pathogenesis of myocarditis caused by cvb has not been completely elucidated. in cvb infection, autophagy is manipulated to facilitate viral replication. here we report that protein 2b, one of the non-structural proteins of cvb3, possesses autophagy-inducing capability. the autophagy-inducing motif of protein 2b was i ... | 2016 | 27187444 |
viral myocarditis. | the article traces the pathways leading from viral infection of the heart by coxsackievirus b3 to autoimmune myocarditis in its various manifestations. | 2016 | 27166925 |
colchicine aggravates coxsackievirus b3 infection in mice. | there is a clinical need for immunosuppressive therapy that can treat myocarditis patients in the presence of an active viral infection. in this study we therefore investigated the effects of colchicine, an immunosuppressive drug which has been used successfully as treatment for pericarditis patients, in a mouse model of coxsackievirus b3(cvb3)-induced myocarditis. | 2016 | 27140338 |
design of a genetically stable high fidelity coxsackievirus b3 polymerase that attenuates virus growth in vivo. | positive strand rna viruses replicate via a virally encoded rna-dependent rna polymerase (rdrp) that uses a unique palm domain active site closure mechanism to establish the canonical two-metal geometry needed for catalysis. this mechanism allows these viruses to evolutionarily fine-tune their replication fidelity to create an appropriate distribution of genetic variants known as a quasispecies. prior work has shown that mutations in conserved motif a drastically alter rdrp fidelity, which can b ... | 2016 | 27137934 |
reversion to wildtype of a mutated and nonfunctional coxsackievirus b3cre(2c). | the cis-acting replication element (cre) in the 2c protein coding region [cre(2c)] of enteroviruses (ev) facilitates the addition of two uridine residues (uridylylation) onto the virus-encoded protein vpg in order for it to serve as the rna replication primer. we demonstrated that coxsackievirus b3 (cvb3) is replication competent in the absence of a native (uridylylating) cre(2c) and also demonstrated that lack of a functional cre(2c) led to generation of 5' terminal genomic deletions in the cvb ... | 2016 | 27130630 |
total flavonoids of astragalus plays a cardioprotective role in viral myocarditis. | viral myocarditis is initiated by viral infection of myocardial tissue leading to dilated cardiomyopathy and congestive heart failure. recent studies have linked viral myocarditis with dysfunctions in endoplasmic reticulum (er) mediated ca(2+) homeostasis and the unfolded protein response (upr). currently there are no effective treatments for this viral infection. | 2016 | 27122935 |
synthesis of pyrazine-1,3-thiazine hybrid analogues as antiviral agent against hiv-1, influenza a (h1n1), enterovirus 71 (ev71), and coxsackievirus b3 (cvb3). | a novel series of pyrazine-1,3-thiazine hybrid conjugates were synthesized in excellent yield. these derivatives were subsequently tested against human immunodeficiency virus (hiv-1); hemagglutinin type 1 and neuraminidase type 1-'influenza' a (h1n1) virus; enterovirus 71 (ev71); and coxsackievirus b3. the effect of these conjugates on the key enzymes responsible for the progression of these viral infections was also illustrated via enzyme-based assay, such as hiv-1 reverse transcriptase (rt) an ... | 2016 | 27062664 |
enterovirus control of translation and rna granule stress responses. | enteroviruses such as poliovirus (pv) and coxsackievirus b3 (cvb3) have evolved several parallel strategies to regulate cellular gene expression and stress responses to ensure efficient expression of the viral genome. enteroviruses utilize their encoded proteinases to take over the cellular translation apparatus and direct ribosomes to viral mrnas. in addition, viral proteinases are used to control and repress the two main types of cytoplasmic rna granules, stress granules (sgs) and processing b ... | 2016 | 27043612 |
retraction notice to “antiviral and myocyte protective effects of il-28a in coxsackievirus b3-induced myocarditis” [braz. j. infect. dis. (2015) 132–140]. | | 2017 | 27035013 |
the coxsackievirus and adenovirus receptor: glycosylation and the extracellular d2 domain are not required for coxsackievirus b3 infection. | the coxsackievirus and adenovirus receptor (car) is a member of the immunoglobulin superfamily (igsf) and functions as a receptor for coxsackie b viruses (cvbs). the extracellular portion of car comprises two glycosylated immunoglobulin-like domains, d1 and d2. car-d1 binds to the virus and is essential for virus infection; however, it is not known whether d2 is also important for infection, and the role of glycosylation has not been explored. to understand the function of these structural compo ... | 2016 | 27030267 |
ethyl pyruvate attenuated coxsackievirus b3-induced acute viral myocarditis by suppression of hmgb1/rage/nf-κb pathway. | inflammation plays important roles in the pathogenesis of coxsackievirus b3 (cvb3)-induced acute viral myocarditis (avmc). ethyl pyruvate (ep) has been shown to be an anti-inflammatory agent. high mobility group box 1 (hmgb1)/receptor for advanced glycation end product (rage)/nuclear factor (nf)-κb pathway has close relation with inflammatory responses. here, we investigated the effects of ep on cvb3-induced avmc and potential mechanisms. the mice with avmc were treated with ep (40 or 80 mg/kg/d ... | 2016 | 27026909 |
halofuginone alleviates acute viral myocarditis in suckling balb/c mice by inhibiting tgf-β1. | viral myocarditis (vmc) is an inflammation of heart muscle in infants and young adolescents. this study explored the function of halofuginone (hf) in coxsackievirus b3 (cvb3) -treated suckling mice. hf-treated animal exhibited higher survival rate, lower heart/body weight, and more decreased blood sugar concentration than cvb3 group. hf also reduced the expressions of interleukin(il)-17 and il-23 and the numbers of th17 cells. moreover, hf downregulated pro-inflammatory cytokine levels and incre ... | 2016 | 27021682 |
an epidemic of coxsackievirus b3 infection in infants and children in jiangsu province, china: a prospective cohort study. | to investigate the epidemiological data on coxsackievirus b3 (cvb3) infection and its incidence in infants and children, a prospective cohort study was carried out from 2012 to 2014 in jiangsu province, china. according to the results of seropositive rates and ntab titers of cvb3, an epidemic of cvb3 infection was found, and a dynamic change in cvb3 neutralizing antibody was also observed. one case was recorded with cvb3-associated hand, foot and mouth disease (hfmd), and the isolates belonged t ... | 2016 | 27020571 |
a rapid and quantitative assay for measuring neutralizing antibodies of coxsackievirus b3. | coxsackievirus b3 (cvb3) infection has been found to account for an increasing proportion cases of hand, foot and mouth disease (hfmd) in recent epidemiology studies. cvb3 is a single stranded, non-enveloped rna virus and the infection can cause prominent health threat to pre-school children. here, by taking approaches of reverse genetics, we established a single-round infection system for cvb3. the pseudovirus was produced by sequential transfection of cvb3 capsid expresser plasmid and cvb3 rep ... | 2016 | 26947399 |
silencing microrna-155 attenuates cardiac injury and dysfunction in viral myocarditis via promotion of m2 phenotype polarization of macrophages. | macrophage infiltration is a hallmark feature of viral myocarditis. as studies have shown that microrna-155 regulates the differentiation of macrophages, we aimed to investigate the role of microrna-155 in vm. we report that silencing microrna-155 protects mice from coxsackievirus b3 induced myocarditis. we found that microrna-155 expression was upregulated and localized primarily in heart-infiltrating macrophages and cd4(+) t lymphocytes during acute myocarditis. in contrast with wildtype (wt) ... | 2016 | 26931072 |
erβ and erα differentially regulate nkt and vγ4(+) t-cell activation and t-regulatory cell response in coxsackievirus b3 infected mice. | coxsackievirus b3 (cvb3) induced myocarditis is sex dependent with males developing more severe disease than females. previous studies had shown that sex-associated hormones determine the sex bias with testosterone and progesterone promoting myocarditis while estrogen (e2) is protective. there are two major estrogen receptors: estrogen receptor alpha (erα) and estrogen receptor beta (erβ). the goal of the current study was to determine the relative role of these receptors to myocarditis suscepti ... | 2017 | 26925301 |
molecular epidemiology of coxsackievirus b3 infection in spain, 2004-2014. | epidemiological and clinical characteristics of coxsackievirus b3 infections in spain were investigated. this enterovirus (ev) type was detected mainly in young children (<6 months) and was associated with neurological (78 %) and respiratory diseases (10 %) but also with myo/pericarditis (10 %). two myocarditis cases were fatal. phylogenetic analysis of the vp1 region showed that genotype iii circulated in the country between 2004 and 2008 and was replaced by genotype v in 2010. furthermore, phy ... | 2016 | 26898312 |
sar evolution and discovery of benzenesulfonyl matrinanes as a novel class of potential coxsakievirus inhibitors. | fifty-one novel 12n-substituted matrinic acid derivatives were synthesized and evaluated for their anti-coxsackievirus b3 activities. | 2016 | 26867658 |
screening of a library of fda-approved drugs identifies several enterovirus replication inhibitors that target viral protein 2c. | enteroviruses (evs) represent many important pathogens of humans. unfortunately, no antiviral compounds currently exist to treat infections with these viruses. we screened the prestwick chemical library, a library of approved drugs, for inhibitors of coxsackievirus b3, identified pirlindole as a potent novel inhibitor, and confirmed the inhibitory action of dibucaine, zuclopenthixol, fluoxetine, and formoterol. upon testing of viruses of several ev species, we found that dibucaine and pirlindole ... | 2016 | 26856848 |
nicotine inhibits the production of proinflammatory cytokines of mice infected with coxsackievirus b3. | although excessive sympathetic activation in viral myocarditis and the protective effects of sympathetic inhibition with β-blockers are clear, the effects of enhancing vagal tone on viral myocarditis remain unclear. in several models, vagus nerve activation with the α7 nicotinic acetylcholine receptor (α7-nachr) agonists has been demonstrated to ameliorate inflammation. this study was therefore designed to examine the effects of cholinergic stimulation with α7-nachr agonist nicotine in a murine ... | 2016 | 26851533 |
recombinant mouse β-defensin 3 protects against coxsackievirus b3-induced myocarditis in mice. | to investigate the protective effect of recombinant mouse β-defensin 3 (rmbd3) against coxsackievirus b3 (cvb3)-induced myocarditis in mice. | 2015 | 26829552 |
construction of a subgenomic cv-b3 replicon expressing emerald green fluorescent protein to assess viral replication of a cardiotropic enterovirus strain in cultured human cells. | coxsackieviruses b (cv-b) (picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (dcm) cases. the mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the dcm clinical stage are not fully understood but are influenced by both viral and host factors. subgenomic replicons of cv-b can be used to assess viral replication m ... | 2016 | 26800776 |
human heart cell proteins interacting with a c-terminally truncated 2a protein of coxsackie b3 virus: identification by the yeast two-hybrid system. | protein 2a is a non-structural protein of coxsackievirus b3 (cvb3), an important human pathogen that can cause a variety of human diseases. protein 2a not only participates in viral life cycle, but also regulates host cell functions; however, the underlying mechanisms remain poorly understood. in order to better understand the molecular mechanisms of cvb3 2a's function, the yeast two-hybrid (y2h) system was adopted to screen for cvb3 2a interactive proteins in the human heart cdna library. full- ... | 2016 | 26781950 |
gene expression analysis during recovery process indicates the mechanism for innate immune injury and repair from coxsackievirus b3-induced myocarditis. | to investigate the innate immune injury and repair mechanism during recovery from coxsackievirus b3 (cvb3) induced myocarditis, we established an acute viral myocarditis recovery model by infecting balb/c mice with cvb3. histopathological examination of cardiac tissues after infection showed a gradual increase of myocardial injury to the maximum degree at 8 dpi (days post infection), followed by a recovery process with reduced viral replication. we also measured expression changes of innate immu ... | 2016 | 26779987 |
argonaute proteins in cardiac tissue contribute to the heart injury during viral myocarditis. | micrornas (mirnas) are a group of short, noncoding, regulatory rna molecules the dysregulation of which contributes to the pathogenesis of myocarditis. argonaute proteins are essential components of mirna-induced silencing complex and play important roles during mirna biogenesis and function. however, the expression pattern of four ago family members has not yet been detected in the coxsackievirus b3 (cvb3)-induced myocarditis tissue samples. in this study, we detected the expression of four ago ... | 2016 | 26764146 |
divergent requirement for a dna repair enzyme during enterovirus infections. | viruses of the enterovirus genus of picornaviruses, including poliovirus, coxsackievirus b3 (cvb3), and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic rnas during infection. one of these host proteins is a cellular dna repair enzyme known as 5' tyrosyl-dna phosphodiesterase 2 (tdp2). tdp2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (vpg) and the 5' end of picornav ... | 2015 | 26715620 |
discovery of structurally diverse small-molecule compounds with broad antiviral activity against enteroviruses. | antiviral drugs do not currently exist for the treatment of enterovirus infections, which are often severe and potentially life-threatening. we conducted high-throughput molecular screening and identified a structurally diverse set of compounds that inhibit the replication of coxsackievirus b3, a commonly encountered enterovirus. these compounds did not interfere with the function of the viral internal ribosome entry site or with the activity of the viral proteases, but they did drastically redu ... | 2015 | 26711750 |
erratum: dose-dependent protective effect of nicotine in a murine model of viral myocarditis induced by coxsackievirus b3. | | 2015 | 26657173 |
emodin inhibits coxsackievirus b3 replication via multiple signalling cascades leading to suppression of translation. | cvb3 (coxsackievirus 3) is a primary causal agent of viral myocarditis. emodin is a natural compound isolated from certain plant roots. in the present study, we found that emodin inhibited cvb3 replication in vitro and in mice, and now we report an unrecognized mechanism by which emodin inhibits cvb3 replication through suppression of viral protein translation via multiple pathways. on one hand, emodin treatment inhibited akt/mtor (mammalian target of rapamycin) signalling and activated 4ebp1 (e ... | 2016 | 26621875 |
cleavage of dap5 by coxsackievirus b3 2a protease facilitates viral replication and enhances apoptosis by altering translation of ires-containing genes. | cleavage of eukaryotic translation initiation factor 4g (eif4g) by enterovirus proteases during infection leads to the shutoff of cellular cap-dependent translation, but does not affect the initiation of cap-independent translation of mrnas containing an internal ribosome entry site (ires). death-associated protein 5 (dap5), a structural homolog of eif4g, is a translation initiation factor specific for ires-containing mrnas. coxsackievirus b3 (cvb3) is a positive single-stranded rna virus and a ... | 2016 | 26586572 |
the immunoproteasome controls the availability of the cardioprotective pattern recognition molecule pentraxin3. | cardiomyocyte death as a result of viral infection is an excellent model for dissecting the inflammatory stress response that occurs in heart tissue. we reported earlier that a specific proteasome isoform, the immunoproteasome, prevents exacerbation of coxsackievirus b3 (cvb3)-induced myocardial destruction and preserves cell vitality in heart tissue inflammation. following the aim to decipher molecular targets of immunoproteasome-dependent proteolysis, we investigated the function and regulatio ... | 2016 | 26578407 |
interleukin-27 ameliorates coxsackievirus-b3-induced viral myocarditis by inhibiting th17 cells. | interleukin (il)-27, which has both pro and anti- inflammatory properties, is a new discovered heterodimeric cytokine that belongs to il-12 family. however, the expression pattern and functional role of il-27 in viral myocarditis (vmc) has not been investigated. | 2015 | 26578236 |
coxsackievirus b3 induces autophagic response in cardiac myocytes in vivo. | viral myocarditis is a common disease that contributes to dilated cardiomyopathy or heart failure. coxsackievirus b (cvb) is one of the major causative pathogens of viral myocarditis. previous studies have shown that autophagy is exploited to promote cvb replication in cell lines. to study whether cardiac myocytes respond to cvb infection in a similar way, viral myocarditis was established by the inoculation of 3-week-old balb/c mice with cvb3. electron microscopic observation showed that autoph ... | 2015 | 26547068 |
synergistic antiviral activity of gemcitabine and ribavirin against enteroviruses. | enteroviruses are major causative agents of various human diseases, and some of them are currently considered to be an enormous threat to public health. however, no effective therapy is currently available for the treatment of these infections. we identified gemcitabine, a nucleoside-analog drug used for cancer treatment, from a screen of bioactive chemicals as a novel inhibitor of coxsackievirus b3 (cvb3) and enterovirus 71 (ev71). gemcitabine potently inhibited the proliferation of cvb3 and ev ... | 2015 | 26526589 |
panax notoginseng saponins ameliorates coxsackievirus b3-induced myocarditis by activating the cystathionine-γ-lyase/hydrogen sulfide pathway. | this study is to determine the therapeutic effects of panax notoginseng saponins (pnss) on coxsackievirus b3 (cvb3)-induced myocarditis, and whether cystathionine-γ-lyase (cse)/hydrogen sulfide (h2s) pathway is involved. mouse model of myocarditis was induced by cvb3 infection, and the mice were subjected to vehicle (saline) or drug treatments (sodium bisulfide (nahs), propargylglycine (pag), or pnss). the results showed that there were inflammatory cell infiltrations, interstitial edemas, and e ... | 2015 | 26525047 |
unc93b induces apoptotic cell death and is cleaved by host and enteroviral proteases. | unc93b is an endoplasmic reticulum (er)-resident transmembrane protein that serves to bind and traffic toll-like receptors (tlrs) from the er to their appropriate subcellular locations for ligand sensing. because of its role in tlr trafficking, unc93b is necessary for an effective innate immune response to coxsackievirus b3 (cvb), a positive-sense single stranded rna virus belonging to the enterovirus family. here, we show that unc93b is cleaved by a cvb-encoded cysteine protease (3cpro) during ... | 2015 | 26509685 |
dose-dependent protective effect of nicotine in a murine model of viral myocarditis induced by coxsackievirus b3. | the alpha 7 nicotinic acetylcholine receptor (alpha7 nachr) was recently described as an anti-inflammatory target in various inflammatory diseases. the aim of this study was to investigate the dose-related effects of nicotine, an alpha7 nachr agonist, in murine model of viral myocarditis. balb/c mice were infected by an intraperitoneally injection with coxsackievirus b3. nicotine was administered at doses of 0.1, 0.2 or 0.4 mg/kg three times per day for 7 or 14 consecutive days. the effects of n ... | 2015 | 26507386 |
three capsid amino acids notably influence coxsackie b3 virus stability. | coxsackievirus b3 strain 28 (cvb3/28) is less stable at 37 °c than eight other cvb3 strains with which it has been compared, including four in this study. in a variant cvb3/28 population selected for increased stability at 37 °c, the capsid proteins of the stable variant differed from the parental cvb3/28 by two mutations in vp1 and one mutation in vp3, each of which resulted in altered protein sequences. each of the amino acid changes was individually associated with a more stable virus. compet ... | 2016 | 26489722 |
simultaneous point-of-care detection of enterovirus 71 and coxsackievirus b3. | human enterovirus 71 (ev71) is one of the pathogens that causes hand, foot, and mouth disease (hfmd), which generally leads to neurological diseases and fatal complications among children. since the early clinical symptoms from ev71 infection are very similar to those from coxsackievirus b3 (cvb3) infection, a robust and sensitive detection method that can be used to distinguish ev71 and cvb3 is urgently needed for prompting medical treatment of related diseases. herein, based on immunomagnetic ... | 2015 | 26461918 |
[expression of vitamin d receptor in the myocardium of mice with viral myocarditis]. | to investigate the dynamic expression and role of vitamin d receptor (vdr) in the myocardium of mice with viral myocarditis (vmc). | 2015 | 26412188 |
molecular mechanism of a specific capsid binder resistance caused by mutations outside the binding pocket. | enteroviruses cause various acute and chronic diseases. the most promising therapeutics for these infections are capsid-binding molecules. these can act against a broad spectrum of enteroviruses, but emerging resistant virus variants threaten their efficacy. all known enterovirus variants with high-level resistance toward capsid-binding molecules have mutations of residues directly involved in the formation of the hydrophobic binding site. this is a first report of substitutions outside the bind ... | 2015 | 26391975 |
cyclosporine a treatment inhibits abcc6-dependent cardiac necrosis and calcification following coxsackievirus b3 infection in mice. | coxsackievirus type b3 (cvb3) is a cardiotropic enterovirus. infection causes cardiomyocyte necrosis and myocardial inflammation. the damaged tissue that results is replaced with fibrotic or calcified tissue, which can lead to permanently altered cardiac function. the extent of pathogenesis among individuals exposed to cvb3 is dictated by a combination of host genetics, viral virulence, and the environment. here, we aimed to identify genes that modulate cardiopathology following cvb3 infection. ... | 2015 | 26375467 |
hsp70-1: upregulation via selective phosphorylation of heat shock factor 1 during coxsackieviral infection and promotion of viral replication via the au-rich element. | coxsackievirus b3 (cvb3) is the primary pathogen of viral myocarditis. upon infection, cvb3 exploits the host cellular machineries, such as chaperone proteins, to benefit its own infection cycles. inducible heat shock 70-kda proteins (hsp70s) are chaperone proteins induced by various cellular stress conditions. the internal ribosomal entry site (ires) within hsp70 mrna allows hsp70 to be translated cap-independently during cvb3 infection when global cap-dependent translation is compromised. the ... | 2016 | 26361762 |
mutational disruption of cis-acting replication element 2c in coxsackievirus b3 leads to 5'-terminal genomic deletions. | following natural human or experimental murine infections and in cell culture, coxsackievirus b (cvb) rna can persist for weeks in the absence of a cytopathic effect, yet viral rna remains detectable. our earlier studies demonstrated that this persistence produced viral rna with up to 49 nucleotide deletions at the genomic 5' terminus which partially degraded the cloverleaf (or domain i), an rna structure required for efficient viral replication. a cis-acting replication element (cre) in the 2c ... | 2015 | 26355088 |
zinc finger antiviral protein inhibits coxsackievirus b3 virus replication and protects against viral myocarditis. | the host zinc finger antiviral protein (zap) has been reported exhibiting antiviral activity against positive-stranded rna viruses (togaviridae), negative-stranded rna viruses (filoviridae) and retroviruses (retroviridae). however, whether zap restricts the infection of enterovirus and the development of enterovirus mediated disease remains unknown. here, we reported the antiviral properties of zap against coxsackievirus b3 (cvb3), a single-stranded rna virus of the enterovirus genus within the ... | 2015 | 26343012 |
the role of micrornas in enteroviral infections. | the genus enterovirus, a member of the picornavirus family, are rna viruses that can cause poliomyelitis, hand-food-mouth disease, viral meningitis or meningoencephalitis, viral myocarditis and so on. micrornas are a class of highly conserved, small noncoding rnas recognized as important regulators of gene expression. recent studies found that micrornas play a significant role in the infection of enterovirus, such as enterovirus 71, coxsackievirus b3 and other enterovirus. enteroviral infection ... | 2015 | 26342975 |
antiviral activity of chrysin derivatives against coxsackievirus b3 in vitro and in vivo. | chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (ev71) by suppressing viral 3c protease (3c(pro)) activity. in the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus b3 (cvb3), which belongs to the same genus (enterovirus) as ev71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. we found that chrysin showed antiviral activity against cvb3 at 10 μm, but exhibited mild ... | 2015 | 26336587 |
correction: mutations in the 5' ntr and the non-structural protein 3a of the coxsackievirus b3 selectively attenuate myocarditogenicity. | | 2015 | 26322895 |
in vitro interaction between coxsackievirus b3 vp1 protein and human pleckstrin homology domain retinal protein (phr1). | coxsackievirus b3 (cvb3) infection causes central nervous system diseases including aseptic meningitis and encephalitis. to understand the mechanism of this virus, a yeast two-hybrid system was used to screen cellular proteins from a human heart cdna library. the results revealed that the human pleckstrin homology domain retinal protein (phr1), a ph domain-containing protein with low expression in the heart and high expression in the brain, interacts with cvb3 vp1, a major structural protein of ... | 2015 | 26318175 |
identification of the interaction of vp1 with gm130 which may implicate in the pathogenesis of cvb3-induced acute pancreatitis. | coxsackievirus b3 (cvb3) is a causative agent of viral myocarditis, pancreatitis, and meningitis in humans. although the susceptibility of cvb3-induced acute pancreatitis is age-dependent, the underlying mechanisms remain unclear. here we identified the host factor golgi matrix protein 130 (gm130) as a novel target of cvb3 during cvb3-induced acute pancreatitis. the viral protein vp1 interacted with gm130, disrupted gm130-grasp65 complexes, and caused gm130 degradation, which may lead to disrupt ... | 2015 | 26314804 |