| cleavage efficiencies of model substrates for ribonuclease p from escherichia coli and thermus thermophilus. | we compared cleavage efficiencies of mono-molecular and bipartite model rnas as substrates for rnase p rnas (m1 rnas) and holoenzymes from e. coli and thermus thermophilus, an extreme thermophilic eubacterium. acceptor stem and t arm of pre-trna substrates are essential recognition elements for both enzymes. impairing coaxial stacking of acceptor and t stems and omitting the t loop led to reduced cleavage efficiencies. small model substrates were less efficiently cleaved by m1 rna and rnase p fr ... | 1992 | 1281315 |
| development of plasmid cloning vectors for thermus thermophilus hb8: expression of a heterologous, plasmid-borne kanamycin nucleotidyltransferase gene. | while several thermus genes have been cloned and t. thermophilus has been shown to be transformable, molecular genetic studies of these thermophiles have been hampered by the absence of selectable cloning vectors. we have constructed a selectable plasmid by random insertion of a heterologous gene encoding a thermostable kanamycin nucleotidyltransferase activity into a cryptic, multicopy plasmid from t. thermophilus hb8. this plasmid should serve as a suitable starting point for the development o ... | 1992 | 1311546 |
| reaction of cyanide with cytochrome ba3 from thermus thermophilus: spectroscopic characterization of the fe(ii)a3-cn.cu(ii)b-cn complex suggests four 14n atoms are coordinated to cub. | cytochrome ba3 from thermus thermophilus reacts slowly with excess hcn at ph 7.4 to create a form of the enzyme in which cua, cytochrome b, and cub remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. we have examined this form of the enzyme by uv-visible, resonance raman, epr, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13c- and 15n-labeled cyanide. the results support a model in which one cn- bi ... | 1992 | 1314380 |
| purification and characterization of dna polymerases from bacillus species. | dna polymerases from bacillus stearothermophilus, bacillus caldotenax, and bacillus caldovelox were purified by chromatography on deae-cellulose, phosphocellulose, and heparin-sepharose and obtained in high yield. the enzyme preparations are free of exo- and endonuclease activities. additional purification steps, e.g., hydrophobic interaction chromatography and chromatography on a mono q column or sucrose density gradient centrifugation, are needed to obtain the enzymes in the form of homogeneou ... | 1992 | 1320608 |
| development of thermus-escherichia shuttle vectors and their use for expression of the clostridium thermocellum cela gene in thermus thermophilus. | we describe the self-selection of replication origins of undescribed cryptic plasmids from thermus aquaticus y-vii-51b (atcc 25105) and a thermus sp. strain (atcc 27737) by random insertion of a thermostable kanamycin adenyltransferase cartridge. once selected, these autonomous replication origins were cloned into the escherichia coli vector puc9 or puc19. the bifunctional plasmids were analyzed for their sizes, relationships, and properties as shuttle vectors for thermus-escherichia cloning. se ... | 1992 | 1400194 |
| sequence of the s-layer gene of thermus thermophilus hb8 and functionality of its promoter in escherichia coli. | the nucleotide sequence of the slpa gene, which is responsible for the synthesis of the s-layer protein of thermus thermophilus hb8, is described. this gene is transcribed as a unit in which the coding region is preceded by a 127-base-long leader mrna sequence. the promoter region is also recognized by the rna polymerase of escherichia coli because of the presence of homologous -35 and -10 boxes. homologies with other promoters from thermus spp. are also presented. | 1992 | 1429468 |
| molecular characterisation of a dna ligase gene of the extremely thermophilic archaeon desulfurolobus ambivalens shows close phylogenetic relationship to eukaryotic ligases. | a 3382 bp fragment containing a gene for a dna ligase from the extremely thermophilic, acidophilic, and facultatively anaerobic archaeon (archaebacterium) desulfurolobus ambivalens was cloned and sequenced. the deduced amino acid sequence (600 amino acids, 67619 molecular weight) showed 30-34% sequence identity with the atp-dependent eucaryal (eukaryotic) dna ligases of schizosaccharomyces pombe, saccharomyces cerevisiae, the human dna ligase i, and with the vaccinia dna ligase. distant similari ... | 1992 | 1437556 |
| identification of the gene encoding transcription factor nusg of thermus thermophilus. | the nusg gene of thermus thermophilus hb8 was cloned and sequenced. it is located 388 bp downstream from tufb, which is followed by the genes for ribosomal proteins l11 and l1. no equivalent to sece preceding nusg, as in escherichia coli, could be detected. the nusg gene product was overproduced in e. coli. a rabbit antiserum raised against the purified recombinant nusg reacted exclusively with one protein band of t. thermophilus crude extracts in western blot (immunoblot) analyses, and no cross ... | 1992 | 1447157 |
| molecular cloning and nucleotide sequence of the dna polymerase gene from thermus flavus. | | 1992 | 1454544 |
| structure of the phenylalanyl-trna synthetase genes from thermus thermophilus hb8 and their expression in escherichia coli. | a 4459 bp long bamhi restriction fragment containing the two genes for the thermus thermophilus hb8 phenylalanyl-trna synthetase was cloned in escherichia coli and its nucleotide sequence was determined. the genes phes and phet encode the alpha- and beta-subunits with a molecular weight of 39 and 87 kd, respectively. three conserved sequence motifs typical for class ii trna synthetases occur in the alpha-subunit. secondary structure predictions indicate that an arm composed of two anti-parallel ... | 1992 | 1508711 |
| molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, thermus thermophilus hb8. | the gene coding for isocitrate dehydrogenase of an extreme thermophile, thermus thermophilus hb8, was cloned and sequenced. this gene consists of a single open reading frame of 1,485 bp preceded by a shine-dalgarno ribosome binding site. promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. the g + c content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. on the basis of the deduced amino ac ... | 1992 | 1539996 |
| molecular cloning of a ribonuclease h (rnase hi) gene from an extreme thermophile thermus thermophilus hb8: a thermostable rnase h can functionally replace the escherichia coli enzyme in vivo. | a dna fragment encoding ribonuclease h (ec 3. 1.26.4) was isolated from an extreme thermophilic bacterium, thermus thermophilus hb8, by its ability to complement the temperature-sensitive growth of an escherichia coli rnha deficient mutant. the primary amino acid sequence showed 56% similarity to that of e. coli rnase hi but little or no homology to e. coli rnase hii. enzymes derived from thermophilic organisms tend to have fewer cysteines than their bacterial counterparts. however, t. thermophi ... | 1991 | 1653414 |
| sequence and base modifications of two phenylalanine-trnas from thermus thermophilus hb8. | | 1992 | 1738592 |
| cloning, nucleotide sequence, and engineered expression of thermus thermophilus dna ligase, a homolog of escherichia coli dna ligase. | we have cloned and sequenced the gene for dna ligase from thermus thermophilus. a comparison of this sequence and those of other ligases reveals significant homology only with that of escherichia coli. the overall amino acid composition of the thermophilic ligase and the pattern of amino acid substitutions between the two proteins are consistent with compositional biases in other thermophilic enzymes. we have engineered the expression of the t. thermophilus gene in escherichia coli, and we show ... | 1991 | 1840584 |
| cloning and expression in escherichia coli of the structural gene coding for the monomeric protein of the s layer of thermus thermophilus hb8. | the gene coding for the 100 kda monomeric protein (p100) of the s layer of thermus thermophilus hb8 has been cloned in the escherichia coli plasmid vector puc9. recombinant plasmids were selected by colony screening with anti-p100 rabbit antiserum. the gene, named slpa (for surface layer protein a), was identified in a bacterial clone harboring a hybrid plasmid, pmf4, with a 5.8-kbp insert. this plasmid consistently expressed a protein specifically recognized by anti-p100 antiserum. expression w ... | 1991 | 1885515 |
| phosphorothioate-containing rnas show mrna activity in the prokaryotic translation systems in vitro. | phosphorothioate-containing rnas were generated by transcription of coliphage t7 dna using the sp diastereomers of ribonucleoside 5'-o-(1-thiotriphosphates) and t7 rna polymerase. rnas in which a single nucleotide was substituted by the corresponding nucleoside phosphorothioate functioned as mrna in the cell-free translation systems prepared from escherichia coli and from an extreme thermophilic bacterium, thermus thermophilus. this substitution increased the efficiency of protein synthesis by s ... | 1991 | 2011526 |
| processing and termination of 23s rrna-5s rrna-trna(gly) primary transcripts in thermus thermophilus hb8. | the two 23s rrna-5s rrna-trnagly operons from the extreme thermophilic eubacterium thermus thermophilus hb8 were used to characterized the in vivo processing and termination of 23s rrna-5s rrna-trnagly primary transcripts in this organism by nuclease s1 mapping. a processing site in the pre-23s rrna 3'-flanking region is located approximately 25 nucleotides upstream of 5s rrna and precedes a putative 23s-5s rrna spacer antitermination box a. cleavage at this site and 5s rrna 5' end formation wer ... | 1991 | 2013580 |
| xylose (glucose) isomerase gene from the thermophile thermus thermophilus: cloning, sequencing, and comparison with other thermostable xylose isomerases. | the xylose isomerase gene from the thermophile thermus thermophilus was cloned by using a fragment of the streptomyces griseofuscus gene as a probe. the complete nucleotide sequence of the gene was determined. t. thermophilus is the most thermophilic organism from which a xylose isomerase gene has been cloned and characterized. the gene codes for a polypeptide of 387 amino acids with a molecular weight of 44,000. the thermus xylose isomerase is considerably more thermostable than other described ... | 1991 | 2022613 |
| cloning of alpha- and beta-galactosidase genes from an extreme thermophile, thermus strain t2, and their expression in thermus thermophilus hb27. | the genes encoding thermostable alpha- and beta-galactosidases from an extremely thermophilic bacterium, thermus strain t2, were cloned in escherichia coli. the alpha-galactosidase gene was located just downstream from the beta-galactosidase gene. the genes were introduced into thermus thermophilus hb27 with the aid of thermus cryptic plasmid ptt8, and beta-galactosidases were expressed constitutively. | 1990 | 2167630 |
| cloning and sequence analysis of tryptophan synthetase genes of an extreme thermophile, thermus thermophilus hb27: plasmid transfer from replica-plated escherichia coli recombinant colonies to competent t. thermophilus cells. | tryptophan synthetase genes (trpba) of the extreme thermophile thermus thermophilus hb27 were cloned by a novel method of direct plasmid transfer from replica-plated escherichia coli recombinant colonies to competent t. thermophilus hb27 trpb cells. the nucleotide sequences of the trpba genes were determined. the amino acid sequences deduced from the nucleotide sequences of thermus trpb and trpa were found to have identities of 54.8 and 28.7%, respectively, with those of e. coli trpb and trpa ge ... | 1990 | 2188962 |
| interaction of the isolated domain ii/iii of thermus thermophilus elongation factor tu with the nucleotide exchange factor ef-ts. | the middle and c-terminal domain (domain ii/iii) of elongation factor tu from thermus thermophilus lacking the gtp/gdp binding domain have been prepared by treating nucleotide-free protein with staphylococcus aureus v8 protease. the isolated domain ii/iii of ef-tu has a compact structure and high resistance against tryptic treatment and thermal denaturation. as demonstrated by circular dichroism spectroscopy, the isolated domain ii/iii does not contain any alpha-helical structure. nucleotide exc ... | 1990 | 2263451 |
| sequences of four trna genes adjacent to the tuf2 gene of thermus thermophilus. | | 1990 | 2336371 |
| nucleotide sequence of the thermus thermophilus hb8 rps12 and rps7 genes coding for the ribosomal proteins s12 and s7. | | 1990 | 2362824 |
| the sequence of the 6s rna gene of pseudomonas aeruginosa. | from the gram-negative eubacterium pseudomonas aeruginosa we have isolated a stable 6s rna, approximately 180 nucleotides in length. the rna was partially sequenced and identified by comparison with the known escherichia coli 6s rna sequence. southern hybridizations revealed a single copy gene coding for the 6s rna. dna from other prokaryotes, i.e. e. coli, thermus thermophilus, bacillus subtilis, bacillus stearothermophilus and halobacterium maris mortui, did not give detectable hybridization s ... | 1987 | 2438656 |
| nucleotide sequence of the 4.5s rna gene from thermus thermophilus hb8. | | 1988 | 2459659 |
| complete nucleotide sequence of a 23s ribosomal rna gene from thermus thermophilus hb8. | | 1988 | 2459660 |
| nucleotide sequence of the thermus thermophilus hb8 gene coding for elongation factor g. | | 1989 | 2587224 |
| dna sequencing with thermostable tet dna polymerase from thermus thermophilus. | | 1989 | 2602167 |
| thermus thermophilus 16s rrna is transcribed from an isolated transcription unit. | a cloned 16s rrna gene from the extreme thermophilic eubacterium thermus thermophilus hb8 was used to characterize the in vivo expression of the 16s rrna genes in this organism by nuclease s1 mapping. the gene represents an isolated transcription unit encoding solely 16s rrna. under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of escherichia coli rrn p2 promoters. the promoter-leader region was very similar to the e. ... | 1989 | 2722737 |
| properties of a copper-containing cytochrome ba3: a second terminal oxidase from the extreme thermophile thermus thermophilus. | we describe an alternate terminal oxidase found in the plasma membrane of thermus thermophilus and designate it cytochrome ba3. the enzyme consists of a single approximately equal to 35-kda polypeptide that binds one heme b molecule, one heme a molecule, and two cu ions. optical spectra suggest the presence of cytochrome b, cytochrome a3, and cua in this protein. quantitative epr and mössbauer studies of the oxidized protein indicate the presence of one low-spin ferric heme, which is assigned to ... | 1988 | 2842747 |
| the circular-dichroic properties of the 'rieske' iron-sulphur protein in the mitochondrial ubiquinol: cytochrome c reductase. | we have studied the c.d. spectra of the 'rieske' iron-sulphur protein isolated from the ubiquinol: cytochrome c reductase (bc1 complex) of bovine heart mitochondria. both the oxidized and the reduced form of the 'rieske' protein display a series of well-resolved c.d. features resembling those reported for the 'rieske'-type iron-sulphur protein purified from the bacterium thermus thermophilus [fee, findling, yoshida, hille, tarr, hearshen, dunham, day, kent & münck (1984) j. biol, chem. 259, 124- ... | 1987 | 3032159 |
| nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile thermus thermophilus. comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase. | using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, thermus thermophilus, was cloned in escherichia coli and its complete nucleotide sequence determined. the gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated mr 41,791) with an extreme bias for g or c (93.1%) in the codon third base position. comparison of the deduced amino acid sequence wit ... | 1988 | 3052437 |
| monoclonal antibodies in identifying neisseria gonorrhoeae: cautionary note. | | 1987 | 3123361 |
| partial purification and characterization of an inactive precursor of pseudomonas aeruginosa elastase. | an inactive precursor of the extracellular elastase of pseudomonas aeruginosa was extensively purified by immunoadsorption chromatography of the soluble bacterial cell fraction on a column of sepharose coupled to antielastase antibodies. sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified precursor fraction revealed two major protein bands with molecular weights of about 36,000 (p36) and 20,000 (p20) that in the absence of sodium dodecyl sulfate were associated with each ot ... | 1988 | 3125153 |
| ca2+-stabilized oligomeric protein complexes are major components of the cell envelope of "thermus thermophilus" hb8. | the major cell envelope proteins of the gram-negative thermophilic eubacterium "thermus thermophilus" gave an electrophoretical pattern characterized by two well-defined groups of bands. one of them showed up as four regularly spaced proteins (hmrps) with mrs higher than 310,000, a value corresponding to the smaller hmrp. the second one was formed by two proteins with mrs of 100,000 (p100) and 84,000 (p84). hmrps p100 and p84 were apparently located in the outer layer of the cell envelope, as in ... | 1988 | 3131301 |
| malate dehydrogenase from the thermophilic green bacterium chloroflexus aurantiacus: purification, molecular weight, amino acid composition, and partial amino acid sequence. | malate dehydrogenase (mdh; ec 1.1.1.37) from the thermophilic green nonsulfur bacterium chloroflexus aurantiacus was purified by a two-step procedure involving affinity chromatography and gel filtration. the enzyme consists of identical subunits which had molecular weights of approximately 35,000. in its active form at 55 degrees c, it formed tetramers. at lower temperatures, inactive dimers and trimers existed. antibodies against the purified enzyme were produced, and immunotitration and enzyme ... | 1988 | 3133356 |
| acceleration of starvation- and glycerol-induced myxospore formation by prior heat shock in myxococcus xanthus. | the effect of heat shock on myxococcus xanthus was investigated during both glycerol- and starvation-induced development. cells heat shocked at 40 degrees c for 1 h prior to a development-inducing signal displayed an accelerated rate of myxospore formation at 30 degrees c. additionally, m. xanthus cells heat shocked prior to glycerol induction formed a greater total number of myxospores when sporulation was complete than did control cells maintained at 30 degrees c. however, in starvation-induce ... | 1988 | 3141380 |
| predisposing factors in microbial keratitis: the significance of contact lens wear. | fifty-three patients consecutively admitted to moorfields eye hospital for treatment of suspected microbial keratitis were examined to identify predisposing factors. the principal associations were pre-existing corneal disease (22 patients (41.5%] and contact lens wear (22 patients (41.5%]. in 13 cases (25%) contact lens wear was the only factor in patients with otherwise healthy eyes using contact lenses as an alternative to spectacles. gram-negative keratitis was more frequent in the lens wear ... | 1988 | 3147696 |
| sequences implicated in the processing of thermus thermophilus hb8 23s rrna. | nuclease s1 mapping analyses were performed in order to detect processing intermediates of pre-23s rrna from thermus thermophilus hb8. two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. in the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. a series of successive intermediates in the region of the mature 3'-end implies the existenc ... | 1987 | 3313273 |
| sequence and identification of the nucleotide binding site for the elongation factor tu from thermus thermophilus hb8. | two structural genes for the thermus thermophilus elongation factor tu (tuf) were identified by cross-hybridization with the tufa gene from e. coli. the sequence of one of these tuf genes, localized on a 6.6 kb bam hi fragment, was determined and confirmed by partial protein sequencing of an authentic elongation factor tu from t. thermophilus hb8. expression of this tuf gene in e. coli minicells provided a low amount of immuno-precipitable thermophilic ef-tu. affinity labeling of the t. thermoph ... | 1987 | 3317278 |
| purification and biochemical characterization of tellurite-reducing activities from thermus thermophilus hb8. | cell-free extracts of thermus thermophilus hb8 catalyze the in vitro, nadh-dependent reduction of potassium tellurite (k2teo3). three different protein fractions with tellurite-reducing activities were identified. two exhibited high molecular weight and were composed of at least two different polypeptides. the protein in the third fraction was purified to homogeneity and had a single polypeptide chain of 53 to 54 kilodaltons, with an isoelectric point of 8.1. each enzyme was thermostable, the te ... | 1988 | 3384810 |
| nucleotide sequence of thermus thermophilus hb8 gene coding 16s rrna. | | 1988 | 3419905 |
| laboratory and clinical evaluation of isolation media for campylobacter jejuni. | six selective isolation media were evaluated for their ability to support the growth of campylobacter jejuni. colony counts of 70 isolated strains of c. jejuni and recovery studies on these strains in simulated positive feces samples demonstrated that bolton and hutchinson' charcoal, cefoperazone, deoxycholate agar and karmali's charcoal-based selective medium produced the highest recovery rates with the greatest suppression of other fecal flora. c. jejuni colonies were more easily recognized on ... | 1987 | 3429621 |
| ser-trnas from bovine mitochondrion form ternary complexes with bacterial elongation factor tu and gtp. | transfer ribonucleic acids were isolated from mitochondria of bovine heart and aminoacylated in vitro by a crude mitochondrial enzyme. ser-trnaserucn and ser-trnaseragy were isolated and characterized by partial sequencing. although these trnas possess unique structural features not found in any bacterial trna, they form a ternary complex with elongation factor from the extreme thermophilic bacterium thermus thermophilus and gtp. | 1986 | 3639440 |
| the interaction of spermine and pentamines with dna. | we studied the effects of spermine, two naturally-occurring pentamines isolated from the thermophile thermus thermophilus and one synthetic pentamine on the aggregation and 'melting' temperature of calf-thymus dna and on the b-to-z transition of poly(dg-me5dc). all pentamines caused aggregation of dna at much lower concentrations than that of spermine. concentrations that increased the melting temperature of dna and induced the b-to-z transition in poly(dg-me5dc) were different for each pentamin ... | 1987 | 3663115 |
| genetic transformation of the extreme thermophile thermus thermophilus and of other thermus spp. | genetic transformation of auxotrophs of the extreme thermophile thermus thermophilus hb27 to prototrophy was obtained at high frequencies of 10(-2) to 10(-1) when proliferating cell populations were exposed to chromosomal dna from a nutritionally independent wild-type strain. the transformation frequency was proportional to the dna concentration from 10 pg/ml to 100 ng/ml. t. thermophilus hb27 cells did not require chemical treatment to induce competence, although optimal transformation was obta ... | 1986 | 3957870 |
| a comparison of virulence of two strains of legionella pneumophila based on experimental aerosol infection of guinea-pigs. | two strains of legionella pneumophila (lp) serogroup i, of differing virulence, were examined in terms of numbers of viable organisms in tissues, pyrexia and mortality following aerosol infection. the corby strain was the more virulent, with pyrexia and deaths of guinea-pigs 3 to 6 days after infection. this strain multiplied very rapidly in the lungs to reach a peak of 5 x 10(11) viable organisms/lung. organisms were present in the blood, liver, spleen and kidney. the philadelphia-1 strain (nct ... | 1985 | 4020112 |
| the nucleotide sequence of 5s rrna from an extreme thermophile, thermus thermophilus hb8. | using 3'- and 5'-end labelling sequencing techniques, the following primary structure for thermusthermophilus hb8 5s rna could be determined: paa (u) cccccgugcccauagcggcguggaaccacccguucccauuccgaacacggaagugaaacgcgccagcgcc gaugguacuggcggacgaccgcugggagaguaggucggugcggggga (oh). this sequence is most similar to thermusaquaticus 5s rna with which it shows 85% homology. | 1981 | 6171775 |
| comparative structural analysis of eubacterial 5s rrna by oxidation of adenines in the n-1 position. | adenines in free 5s rrna from escherichia coli, bacillus stearothermophilus and thermus thermophilus have been oxidized at their n-1 position using monoperphthalic acid. the determination of the number of adenine 1-n-oxides was on the basis of uv spectroscopic data of the intact molecule. identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. implica ... | 1984 | 6201825 |
| a spite specific endonuclease from thermus thermophilus 111, tth111i. | a site specific endonuclease with novel specificity has been isolated from thermus thermophilus strain 111 and named tth111i. tth111i cleaves lambda dna into three fragments of 23.5, 25.7 and 50.8% of the total length, and cole1 dna into two fragments of nearly equal length. the sequences around tth111i cleavage sites of cole1 and lambda dna were determined by the maxam and gilbert method and the two dimensional mapping method. the results suggest that tth111i recognizes the dna sequence (formu ... | 1980 | 6243779 |
| properties of a copper-containing cytochrome c1aa3 complex: a terminal oxidase of the extreme thermophile thermus thermophilus hb8. | from the plasma membrane of thermus thermophilus hb8 we have partially purified a detergent-solubilized complex of cytochromes a and c1 that actively catalyzes the transfer of electrons from ascorbate via a redox dye to oxygen. the complex is composed of two types of polypeptides, with molecular weights of approximately 55,000 and 33,000. quantitative analysis revealed the presence of heme a, heme c, and copper in a ratio of 2:1:2, with the heme a being present at 10 +/- 1.3 nmol/mg of protein. ... | 1980 | 6244539 |
| a second site specific endonuclease from thermus thermophilus 111, tth111ii. | a second site specific endonuclease with novel specificity has been purified from thermus thermophilus strain 111 and named tth111ii. the enzyme is active at temperature up to 80 degrees c and requires mg2+ or mn2+ for endonuclease activity. tth111ii cleaves phi x174rfdna into 11 fragments and lambda na into more than 25 fragments. from the 5'-terminal sequences of tthlllii fragments of phi x174rfdna determined by the two dimensional homochromatography and the survey on nucleotide sequence of ph ... | 1980 | 6255411 |
| nuclease tt1 from thermus thermophilus hb8 has an endonuclease activity preferential to circular dnas. | homogeneously purified nuclease tt1 from thermus thermophilus hb8 is known as an exonuclease to produce 5'-mononucleotides. besides the exonuclease activity, nuclease tt1 also possesses endonuclease activity preferential to superhelical (form i) and single-stranded circular dna. although the rate of cleavage is slower than that of form i, covalently closed circular dna (form i') is also cleaved. form i dna was nicked to yield relaxed circles (form ii) first, and was then nicked at the opposite s ... | 1980 | 6258147 |
| purification and characterization of two new modification methylases: mclai from caryophanon latum l and mtaqi from thermus aquaticus yti. | a method for detecting type ii modification methylases and determining their methylation site by assaying the ability of methylated dna to be cleaved by heterologous restriction enzymes is described and applied to the isolation of the restriction modification methylases from thermus thermophilus hb8, thermus aquaticus yti and caryophanon latum l. m.taqi is shown to have a methylation specificity identical to m.thi (tcgmea). m.clai methylates at adenine and protects a subset of tthi sites indicat ... | 1981 | 6278447 |
| the number of ribosomal rna genes in thermus thermophilus hb8. | we have examined the number of rrna genes in thermus thermophilus hb8 by hybridization of bam hi -, hind iii - and pst i - digests of dna to 3'- (3 2p) 23s, 16s and 5s rrnas according to the southern procedure. the restriction gels gave two radioactive bands with 23s and 5s rrna. furthermore, band positions were indistinguishable from one another when 23s and 5s rrnas were used as probes to bam hi and hind iii digests, indicating that each band contains sequences corresponding to the 3'-end of 2 ... | 1984 | 6322133 |
| terminal heterogeneity and corrections of the nucleotide sequence of 5s rrna from an extreme thermophile, thermus thermophilus hb8. | the nucleotide sequence of 5s rrna from an extreme thermophile thermusthermophilus hb8 has been re-examined and determined as [formula: see text] the present study could resolve previously ambiguous residues and find two additional residues (g(8 3), c(9 7)), g at position 89 and two terminal heterogeneities which are exactly the same as reported with thermusaquaticus 5s rrna.images | 1983 | 6828381 |
| consensus structure and evolution of 5s rrna. | a consensus structure model of 5s rrna presenting all conserved nucleotides in fixed positions has been deduced from the primary and secondary structure of 71 eubacterial, archaebacterial, eukaryotic cytosolic and organellar molecules. phylogenetically related groups of molecules are characterized by nucleotide deletions in helices iii, iv and v, and by potential base pair interactions in helix iv. the group-specific deletions are correlated with the early branching pattern of a dendrogram calcu ... | 1983 | 6835839 |
| thermally induced biosynthesis of 2'-o-methylguanosine in trna from an extreme thermophile, thermus thermophilus hb27. | the contents of 2'-o-methylguanosine and 1-methyladenosine in unfractionated trna obtained from thermus thermophilus hb27 were found to increase significantly when the bacterium was grown at a higher temperature (80 degrees c). s-adenosyl-l-methionine-dependent trna (guanosine-2')-methyltransferase (ec 2.1.1.34) and trna (adenine-1)-methyltransferase (ec 2.1.1.36) were detected in a cell-free extract of the thermophile, and both of them were partially purified. trna (guanosine-2')-methyltransfer ... | 1980 | 6990416 |
| glycolipids from some extreme thermophilic bacteria belonging to the genus thermus. | the lipids of thermus aquaticus yt1, thermus thermophilus hb8, thermus sp. strains h and j (from icelandic hot springs), and thermus sp. strain nh (from domestic hot water) have been investigated. each strain contained two major components, a glycolipid and a glycophospholipid, which have been isolated and analyzed. all of the strains contained as the principal component (41 to 57% of total lipid) a diacyldiglycosyl-(n-acyl)glycosaminylglucosylglycerol, but the five glycolipids differed in carbo ... | 1982 | 7054151 |
| contribution of structural elements to thermus thermophilus ribonuclease p rna function. | we have performed a deletion and mutational analysis of the catalytic ribonuclease (rnase) p rna subunit from the extreme thermophilic eubacterium thermus thermophilus hb8. catalytic activity was reduced 600-fold when the terminal helix, connecting the 5' and 3' ends of the molecule, was destroyed by deleting 15 nucleotides from the 3' end. in comparison, the removal of a large portion (94 nucleotides, about one quarter of the rna) of the upper loop region impaired function only to a relatively ... | 1994 | 7525270 |
| crystal structure of histidyl-trna synthetase from escherichia coli complexed with histidyl-adenylate. | the crystal structure at 2.6 a of the histidyl-trna synthetase from escherichia coli complexed with histidyl-adenylate has been determined. the enzyme is a homodimer with a molecular weight of 94 kda and belongs to the class ii of aminoacyl-trna synthetases (aars). the asymmetric unit is composed of two homodimers. each monomer consists of two domains. the n-terminal catalytic core domain contains a six-stranded antiparallel beta-sheet sitting on two alpha-helices, which can be superposed with t ... | 1995 | 7556055 |
| crystal structure of glycyl-trna synthetase from thermus thermophilus. | the sequence and crystal structure at 2.75 a resolution of the homodimeric glycyl-trna synthetase from thermus thermophilus, the first representative of the last unknown class ii synthetase subgroup, have been determined. the three class ii synthetase sequence motifs are present but the structure was essential for identification of motif 1, which does not possess the proline previously believed to be an essential class ii invariant. nevertheless, crucial contacts with the active site of the othe ... | 1995 | 7556056 |
| horizontal transference of s-layer genes within thermus thermophilus. | the s-layers of thermus thermophilus hb27 and t. thermophilus hb8 are composed of protein units of 95 kda (p95) and 100 kda (p100), respectively. we have selected s-layer deletion mutants from both strains by complete replacement of the slpa gene. mutants of the two strains showed similar defects in growth and morphology and overproduced an external cell envelope inside of which cells remained after division. however, the nature of this external layer is strain specific, being easily stained and ... | 1995 | 7559330 |
| molecular characterization and t-cell-stimulatory capacity of mycobacterium leprae antigen t5. | a mycobacterium leprae lambda gt11 clone designated t5 has previously been selected with sera from tuberculoid leprosy patients. sequence analysis of this clone revealed the presence of two overlapping open reading frames (orfs) present on the two cdna strands. the first orf codes for the serologically recognized antigen, which was fused with the lacz gene in the lambda gt11 clone. the second orf, present on the complementary strand, displays strong sequence homology with the aspartyl-trna synth ... | 1995 | 7591123 |
| effect of genome size and rrn gene copy number on pcr amplification of 16s rrna genes from a mixture of bacterial species. | in order to assess the effect of genome size and number of 16s rrna genes (rdnas) on the quantities of pcr-generated partial 16s rdna fragments, equimolar amounts of dna from pairs of different species for which these parameters are known were subjected to gene amplification. the experimentally determined ratio of pcr products obtained, as determined by image analysis of sybr-green i-stained amplification products, corresponded well with the predicted ratio calculated from the number of rrn gene ... | 1995 | 7618894 |
| molecular cloning of the pyre gene from the extreme thermophile thermus flavus. | mutants of the extreme thermophile thermus flavus in the pyrimidine biosynthetic pathway (pyr-) were isolated by resistance to 5-fluoroorotic acid. the pyre gene, which codes for the orotate phosphoribosyltransferase, was cloned by recombination with one of the isolated pyr- t. flavus mutant strains. it was subcloned by complementation of an escherichia coli pyre mutant strain and was sequenced. the deduced polypeptide sequence extends over 183 amino acids. several independent pyr- mutations wer ... | 1995 | 7635839 |
| structure of peptidoglycan from thermus thermophilus hb8. | the composition and structure of peptidoglycan (murein) extracted from the extreme thermophilic eubacterium thermus thermophilus hb8 are presented. the structure of 29 muropeptides, accounting for more than 85% of total murein, is reported. the basic monomeric subunit consists of n-acetylglucosamine-n-acetylmuramic acid-l-ala-d-glu-l-orn-d-ala-d-ala, acylated at the delta-nh2 group of orn by a gly-gly dipeptide. in a significant proportion (about 23%) of total muropeptides, the n-terminal gly is ... | 1995 | 7665471 |
| sequence of trna(asp) from thermus thermophilus hb8. | | 1993 | 7692402 |
| sulredoxin: a novel iron-sulfur protein of the thermoacidophilic archaeon sulfolobus sp. strain 7 with a rieske-type [2fe-2s] center. | a novel pink [2fe-2s] protein has been purified from the cytosol fraction of the thermoacidophilic archaeon sulfolobus sp. strain 7 (originally named sulfolobus acidocaldarius 7) and called "sulredoxin." its absorption, circular dichroism, and electron paramagnetic resonance spectra suggest the presence of a rieske-type [2fe-2s] cluster (g-factors of 2.01, 1.91, and 1.79; average g-factor [gav] = 1.90) which is remarkably similar to that of thermus thermophilus respiratory rieske fes protein (j. ... | 1995 | 7730295 |
| modeling substrate binding in thermus thermophilus isopropylmalate dehydrogenase. | the thermus thermophilus 3-isopropylmalate dehydrogenase (ipmdh) and escherichia coli isocitrate dehydrogenase (icdh) are two functionally and evolutionarily related enzymes with distinct substrate specificities. to understand the determinants of substrate specificities of the two proteins, the substrate and coenzyme in ipmdh were docked into their respective binding sites based on the published structure for apo ipmdh and its sequence and structural homology to icdh. this modeling study suggest ... | 1995 | 7773180 |
| genetic and molecular analysis of the trna-tufb operon of the myxobacterium stigmatella aurantiaca. | the tufb gene, encoding elongation factor tu (ef-tu), from the myxobacterium stigmatella aurantiaca was cloned and sequenced. it is preceded by four trna genes, the first ever described in myxobacteria. the trna synthesized from these genes and the general organization of the locus seem identical to that of escherichia coli, but differences of potential importance were found in the trna sequences and in the intergenic regions. the primary structure of ef-tu was deduced from the tufb dna sequence ... | 1995 | 7784178 |
| phosphorylation of ctp synthetase from saccharomyces cerevisiae by protein kinase c. | phosphorylation of ctp synthetase (ec 6.3.4.2, utp:ammonia ligase (adp-forming)) from saccharomyces cerevisiae protein kinase c was examined. using pure ctp by synthetase as a substrate, protein kinase c activity was dose- and time-dependent and required calcium, diacylglycerol, and phosphatidylserine for full activation. protein kinase c activity was also dependent on the concentration of ctp synthetase. protein kinase c phosphorylated ctp synthetase on serine and threonine residues in vitro wh ... | 1995 | 7797479 |
| crystal structure of inorganic pyrophosphatase from thermus thermophilus. | the 3-dimensional structure of inorganic pyrophosphatase from thermus thermophilus (t-ppase) has been determined by x-ray diffraction at 2.0 a resolution and refined to r = 15.3%. the structure consists of an antiparallel closed beta-sheet and 2 alpha-helices and resembles that of the yeast enzyme in spite of the large difference in size (174 and 286 residues, respectively), little sequence similarity beyond the active center (about 20%), and different oligomeric organization (hexameric and dime ... | 1994 | 7920256 |
| pulvomycin-resistant mutants of e.coli elongation factor tu. | this paper reports the generation of escherichia coli mutants resistant to pulvomycin. together with targeted mutagenesis of the tufa gene, conditions were found to overcome membrane impermeability, thereby allowing the selection of three mutants harbouring elongation factor (ef)-tu arg230-->cys, arg333-->cys or thr334-->ala which confer pulvomycin resistance. these mutations are clustered in the three-domain junction interface of the crystal structure of the gtp form of thermus thermophilus ef- ... | 1994 | 7957075 |
| characterization of the thermus thermophilus locus encoding peptide deformylase and methionyl-trna(fmet) formyltransferase. | an escherichia coli strain with thermosensitive expression of the gene encoding peptide deformylase (fms) has been constructed. at nonpermissive temperatures, this strain fails to grow. the essential character of the fms gene was further used to clone by heterologous complementation the locus corresponding to thermus thermophilus peptide deformylase. the cloned fragment also carries the methionyl-trna(fmet) formyltransferase gene (fmt). it is located immediately downstream from the fms gene, as ... | 1994 | 7961514 |
| a structural role for arginine in proteins: multiple hydrogen bonds to backbone carbonyl oxygens. | we propose that arginine side chains often play a previously unappreciated general structural role in the maintenance of tertiary structure in proteins, wherein the positively charged guanidinium group forms multiple hydrogen bonds to backbone carbonyl oxygens. using as a criterion for a "structural" arginine one that forms 4 or more hydrogen bonds to 3 or more backbone carbonyl oxygens, we have used molecular graphics to locate arginines of interest in 4 proteins: arg 180 in thermus thermophilu ... | 1994 | 8003972 |
| crystal structure of a prokaryotic aspartyl trna-synthetase. | the crystal structure of thermus thermophilus aspartyl trna-synthetase (asprs) refined at 2.5 a resolution is described. this molecular structure is a textbook illustration of the modular organization of aminoacyl-trna synthetases. in addition to the three domains found in yeast asprs, each monomer exhibits a module specific to prokaryotic enzymes, which corresponds to a helix-turn-helix motif in yeast asprs, a domain implicated in the stabilization of the complex with trna. its topology matches ... | 1994 | 8045252 |
| the crystal structure of elongation factor g complexed with gdp, at 2.7 a resolution. | elongation factor g (ef-g) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, ef-tu--whose structure is already known--it is a member of the gtpase superfamily. we have determined the crystal structure of ef-g--gdp from thermus thermophilus. it is an elongated molecule whose large, n-terminal domain resembles the g domain of ef-tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in ef-t ... | 1994 | 8070396 |
| three-dimensional structure of the ribosomal translocase: elongation factor g from thermus thermophilus. | the crystal structure of thermus thermophilus elongation factor g without guanine nucleotide was determined to 2.85 a. this gtpase has five domains with overall dimensions of 50 x 60 x 118 a. the gtp binding domain has a core common to other gtpases with a unique subdomain which probably functions as an intrinsic nucleotide exchange factor. domains i and ii are homologous to elongation factor tu and their arrangement, both with and without gdp, is more similar to elongation factor tu in complex ... | 1994 | 8070397 |
| domain structure of the acetogenium kivui surface layer revealed by electron crystallography and sequence analysis. | the three-dimensional structure of the acetogenium kivui surface layer (s-layer) has been determined to a resolution of 1.7 nm by electron crystallographic techniques. two independent reconstructions were made from layers negatively stained with uranyl acetate and na-phosphotungstate. the s-layer has p6 symmetry with a center-to-center spacing of approximately 19 nm. within the layer, six monomers combine to form a ring-shaped core surrounded by a fenestrated rim and six spokes that point toward ... | 1994 | 8113161 |
| crystal structure of the ribosomal protein s6 from thermus thermophilus. | the amino acid sequence and crystal structure of the ribosomal protein s6 from the small ribosomal subunit of thermus thermophilus have been determined. s6 is a small protein with 101 amino acid residues. the 3d structure, which was determined to 2.0 a resolution, consists of a four-stranded anti-parallel beta-sheet with two alpha-helices packed on one side. similar folding patterns have been observed for other ribosomal proteins and may suggest an original rna-interacting motif. related topolog ... | 1994 | 8137808 |
| properties of the lysyl-trna synthetase gene and product from the extreme thermophile thermus thermophilus. | a dna region carrying lyss, the gene encoding the lysyl-trna synthetase, was cloned from the extreme thermophile prokaryote thermus thermophilus vk-1 and sequenced. the analysis indicated an open reading frame encoding a protein of 492 amino acids. this putative protein has significant homologies to previously sequenced lysyl-trna synthetases and displays the three motifs characteristic of class ii aminoacyl-trna synthetases. the t. thermophilus lyss gene was overexpressed in escherichia coli by ... | 1994 | 8169220 |
| overexpression of genes of an extreme thermophile thermus thermophilus, in escherichia coli cells. | the 3-isopropylmalate dehydrogenase gene from an extreme thermophile, thermus thermophilus, was not expressed in escherichia coli unless a palindromic structure around the ribosome binding site was eliminated or a leader open reading frame was introduced into the upstream flanking region of the gene. this report suggests a way to increase the expression of this gene, with a high g+c content, in e. coli. | 1994 | 8169232 |
| effector region of the translation elongation factor ef-tu.gtp complex stabilizes an orthoester acid intermediate structure of aminoacyl-trna in a ternary complex. | trna(val) from escherichia coli was aminoacylated with [1-13c]valine and its complex with thermus thermophilus elongation factor ef-tu.gtp was analyzed by 13c nmr spectroscopy. the results suggest that the aminoacyl residue of the valyl-trna in ternary complex with bacterial ef-tu and gtp is not attached to trna by a regular ester bond to either a 2'- or 3'-hydroxyl group; instead, an intermediate orthoester acid structure with covalent linkage to both vicinal hydroxyls of the terminal adenosine ... | 1994 | 8183898 |
| pullulanase of thermoanaerobacterium thermosulfurigenes em1 (clostridium thermosulfurogenes): molecular analysis of the gene, composite structure of the enzyme, and a common model for its attachment to the cell surface. | the complete pullulanase gene (amyb) from thermoanaerobacterium thermosulfurigenes em1 was cloned in escherichia coli, and the nucleotide sequence was determined. the reading frame of amyb consisted of 5,586 bp encoding an exceptionally large enzyme of 205,991 da. sequence analysis revealed a composite structure of the pullulanase consisting of catalytic and noncatalytic domains. the n-terminal half of the protein contained a leader peptide of 35 amino acid residues and the catalytic domain, whi ... | 1994 | 8195085 |
| molecular cloning and sequence analysis of the crtb gene of thermus thermophilus hb27, an extreme thermophile producing carotenoid pigments. | we have cloned and sequenced a 1.5-kb chromosomal fragment of thermus thermophilus which promoted the overproduction of carotenoids in t. thermophilus. an open reading frame (orf-a) coding for a polypeptide with 289 amino acids was responsible for carotenoid overproduction. the putative orf-a protein showed significant homology with the amino acid sequences of crtb gene products (phytoene syntheses) of other microorganisms. the clone containing the orf-a on a multicopy plasmid produced about thr ... | 1993 | 8215386 |
| identification of the gene encoding the mitochondrial elongation factor g in mammals. | protein synthesis in cytosolic and rough endoplasmic reticulum associated ribosomes is directed by factors, many of which have been well characterized. although these factors have been the subject of intense study, most of the corresponding factors regulating protein synthesis in the mitochondrial ribosomes remain unknown. in this report we present the cloning and initial characterization of the gene encoding the rat mitochondrial elongation factor-g (ref-gmt). the rat gene encoding ef-gmt (rmef ... | 1993 | 8332461 |
| cloning, sequencing, and expression in escherichia coli of the gene coding for phosphofructokinase in lactobacillus bulgaricus. | a fragment of 1,185 bp containing the gene coding for phosphofructokinase (atp:d-fructose-6-phosphate-1-phosphotransferase; ec 2.7.1.11) in lactobacillus bulgaricus has been cloned, sequenced, and expressed in escherichia coli. the amino acid sequence of this enzyme was homologous to those of the atp-dependent phosphofructokinases from e. coli, thermus thermophilus, spiroplasma citri, and bacillus stearothermophilus, suggesting that these enzymes have closely related structures despite their dif ... | 1993 | 8366023 |
| detection of hepatitis c virus rna by a combined reverse transcription-polymerase chain reaction assay. | amplification of rna by the polymerase chain reaction (pcr) is normally a two-step process requiring separate enzymes and buffer conditions. we describe a combined reverse transcription-pcr (rt-pcr) assay for hepatitis c virus (hcv) rna amplification in which a single enzyme and buffer condition are used. in this assay, both the rt and pcr steps are carried out with the thermoactive dna polymerase of thermus thermophilus. a transcription vector containing hcv sequences has also been constructed ... | 1993 | 8385151 |
| genomic restriction map of the extremely thermophilic bacterium thermus thermophilus hb8. | a physical map of the chromosome of the extremely thermophilic eubacterium thermus thermophilus hb8 has been constructed by using pulsed-field gel electrophoresis techniques. a total of 26 cleavage sites for the rarely cutting restriction endonucleases hpai, muni, and ndei were located on the genome. on the basis of the sizes of the restriction fragments generated, the genome size was estimated to be 1.74 mbp, which is significantly smaller than the chromosomes of escherichia coli and other meso ... | 1993 | 8416889 |
| comparison of the crystal structures of genetically engineered human manganese superoxide dismutase and manganese superoxide dismutase from thermus thermophilus: differences in dimer-dimer interaction. | the three-dimensional x-ray structure of a recombinant human mitochondrial manganese superoxide dismutase (mnsod) (chain length 198 residues) was determined by the method of molecular replacement using the related structure of mnsod from thermus thermophilus as a search model. this tetrameric human mnsod crystallizes in space group p2(1)2(1)2 with a dimer in the asymmetric unit (wagner, u.g., werber, m.m., beck, y., hartman, j.r., frolow, f., & sussman, j.l., 1989, j. mol. biol. 206, 787-788). r ... | 1993 | 8495200 |
| footprinting of trna(phe) transcripts from thermus thermophilus hb8 with the homologous phenylalanyl-trna synthetase reveals a novel mode of interaction. | the phosphates of the trna(phe) transcript from thermus thermophilus interacting with the cognate synthetase were determined by footprinting. backbone bond protection against cleavage by iodine of the phosphorothioate-containing transcripts was found in the anticodon stem-loop, the d stem-loop and the acceptor stem and weak protection was also seen in the variable loop. most of the protected phosphates correspond to regions around known identity elements of trna(phe). enhancement of cleavage at ... | 1995 | 8524648 |
| the role of glutamate 87 in the kinetic mechanism of thermus thermophilus isopropylmalate dehydrogenase. | the kinetic mechanism of the oxidative decarboxylation of 2r,3s-isopropylmalate by the nad-dependent isopropylmalate dehydrogenase of thermus thermophilus was investigated. initial rate results typical of random or steady-state ordered sequential mechanisms are obtained for both the wild-type and two mutant enzymes (e87g and e87q) regardless of whether natural or alternative substrates (2r-malate, 2r,3s-tartrate and/or nadp) are utilized. initial rate data fail to converge on a rapid equilibrium ... | 1995 | 8535253 |
| slpm, a gene coding for an "s-layer-like array" overexpressed in s-layer mutants of thermus thermophilus hb8. | s-layer deletion mutants of thermus thermophilus hb8 overproduce a regular array which surrounds groups of several cells. averages of two-dimensional projections revealed a detailed architecture similar in general morphology and unit cell dimensions to that of the s-layer but having a different mass distribution. the structural components of these "s-layer-like arrays" are a group of three proteins of 52 (p52), 50 (p50), and 36 (p36) kda, which are overexpressed in s-layer mutants. these three p ... | 1996 | 8550453 |
| further stabilization of 3-isopropylmalate dehydrogenase of an extreme thermophile, thermus thermophilus, by a suppressor mutation method. | we succeeded in further improvement of the stability of 3-isopropylmalate dehydrogenase (ipmdh) from an extreme thermophile, thermus thermophilus, by a suppressor mutation method. we previously constructed a chimeric ipmdh consisting of portions of thermophile and mesophile enzymes. the chimeric enzyme is less thermostable than the thermophile enzyme. the gene encoding the chimeric enzyme was subjected to random mutagenesis and integrated into the genome of a leub-deficient mutant of t. thermoph ... | 1996 | 8550506 |
| structural similarities in the noncatalytic domains of phenylalanyl-trna and biotin synthetases. | detailed comparison between the structures of the escherichia coli biotin synthetase/repressor protein (bira) and the recently solved thermus thermophilus phenylalanyl-trna synthetase (phers) reveals significant similarities outside their respective catalytic domains. these comprise a dna-binding alpha+beta domain and an src-homology 3 (sh3)-like domain that were observed in both enzymes. this similarity provides a novel example in which all domains of one multidomain protein appear to be consti ... | 1995 | 8563641 |
| inhibition of pcr by aqueous and vitreous fluids. | the detection of viral nucleic acids in intraocular fluids and tissues by pcr has become increasingly important in clinical ophthalmology. while much attention has been directed toward minimizing false-positive reactions resulting from specimen contamination or amplicor carryover, relatively little attention has been given to the causes of false-negative pcrs. this report describes a pcr inhibitor in normal aqueous and vitreous fluids that can produce false-negative pcr results. as little as 0.5 ... | 1995 | 8567898 |
| the reca protein as a model molecule for molecular systematic studies of bacteria: comparison of trees of recas and 16s rrnas from the same species. | the evolution of the reca protein was analyzed using molecular phylogenetic techniques. phylogenetic trees of all currently available complete reca proteins were inferred using multiple maximum parsimony and distance matrix methods. comparison and analysis of the trees reveal that the inferred relationships among these proteins are highly robust. the reca trees show consistent subdivisions corresponding to many of the major bacterial groups found in trees of other molecules including the alpha, ... | 1995 | 8587109 |
| antideterminants present in minihelix(sec) hinder its recognition by prokaryotic elongation factor tu. | during protein biosynthesis, all aminoacylated elongator trnas except selenocysteine-inserting trna sec form ternary complexes with activated elongation factor. trna sec is bound by its own translation factor, an elongation factor analogue, e.g. the selb factor in prokaryotes. an apparent reason for this discrimination could be related to the unusual length of trna sec amino acid-acceptor branch formed by 13 bp. however, it has been recently shown that an aspartylated minihelix of 13 bp derived ... | 1996 | 8599948 |
| mismatch dna recognition protein from an extremely thermophilic bacterium, thermus thermophilus hb8. | the muts gene, implicated in dna mismatch repair, was cloned from an extremely thermophilic bacterium, thermus thermophilus hb8. its nucleotide sequence encoded a 819-amino acid protein with a molecular mass of 91.4 kda. its predicted amino acid sequence showed 56 and 39% homology with escherichia coli muts and human hmsh2 proteins, respectively. the t.thermophilus muts gene complemented the hypermutability of the e.coli muts mutant, suggesting that t.thermophilus muts protein was active in e.co ... | 1996 | 8604304 |