| an integrative analysis of four cesa isoforms specific for fiber cellulose production between gossypium hirsutum and gossypium barbadense. | cotton fiber is an excellent model system of cellulose biosynthesis; however, it has not been widely studied due to the lack of information about the cellulose synthase (cesa) family of genes in cotton. in this study, we initially identified six full-length cesa genes designated as ghcesa5-ghcesa10. phylogenetic analysis and gene co-expression profiling revealed that cesa1, cesa2, cesa7, and cesa8 were the major isoforms for secondary cell wall biosynthesis, whereas cesa3, cesa5, cesa6, cesa9, a ... | 2013 | 23508664 |
| cotton fiber cell walls of gossypium hirsutum and gossypium barbadense have differences related to loosely-bound xyloglucan. | cotton fiber is an important natural textile fiber due to its exceptional length and thickness. these properties arise largely through primary and secondary cell wall synthesis. the cotton fiber of commerce is a cellulosic secondary wall surrounded by a thin cuticulated primary wall, but there were only sparse details available about the polysaccharides in the fiber cell wall of any cotton species. in addition, gossypium hirsutum (gh) fiber was known to have an adhesive cotton fiber middle lamel ... | 2013 | 23457548 |
| repeated polyploidization of gossypium genomes and the evolution of spinnable cotton fibres. | polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (myr) ago, and allopolyploidy reuniting divergent gossypium genomes approximately 1-2 myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (gossypium hirsutum and gossypium barb ... | 2012 | 23257886 |
| mapping quantitative trait loci for lint yield and fiber quality across environments in a gossypium hirsutum × gossypium barbadense backcross inbred line population. | identification of stable quantitative trait loci (qtls) across different environments and mapping populations is a prerequisite for marker-assisted selection (mas) for cotton yield and fiber quality. to construct a genetic linkage map and to identify qtls for fiber quality and yield traits, a backcross inbred line (bil) population of 146 lines was developed from a cross between upland cotton (gossypium hirsutum) and egyptian cotton (gossypium barbadense) through two generations of backcrossing u ... | 2013 | 23064252 |
| interspecific chromosomal effects on agronomic traits in gossypium hirsutum by ad analysis using intermated g. barbadense chromosome substitution lines. | the untapped potential of the beneficial alleles from gossypium barbadense l. has not been well utilized in g. hirsutum l. (often referred to as upland cotton) breeding programs. this is primarily due to genomic incompatibility and technical challenges associated with conventional methods of interspecific introgression. in this study, we used a hypoaneuploid-based chromosome substitution line as a means for systematically introgressing g. barbadense doubled-haploid line '3-79' germplasm into a c ... | 2013 | 22945267 |
| the draft genome of a diploid cotton gossypium raimondii. | we have sequenced and assembled a draft genome of g. raimondii, whose progenitor is the putative contributor of the d subgenome to the economically important fiber-producing cotton species gossypium hirsutum and gossypium barbadense. over 73% of the assembled sequences were anchored on 13 g. raimondii chromosomes. the genome contains 40,976 protein-coding genes, with 92.2% of these further confirmed by transcriptome data. evidence of the hexaploidization event shared by the eudicots as well as o ... | 2012 | 22922876 |
| molecular evolution and phylogenetic analysis of genes related to cotton fibers development from wild and domesticated cotton species in gossypium. | the domestication of both diploid and tetraploid cotton species was carried out for fiber utilization. to understand the origin and domestication of fibers, 18 genes related to fiber development were individually cloned and sequenced from 22 different cotton species. their structures, phylogenetic relationship and molecular evolution were further studied. in the orthologous and homeologous loci of the 18 genes, the sequence and structure of 72.22% were conserved and 27.78% were diverse. tree top ... | 2012 | 22381639 |
| inheritance of long staple fiber quality traits of gossypium barbadense in g. hirsutum background using csils. | gossypium hirsutum is a high yield cotton species that exhibits only moderate performance in fiber qualities. a promising but challenging approach to improving its phenotypes is interspecific introgression, the transfer of valuable traits or genes from the germplasm of another species such as g. barbadense, an important cultivated extra long staple cotton species. one set of chromosome segment introgression lines (csils) was developed, where tm-1, the genetic standard in g. hirsutum, was used as ... | 2012 | 22297564 |
| overexpression of ghsusa1 increases plant biomass and improves cotton fiber yield and quality. | cotton (gossypium spp.) is an important economic crop and the largest source of textile fiber in the world. however, to date, only a few genes have been identified that exhibit critical roles in fiber development, and few has shown positive effects on fiber yield and quality in transgenic cotton. here, we report the characterization of a novel sucrose synthase (susa1) gene from a superior quality fiber germplasm line 7235 in gossypium hirsutum. by association analysis, ghsusa1 was highly correla ... | 2012 | 22044435 |
| among-sampler variation in sweep net samples of adult lygus hesperus (hemiptera: miridae) in cotton. | the sweep net is a standard sampling method for adults of the western tarnished plant bug, lygus hesperus knight (hemiptera: miridae), in cotton (gossypium spp.). however, factors that influence the relationship between true population levels and population estimates obtained using the sweep net are poorly documented. improved understanding of these factors is needed for the development and application of refined treatment thresholds. recent reports of significant among-sampler differences in sw ... | 2011 | 21510222 |
| structure, expression differentiation and evolution of duplicated fiber developmental genes in gossypium barbadense and g. hirsutum. | both gossypium hirsutum and g. barbadense probably originated from a common ancestor, but they have very different agronomic and fiber quality characters. here we selected 17 fiber development-related genes to study their structures, tree topologies, chromosomal location and expression patterns to better understand the interspecific divergence of fiber development genes in the two cultivated tetraploid species. | 2011 | 21349199 |
| metabolite and mineral analyses of cotton near-isogenic lines introgressed with qtls for productivity and drought-related traits. | quantitative trait loci (qtls) for yield and drought-related traits were exchanged via marker-assisted selection between elite cultivars of two cotton species, gossypium barbadense (gb) cv. f-177 and gossypium hirsutum (gh) cv. siv'on. three of the resultant near-isogenic lines (nils), each introgressed with a different qtl region, expressed an advantage in osmotic adjustment (oa) and other drought-related traits relative to their recipient parents. these nils and the parental genotypes were fie ... | 2011 | 21143238 |
| comparative expression of mirna genes and mirna-based aflp marker analysis in cultivated tetraploid cottons. | micrornas (mirnas) are a class of small non-coding rnas that down-regulate gene expression in a sequence specific manner to control plant growth and development. the identification and characterization of mirnas are critical steps in finding their target genes and elucidating their functions. the objective of the present study was to assess the genetic variation of mirna genes through expression comparisons and mirna-based aflp marker analysis. seven mirnas were first selected for rt-pcr and fou ... | 2011 | 21134704 |
| sampling nucleotide diversity in cotton. | cultivated cotton is an annual fiber crop derived mainly from two perennial species, gossypium hirsutum l. or upland cotton, and g. barbadense l., extra long-staple fiber pima or egyptian cotton. these two cultivated species are among five allotetraploid species presumably derived monophyletically between g. arboreum and g. raimondii. genomic-based approaches have been hindered by the limited variation within species. yet, population-based methods are being used for genome-wide introgression of ... | 2009 | 19840401 |
| total and percent atropisomers of gossypol and gossypol-6-methyl ether in seeds from pima cottons and accessions of gossypium barbadense l. | gossypol occurs naturally in the seed, foliage, and roots of the cotton plant ( gossypium ) as atropisomers due to restricted rotation around the binaphthyl bond. the atropisomers differ in their biological activities. (-)-(r)-gossypol is more toxic and exhibits significantly greater anticancer activity than the (+)-(s)-atropisomer. most commercial upland ( gossypium hirsutum ) cottonseeds have an (r)- to (s)-gossypol ratio of approximately 2:3, but some pima ( gossypium barbadense ) seeds have ... | 2009 | 19113939 |
| [cotton fiber quality traits were controlled mainly by maternal plant genotype]. | hai1, a gossypium barbadense l. variety with super fiber quality, and ccri36 and zhong221, two upland cotton cultivars (gossypium hirsutum l.), were used as recurrent parents to develop two backcross combinations of ccri36xhai1 and zhong221xhai1. fiber quality of inter-crossing bolls and self-crossing bolls were analyzed from different generations of the two combinations. the results showed that there existed significant difference in the average value, pole difference and cv% of fiber quality t ... | 2008 | 19073557 |
| identification of differentially expressed genes associated with cotton fiber development in a chromosomal substitution line (cs-b22sh). | one of the impediments in the genetic improvement of cotton fiber is the paucity of information about genes associated with fiber development. availability of chromosome arm substitution line cs-b22sh (chromosome 22 short arm substitution from 3-79 (gossypium barbadense) into a tm-1 (gossypium hirsutum) background) provides a novel opportunity to study fiber-associated genes because previous studies revealed this line was associated with some superior fiber quality traits compared to tm-1. we us ... | 2008 | 18043952 |
| genetic mapping of new cotton fiber loci using est-derived microsatellites in an interspecific recombinant inbred line cotton population. | there is an immediate need for a high-density genetic map of cotton anchored with fiber genes to facilitate marker-assisted selection (mas) for improved fiber traits. with this goal in mind, genetic mapping with a new set of microsatellite markers [comprising both simple (ssr) and complex (csr) sequence repeat markers] was performed on 183 recombinant inbred lines (rils) developed from the progeny of the interspecific cross gossypium hirsutum l. cv. tm1 x gossypium barbadense l. pima 3-79. micro ... | 2005 | 16187061 |
| cleaved aflp (caflp), a modified amplified fragment length polymorphism analysis for cotton. | in certain plant species including cotton (gossypium hirsutum l. or gossypium barbadense l.), the level of amplified fragment length polymorphism (aflp) is relatively low, limiting its utilization in the development of genome-wide linkage maps. we propose the use of frequent restriction enzymes in combination with aflp to cleave the aflp fragments, called cleaved aflp analysis (caflp). using four upland cotton genotypes (g. hirsutum) and three pima cotton (g. barbadense), we demonstrated that ca ... | 2005 | 16133304 |
| a comparison of genetic maps constructed from haploid and bc1 mapping populations from the same crossing between gossypium hirsutum l. and gossypium barbadense l. | simple sequence repeat (ssr) genetic maps have been separately constructed based on doubled haploid (dh) and (or) haploid and bc1 populations from the same cross between gossypium hirsutum l. 'tm-1' and gossypium barbadense l. 'hai7124'. the bc1 population was produced by pollinating individual plants of the 'tm-1' x 'hai7124' f1 with 'tm-1', whereas the dh and (or) haploid population developed from the offspring of vsg x ('tm-1' x 'hai7124'). vsg is a virescently marked semigamy line of gossypi ... | 2005 | 16121235 |
| occurrence of (+)- and (-)-gossypol in wild species of cotton and in gossypium hirsutum var. marie-galante (watt) hutchinson. | gossypol occurs as a mixture of enantiomers in cottonseed. these enantiomers exhibit different biological activities. the (-)-enantiomer is toxic to animals, but it has potential medicinal uses. therefore, cottonseed with >95% (-)-gossypol could have biopharmaceutical applications. the (+)-enantiomer shows little, if any, toxicity to nonruminant animals. thus, cottonseed with >95% (+)-gossypol could be more readily utilized as a feed for nonruminants. the (+)- to (-)-gossypol ratio in commercial ... | 2005 | 16076104 |
| molecular dissection of phenotypic variation between gossypium hirsutum and gossypium barbadense (cotton) by a backcross-self approach: iii. fiber length. | a backcross-self population from a cross between gossypium hirsutum and g. barbadense was used to dissect the molecular basis of genetic variation governing 15 parameters that reflect fiber length. applying a detailed restriction fragment length polymorphism (rflp) map to 3,662 bc(3)f(2) plants from 24 independently derived bc(3) families, we detected 28, nine, and eight quantitative trait loci (qtls) for fiber length, length uniformity, and short fiber content, respectively. for eight, six, and ... | 2005 | 15983757 |
| molecular dissection of interspecific variation between gossypium hirsutum and gossypium barbadense (cotton) by a backcross-self approach: i. fiber elongation. | the current study is the first installment of an effort to explore the secondary gene pool for the enhancement of upland cotton (gossypium hirsutum l.) germplasm. we developed advanced-generation backcross populations by first crossing g. hirsutum cv. tamcot 2111 and g. barbadense cv. pima s6, then independently backcrossing f(1) plants to the g. hirsutum parent for three cycles. genome-wide mapping revealed introgressed alleles at an average of 7.3% of loci in each bc(3)f(1) plant, collectively ... | 2005 | 15983756 |
| genetic diversity and geographic pattern in early south american cotton domestication. | amplified fragment length polymorphism fingerprinting was applied to survey the genetic diversity of primitive south american gossypium barbadense cotton for establishing a possible link to its pre-columbian expansion. new germplasm was collected along coastal peru and over an andean transect in areas where most of the archaeological evidence relating to cotton domestication has been recorded. gene bank material of three diploid (g. raimondii, g. arboreum, and g. herbaceum) and four allotetraplo ... | 2005 | 15580473 |
| genotypic and developmental evidence for the role of plasmodesmatal regulation in cotton fiber elongation mediated by callose turnover. | cotton fibers are single-celled hairs that elongate to several centimeters long from the seed coat epidermis of the tetraploid species (gossypium hirsutum and gossypium barbadense). thus, cotton fiber is a unique system to study the mechanisms of rapid cell expansion. previous work has shown a transient closure of plasmodesmata during fiber elongation (y.-l. ruan, d.j. llewellyn, r.t. furbank [2001] plant cell 13: 47-60). to examine the importance of this closure in fiber elongation, we compared ... | 2004 | 15557097 |
| genetic mapping and qtl analysis of fiber-related traits in cotton ( gossypium). | cotton, the leading natural fiber crop, is largely produced by two primary cultivated allotetraploid species known as upland or american cotton ( gossypium hirsutum l.) and pima or egyptian cotton ( g. barbadense l.). the allotetraploid species diverged from each other and from their diploid progenitors (a or d genome) through selection and domestication after polyploidization. to analyze cotton ad genomes and dissect agronomic traits, we have developed a genetic map in an f2 population derived ... | 2004 | 14513220 |
| localization of qtls for yield and fiber quality traits of tetraploid cotton cultivar. | using ssr and rapd as molecular markers, and the 69 f2 families from a cross between handan208 (gossypium hirsutum) and pima90 (gossypium barbadense) as a mapping population, a linkage map comprising 126 markers was constructed. with an average spacing 13.7 cm between markers, the linkage map spanned 1,717.0 cm, which covers approximately 34.34% of the total recombinational length of cotton genome. based on the linkage map and the f2:3 phenotypic data, overall genome qtl screening was conducted ... | 2003 | 12924159 |
| a combined rflp-ssr-aflp map of tetraploid cotton based on a gossypium hirsutum x gossypium barbadense backcross population. | an interspecific gossypium hirsutum x gossypium barbadense backcross population of 75 bc1 plants was evaluated for 1014 markers. the map consists of 888 loci, including 465 aflps, 229 ssrs, 192 rflps, and 2 morphological markers, ordered in 37 linkage groups that represent most if not all of the 26 chromosomes, altogether spanning 4400 cm. loci were not evenly distributed over linkage groups, and 18 of the 26 long groups had a single dense region. this paper proposes a partially revised list of ... | 2003 | 12897870 |
| molecular linkage map of allotetraploid cotton ( gossypium hirsutum l. x gossypium barbadense l.) with a haploid population. | in the present study, a haploid population from the cross of the two cultivated allotetraploid cottons, gossypium hirsutum l. and gossypium barbadense l., was developed by means of vsg, a virescently marked semigamous line of sea island cotton, and some target haploids were successfully doubled with colchicine. a molecular linkage map was constructed with 58 doubled and haploid plants. among the total of 624 marker loci (510 ssrs and 114 rapds), 489 loci were assembled into 43 linkage groups and ... | 2002 | 12582895 |
| polyploid formation created unique avenues for response to selection in gossypium (cotton). | a detailed restriction fragment length polymorphism map was used to determine the chromosomal locations and subgenomic distributions of quantitative trait loci (qtls) segregating in a cross between cultivars of allotetraploid (aadd) gossypium hirsutum ("upland" cotton) and gossypium barbadense ("sea island," "pima," or "egyptian" cotton) that differ markedly in the quality and quantity of seed epidermal fibers. most qtls influencing fiber quality and yield are located on the "d" subgenome, deriv ... | 1998 | 9539752 |
| the distribution of gossypium hirsutum chromatin in g. barbadense germ plasm: molecular analysis of introgressive plant breeding. | cotton is unusual among major crop plants in that two cross-fertile species are widely cultivated for a common economic product, fiber. both historical evidence and classical genetic studies suggest that many improved forms of gossypium barbadense ("sea island", "egyptian", and "pima" cottons) may include chromatin derived from g. hirsutum. using 106 restriction fragment length polymorphism (rflp) loci well distributed across the cotton genome, we revealed the amount and genomic distribution of ... | 1995 | 24170011 |
| a detailed rflp map of cotton, gossypium hirsutum x gossypium barbadense: chromosome organization and evolution in a disomic polyploid genome. | we employ a detailed restriction fragment length polymorphism (rflp) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. about 46.2% of nuclear dna probes detect rflps distinguishing gossypium hirsutum and gossypium barbadense; and 705 rflp loci are assembled into 41 linkage groups and 4675 cm. the subgenomic origin (a vs. d) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. the a and d subgenomes show similar recombinational length, s ... | 1994 | 7851778 |
| regeneration of gossypium hirsutum and g. barbadense from shoot apex tissues for transformation. | a method of regenerating cotton plants from the shoot apical meristem of seedlings was developed for use with particle gun and agrobacterium-mediated transformation. this method was developed to circumvent the problems of genotype restriction and chromosomal damage frequently encountered in cotton regeneration in tissue culture through somatic embryogenesis. in this procedure, the cells of the shoot meristem are targeted for transformation. normal and fertile plants of gossypium barbadense pima ... | 1991 | 24226156 |
| the inheritance of gossypol level in gossypium. ii. inheritance of seed gosypol in two trains of cultivated gossypoium barbadense l. | two strains of cultivated gossypium barbadense l., sea island as-2 and pima s-4, were used to study the effects of alleles at two loci on the production and/or storage of gossypol in mature embryos. the normal alleles, gl(2) and gl(3), are "native" to g. barbadense, whereas the mutant alleles, gl(2) and gl(3), were introduced from gossypium hirsutum l. through backcrossing. each strain was grown in three replications per trial, and one, sea island as-2, was grown in three environments. each expe ... | 1973 | 4769299 |
| the genetics of flowering response in cotton. v. fruiting behavior of gossypium hirsutum and gossypium barbadense in interspecific hybrids. | | 1965 | 17248253 |
| microsatellite loci for gossypium davidsonii (malvaceae) and other d-genome, sonoran desert endemic cotton species. | microsatellite primers previously developed for domesticated cotton (gossypium hirsutum; tetraploid) were screened for their utility in investigating genetic structure and gene flow within g. davidsonii and five other wild, mexican, d-genome cotton species (all diploid). | 2012 | 22358044 |
| physiological performance and differential expression profiling of genes associated with drought tolerance in root tissue of four contrasting varieties of two gossypium species. | root growth in drying soil is generally limited by a combination of mechanical impedance and water stress. as the major function of root tissue is water and nutrient uptake, so it imparts an important role in plant growth and stress management. previously, we have studied physiological performance and expression profiling of gene associated with drought tolerance in leaf tissue of four cotton varieties. here, we have further continued our studies with the root tissue of these varieties. the goss ... | 2016 | 25802007 |
| identification of centromeric regions on the linkage map of cotton using centromere-related repeats. | centromere usually contains high-copy-number retrotransposons and satellite repeats, which are difficult to map, clone and sequence. currently, very little is known about the centromere in cotton. here, we sequenced a bacterial artificial chromosome (bac) mapping to the centromeric region and predicted four long-terminal-repeat (ltr) retrotransposons. they were located in the heterochromatic centromeric regions of all 52 pachytene chromosomes in gossypium hirsutum. fiber-fish mapping revealed th ... | 2014 | 25238895 |
| physiological performance and differential expression profiling of genes associated with drought tolerance in contrasting varieties of two gossypium species. | cotton is mostly cultivated under rain-fed conditions in india, thus faces frequent drought conditions during its life cycle. drought being a major stress factor responsible for yield penalty, there has always been a high priority to generate knowledge on adaptation and tolerance of cotton. in the present study, four cotton varieties, jkc-770 and kc-2 (gossypium hirsutum), and jkc-717 and rahs-187(gossypium herbaceum), were imposed to drought. under drought condition, differential changes in phy ... | 2015 | 25149149 |
| insights into the evolution of cotton diploids and polyploids from whole-genome re-sequencing. | understanding the composition, evolution, and function of the gossypium hirsutum (cotton) genome is complicated by the joint presence of two genomes in its nucleus (at and dt genomes). these two genomes were derived from progenitor a-genome and d-genome diploids involved in ancestral allopolyploidization. to better understand the allopolyploid genome, we re-sequenced the genomes of extant diploid relatives that contain the a1 (gossypium herbaceum), a2 (gossypium arboreum), or d5 (gossypium raimo ... | 2013 | 23979935 |
| identification of micro-rnas in cotton. | the plant genome has conserved small non-coding micrornas (mirnas) genes about 20-24 nucleotides long. they play a vital role in the gene regulation at various stages of plant life. their conserved nature among the various organisms not only suggests their early evolution in eukaryotes but also makes them a good source of new mirna discovery by homology search using bioinformatics tools. a systematic search approach was used for interspecies orthologues of mirna precursors, from known sequences ... | 2016 | 18603441 |
| the dna sequence of a gypsy element from gossypium hirsutum l. and characterization of gypsy elements in three gossypium species. | a strategy was developed to isolate a complete gypsy-element from gossypium hirsutum l. based on the sequence of a rapd that was polymorphic in near isoganic lines of cotton that varied in leaf shape. a 5998 nt clone was isolated and its gene order and sequence confirmed it was a gypsy-type retroelement. sequences homologous to the gag portion of this clone were also found in gossypium herbaceum l. and gossypium raimondii l. a portion of the open reading frame of the integrase gene was amplified ... | 2003 | 14631654 |
| [molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. | using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to c-terminal peptides ggaactcccttttctggatagctcacc and cctggtccgaacccaaacaggacgcccc, were used to amplify, via polymerase chain reaction, genomic sequences from two gossypium species, a diploid gossypium herbaceum, and a tetraploid gossypium hirsutum cv. 108f. amplified dna was separated into individual sequences by cloning into an m13 vector. six diff ... | 2006 | 1339958 |
| genome-wide identification of the mikc-type mads-box gene family in gossypium hirsutum l. unravels their roles in flowering. | cotton is one of the major world oil crops. cottonseed oil meets the increasing demand of fried food, ruminant feed, and renewable bio-fuels. mads intervening keratin-like and c-terminal (mikc)-type mads-box genes encode transcription factors that have crucial roles in various plant developmental processes. nevertheless, this gene family has not been characterized, nor its functions investigated, in cotton. here, we performed a comprehensive analysis of mikc-type mads genes in the tetraploid gos ... | 2017 | 28382045 |
| genome-wide identification of membrane-bound fatty acid desaturase genes in gossypium hirsutum and their expressions during abiotic stress. | membrane-bound fatty acid desaturases (fads) are of great importance and play multiple roles in plant growth and development. in the present study, 39 full-length fad genes, based on database searches, were identified in tetraploid upland cotton (gossypium hirsutum l.) and were phylogenetically clustered into four subfamilies. genomic localization revealed that 34 genes were mapped on 22 chromosomes, and five genes were positioned on the scaffold sequences. the fad genes of g. hirsutum in the sa ... | 2017 | 28374822 |
| genome-wide association study discovered candidate genes of verticillium wilt resistance in upland cotton (gossypium hirsutum l.). | verticillium wilt (vw), caused by infection by verticillium dahliae, is considered one of the most yield-limiting diseases in cotton. to examine the genetic architecture of cotton vw resistance, we performed a genome-wide association study (gwas) using a panel of 299 accessions and 85,630 single-nucleotide polymorphisms (snps) detected using the specific-locus amplified fragment sequencing (slaf-seq) approach. trait-snp association analysis detected a total of 17 significant snps at p < 1.17 × 1 ... | 2017 | 28371164 |
| fine mapping and candidate gene analysis of qfl-chr1, a fiber length qtl in cotton. | a fiber length qtl, qfl-chr1, was fine mapped to a 0.9 cm interval of cotton chromosome 1. two positional candidate genes showed positive correlation between gene expression level and fiber length. prior analysis of a backcross-self mapping population derived from a cross between gossypium hirsutum l. and g. barbadense l. revealed a qtl on chromosome 1 associated with increased fiber length (qfl-chr1), which was confirmed in three independent populations of near-isogenic introgression lines (nii ... | 2017 | 28361363 |
| developmental features of cotton fibre middle lamellae in relation to cell adhesion and cell detachment in cultivars with distinct fibre qualities. | cotton fibre quality traits such as fibre length, strength, and degree of maturation are determined by genotype and environment during the sequential phases of cotton fibre development (cell elongation, transition to secondary cell wall construction and cellulose deposition). the cotton fibre middle lamella (cfml) is crucial for both cell adhesion and detachment processes occurring during fibre development. to explore the relationship between fibre quality and the pace at which cotton fibres dev ... | 2017 | 28359260 |
| qtl analysis of cotton fiber length in advanced backcross populations derived from a cross between gossypium hirsutum and g. mustelinum. | qtls for fiber length mapped in three generations of advanced backcross populations derived from crossing gossypium hirsutum and gossypium mustelinum showed opportunities to improve elite cottons by introgression from wild relatives. the molecular basis of cotton fiber length in crosses between gossypium hirsutum and gossypium mustelinum was dissected using 21 bc3f2 and 12 corresponding bc3f2:3 and bc3f2:4 families. sixty-five quantitative trait loci (qtls) were detected by one-way analysis of v ... | 2017 | 28349176 |
| microrna expression profiles during cotton (gossypium hirsutum l) fiber early development. | the role of micrornas (mirnas) during cotton fiber development remains unclear. here, a total of 54 mirnas belonging to 39 families were selected to characterize mirna regulatory mechanism in eight different fiber development stages in upland cotton cv bm-1. among 54 mirnas, 18 mirnas were involved in cotton fiber initiation and eight mirnas were related to fiber elongation and secondary wall biosynthesis. additionally, 3,576 protein-coding genes were candidate target genes of these mirnas, whic ... | 2017 | 28327647 |
| population structure and genetic basis of the agronomic traits of upland cotton in china revealed by a genome-wide association study using high-density snps. | gossypium hirsutum l. represents the largest source of textile fibre, and china is one of the largest cotton-producing and cotton-consuming countries in the world. to investigate the genetic architecture of the agronomic traits of upland cotton in china, a diverse and nationwide population containing 503 g. hirsutum accessions was collected for a genome-wide association study (gwas) on 16 agronomic traits. the accessions were planted in four places from 2012 to 2013 for phenotyping. the cottonsn ... | 2017 | 28301713 |
| targeted mutagenesis in cotton (gossypium hirsutum l.) using the crispr/cas9 system. | the crispr (clustered regularly interspaced short palindromic repeats)/cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. however, to our knowledge, there is no report on the application of crispr/cas9-mediated targeted mutagenesis in cotton. here, we report the genome editing and targeted mutagenesis in upland cotton (gossypium hirsutum l., hereafter cotton) using the crispr/cas9 system. we designed two guide ... | 2017 | 28287154 |
| asymmetric subgenome selection and cis-regulatory divergence during cotton domestication. | comparative population genomics offers an excellent opportunity for unraveling the genetic history of crop domestication. upland cotton (gossypium hirsutum) has long been an important economic crop, but a genome-wide and evolutionary understanding of the effects of human selection is lacking. here, we describe a variation map for 352 wild and domesticated cotton accessions. we scanned 93 domestication sweeps occupying 74 mb of the a subgenome and 104 mb of the d subgenome, and identified 19 cand ... | 2017 | 28263319 |
| crispr/cas9-mediated targeted mutagenesis in upland cotton (gossypium hirsutum l.). | the clustered, regularly interspaced, short palindromic repeats (crispr)/crispr associated (cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. it has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed ... | 2017 | 28258551 |
| a high-efficiency crispr/cas9 system for targeted mutagenesis in cotton (gossypium hirsutum l.). | the complex allotetraploid genome is one of major challenges in cotton for repressing gene expression. developing site-specific dna mutation is the long-term dream for cotton breeding scientists. the clustered regularly interspaced short palindromic repeats/crispr-associated protein 9 (crispr/cas9) system is emerging as a robust biotechnology for targeted-dna mutation. in this study, two sgrnas, ghmyb25-like-sgrna1 and ghmyb25-like-sgrna2, were designed in the identical genomic regions of ghmyb2 ... | 2017 | 28256588 |
| identification of marker-trait associations for lint traits in cotton. | harvesting high quality lint, a long-awaited breeding goal-accomplished partly, can be achieved by identifying dna markers which could be used for diagnosing cotton plants containing the desired traits. in the present studies, a total of 185 cotton genotypes exhibiting diversity for lint traits were selected from a set of 546 genotypes evaluated for fiber traits in 2009. these genotypes were extensively studied for three consecutive years (2011-2013) at three different locations. significant gen ... | 2017 | 28220132 |
| quantification of climate warming and crop management impacts on cotton phenology. | understanding the impact of the warming trend on phenological stages and phases of cotton (gossypium hirsutum l.) in central and lower punjab, pakistan, may assist in optimizing crop management practices to enhance production. this study determined the influence of the thermal trend on cotton phenology from 1980-2015 in 15 selected locations. the results demonstrated that observed phenological stages including sowing (s), emergence (e), anthesis (a) and physiological maturity (m) occurred earlie ... | 2017 | 28208605 |
| combined elevated temperature and soil waterlogging stresses inhibit cell elongation by altering osmolyte composition of the developing cotton (gossypium hirsutum l.) fiber. | soil waterlogging events and high temperature conditions occur frequently in the yangtze river valley, yet the effects of these co-occurring stresses on fiber elongation have received little attention. in the current study, the combined effect of elevated temperature (et) and soil waterlogging (sw) more negatively affected final fiber length (reduced by 5.4%-11.3%) than either stress alone by altering the composition of osmotically active solutes (sucrose, malate, and k(+)), where sw had the mos ... | 2017 | 28167033 |
| diversity analysis of cotton (gossypium hirsutum l.) germplasm using the cottonsnp63k array. | cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapted to emerging environmental and climate conditions. accessions and lines have traditionally been characterized based on phenotypes, but phenotypic profiles are limited by the cost, time, and space required to make visual observations and measurements. with advances in molecular genetic methods, genotypic profiles are increasingly able to identify differences among accessions due to the larger n ... | 2017 | 28158969 |
| fine-mapping qfs07.1 controlling fiber strength in upland cotton (gossypium hirsutum l.). | key message: qfs07.1 controlling fiber strength was fine-mapped to a 62.6-kb region containing four annotated genes. rt-qpcr and sequence of candidate genes identified an lrr rlk gene as the most likely candidate. fiber strength is an important component of cotton fiber quality and is associated with other properties, such as fiber maturity, fineness, and length. stable qtl qfs07.1, controlling fiber strength, had been identified on chromosome 7 in an upland cotton recombinant inbred line (ril) ... | 2017 | 28144698 |
| dissecting genetic network of fruit branch traits in upland cotton by association mapping using ssr markers. | genetic architecture of branch traits has large influences on the morphological structure, photosynthetic capacity, planting density, and yield of upland cotton (gossypium hirsutum l.). this research aims to reveal the genetic effects of six branch traits, including bottom fruit branch node number (bfbnn), bottom fruit branch length (bfbl), middle fruit branch node number (mfbnn), middle fruit branch length (mfbl), upper fruit branch node number (ufbnn), and upper fruit branch length (ufbl). ass ... | 2017 | 28121983 |
| ascorbate alleviates fe deficiency-induced stress in cotton (gossypium hirsutum) by modulating aba levels. | fe deficiency causes significant losses to crop productivity and quality. to understand better the mechanisms of plant responses to fe deficiency, we used an in vitro cotton ovule culture system. we found that fe deficiency suppressed the development of ovules and fibers, and led to tissue browning. rna-seq analysis showed that the myo-inositol and galacturonic acid pathways were activated and cytosolic apx (ascorbate peroxidase) was suppressed in fe-deficient treated fibers, which increased asc ... | 2016 | 28101095 |
| ectopic expression of two areb/abf orthologs increases drought tolerance in cotton (gossypium hirsutum). | plants have evolved complex molecular, cellular and physiological mechanisms to respond to environmental stressors. because of the inherent complexity of this response, genetic manipulation to substantially improve water deficit tolerance, particularly in agricultural crops, has been largely unsuccessful, as the improvements are frequently accompanied by slower growth and delayed reproduction. here, we ectopically express two abiotic stress-responsive bzip areb/abf transcription factor orthologs ... | 2017 | 28098349 |
| functional characterization of a novel jasmonate zim-domain interactor (ninja) from upland cotton (gossypium hirsutum). | the jasmonic acid (ja) signalling pathway plays roles in plant development and defence against biotic and abiotic stresses. we isolated a cotton ninja (novel interactor of ja zim-domain) gene, designated ghninja, which contains a 1305 bp open read frame. the ghninja gene encodes a 434 amino acid peptide. according to quantitative real-time pcr analysis, ghninja is preferentially expressed in roots, and its expression level is greatly induced by verticillium dahliae infection. through a virus-ind ... | 2017 | 28086169 |
| cotip: cotton tilling platform, a resource for plant improvement and reverse genetic studies. | cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (gossypium hirsutum l.) carrying both a and d genome. since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. mutation based improvement strategies provide an effective way of creating new allelic variations. targeting induced local lesions in genomes (tilling) provides a mutation based rever ... | 2016 | 28082993 |
| a gly65val substitution in an actin, ghact_li1, disrupts cell polarity and f-actin organization resulting in dwarf, lintless cotton plants. | actin polymerizes to form part of the cytoskeleton and organize polar growth in all eukaryotic cells. species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. here, we investigated the role of a cotton (gossypium hirsutum) actin gene in the organization of actin filaments in lobed cotyledon pavement cells and the highly elongated single-celled trichomes that comprise cotton lint fibers. using mapping-by-seq ... | 2017 | 28078746 |
| microrna 157-targeted spl genes regulate floral organ size and ovule production in cotton. | micrornas (mirnas) have been involved in regulation of diverse spectrum of plant development processes in many species. in cotton, few mirnas have been well characterised in floral organ development. floral organ, which should be finely tuned, is a crucial factor affecting the yield of cotton. therefore, it is well worth revealing the function of mirnas in regulation of floral organ development. here, we report the role of mirna156/157 in regulation of floral organ size in cotton. | 2017 | 28068913 |
| genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in gossypium hirsutum l. | genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, gossypium hirsutum, but there are difficulties with precise selection of traits. therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. in this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed cotton 63k illumina infinium snp array and perfo ... | 2017 | 28064470 |
| optimizing the phosphorus use in cotton by using csm-cropgro-cotton model for semi-arid climate of vehari-punjab, pakistan. | crop nutrient management is an essential component of any cropping system. with increasing concerns over environmental protection, improvement in fertilizer use efficiencies has become a prime goal in global agriculture system. phosphorus (p) is one of the most important nutrients, and strategies are required to optimize its use in important arable crops like cotton (gossypium hirsutum l.) that has great significance. sustainable p use in crop production could significantly avoid environmental h ... | 2017 | 28054268 |
| polymorphism analysis of multi-parent advanced generation inter-cross (magic) populations of upland cotton developed in china. | upland cotton (gossypium hirsutum l.) is an important cash crop that provides renewable natural fiber worldwide. currently limited genetic base leads to a decrease in upland cotton genetic diversity. multi-parent advance generation inter-cross (magic) populations can be used to evaluate complex agronomic traits in crops. in this study, we developed an upland cotton magic population. a total of 258 magic population lines and their twelve founder lines were analyzed, using 432 pairs of simple sequ ... | 2016 | 28002582 |
| modifications to a late meristem identity1 gene are responsible for the major leaf shapes of upland cotton (gossypium hirsutum l.). | leaf shape varies spectacularly among plants. leaves are the primary source of photoassimilate in crop plants, and understanding the genetic basis of variation in leaf morphology is critical to improving agricultural productivity. leaf shape played a unique role in cotton improvement, as breeders have selected for entire and lobed leaf morphs resulting from a single locus, okra (l-d1), which is responsible for the major leaf shapes in cotton. the l-d1 locus is not only of agricultural importance ... | 2017 | 27999177 |
| comparison of ionomic and metabolites response under alkali stress in old and young leaves of cotton (gossypium hirsutum l.) seedlings. | soil salinization is an important agriculture-related environmental problem. alkali stress and salt stress strongly influence the metabolic balance in plants. salt and alkali stresses exert varied effects on old and young tissues, which display different adaptive strategies. in this study, we used cotton (gossypium hirsutum l.) plants as experimental material to investigate whether alkali stress induces ionic and metabolism changes in old and young leaves of cotton plants exposed to alkali stres ... | 2016 | 27933088 |
| the cotton β-galactosyltransferase 1 (galt1) that galactosylates arabinogalactan proteins participates in controlling fiber development. | arabinogalactan proteins (agps) are highly glycosylated proteins that play pivotal roles in diverse developmental processes in plants. type-ii ag glycans, mostly o-linked to the hydroxyproline residues of the protein backbone, account for up to 95% w/w of the agp, but their functions are still largely unclear. cotton fibers are extremely elongated single-cell trichomes on the seed epidermis; however, little is known of the molecular basis governing the regulation of fiber cell development. here, ... | 2017 | 27888523 |
| genetic gains from selection for fiber traits in gossypium hirsutum l. | brazil is among the five largest producers of cotton in the world, cultivating the species gossypium hirsutum l. r. latifolium hutch. the cultivars should have good fiber quality as well as yield. genetic improvement of fiber traits requires the study of the genetic structure of the populations under improvement, leading to the identification of promising parent plants. to this end, it is important to acquire some information, such as estimates of genetic variance components and heritability coe ... | 2016 | 27886330 |
| molecular characterization of ghpldα1 and its relationship with secondary cell wall thickening in cotton fibers. | phospholipase d (pld) hydrolyzes phospholipids to generate a free polar head group (e.g., choline) and a second messenger phosphatidic acid and plays diverse roles in plant growth and development, including seed germination, leaf senescence, root hair growth, and hypocotyl elongation. however, the function of pld in cotton remains largely unexplored. here, the comprehensive molecular characterization of ghpldα1 was explored with its role in upland cotton (gossypium hirsutum) fiber development. t ... | 2017 | 27864277 |
| leaf hydraulic conductance and mesophyll conductance are not closely related within a single species. | stomata represent one resistor in a series of resistances for carbon and water exchange between the leaf and the atmosphere; the remaining resistors occurring within the leaf, commonly represented as mesophyll conductance to co2 , gm , and leaf hydraulic conductance, kleaf . recent studies have proposed that gm and kleaf may be coordinated across species because of shared pathways. we assessed the correlation between gm and kleaf within cotton, under growth co2 partial pressure and irradiance tr ... | 2017 | 27861995 |
| high-density linkage map construction and qtl analysis for earliness-related traits in gossypium hirsutum l. | gossypium hirsutum l., or upland cotton, is an important renewable resource for textile fiber. to enhance understanding of the genetic basis of cotton earliness, we constructed an intra-specific recombinant inbred line population (ril) containing 137 lines, and performed linkage map construction and quantitative trait locus (qtl) mapping. | 2016 | 27835938 |
| comparative genome-wide analysis of the malate dehydrogenase gene families in cotton. | malate dehydrogenases (mdhs) play crucial roles in the physiological processes of plant growth and development. in this study, 13 and 25 mdh genes were identified from gossypium raimondii and gossypium hirsutum, respectively. using these and 13 previously reported gossypium arboretum mdh genes, a comparative molecular analysis between identified mdh genes from g. raimondii, g. hirsutum, and g. arboretum was performed. based on multiple sequence alignments, cotton mdhs were divided into five subg ... | 2016 | 27829020 |
| genome-wide identification and expression analysis of stress-associated proteins (saps) containing a20/an1 zinc finger in cotton. | stress-associated proteins (saps) containing the a20/an1 zinc-finger domain play important roles in response to both biotic and abiotic stresses in plants. nevertheless, few studies have focused on the sap gene family in cotton. to explore the distributions and expression patterns of these genes, we performed genome-wide identification and characterization of saps in tetraploid gossypium hirsutum l. tm-1 (ad1). a total of 37 genes encoding saps were identified, 36 of which were duplicated in the ... | 2016 | 27681253 |
| development, genetic mapping and qtl association of cotton phya, phyb, and hy5-specific caps and dcaps markers. | among snp markers that become increasingly valuable in molecular breeding of crop plants are the caps and dcaps markers derived from the genes of interest. to date, the number of such gene-based markers is small in polyploid crop plants such as allotetraploid cotton that has a- and d-sub-genomes. the objective of this study was to develop and map new caps and dcaps markers for cotton developmental-regulatory genes that are important in plant breeding programs. | 2016 | 27776497 |
| small rna-mediated responses to low- and high-temperature stresses in cotton. | micrornas (mirnas) are one class of endogenous non-coding rnas modulating the expression of target genes involved in plant development and stress tolerance, by degrading mrna or repressing translation. in this study, small rna and mrna degradome sequencing were used to identify low- and high-temperature stress-responsive mirnas and their targets in cotton (gossypium hirsutum). cotton seedlings were treated under different temperature conditions (4, 12, 25, 35, and 42 °c) and then the effects wer ... | 2016 | 27752116 |
| identification and functional analysis of micrornas involved in the anther development in cotton genic male sterile line yu98-8a. | hybrid vigor contributes in a large way to the yield and quality of cotton (gossypium hirsutum) fiber. although micrornas play essential regulatory roles in flower induction and development, it is still unclear if micrornas are involved in male sterility, as the regulatory molecular mechanisms of male sterility in cotton need to be better defined. in this study, two independent small rna libraries were constructed and sequenced from the young buds collected from the sporogenous cell formation to ... | 2016 | 27739413 |
| a raf-like mapkkk gene, ghraf19, negatively regulates tolerance to drought and salt and positively regulates resistance to cold stress by modulating reactive oxygen species in cotton. | mitogen-activated protein kinase kinase kinases (mapkkks) function at the top level of mapk cascades and play important roles in plant development and stress responses. although mapkkks comprise the largest family in the mapk cascades, very few raf-like mapkkks have been functionally identified, especially in the economically important crop cotton. in this study, a raf-like mapkkk gene, ghraf19, was characterized for the first time in cotton. our data show that the expression of ghraf19 was inhi ... | 2016 | 27717463 |
| characterization of eleven monosomic alien addition lines added from gossypium anomalum to gossypium hirsutum using improved gish and ssr markers. | gossypium anomalum (bb genome) possesses the desirable characteristics of drought tolerance, resistance to diseases and insect pests, and the potential for high quality fibers. however, it is difficult to transfer the genes associated with these desirable traits into cultivated cotton (g. hirsutum, aadd genome). monosomic alien addition lines (maals) can be used as a bridge to transfer desired genes from wild species into g. hirsutum. in cotton, however, the high number and smaller size of the c ... | 2016 | 27717331 |
| ghabf2, a bzip transcription factor, confers drought and salinity tolerance in cotton (gossypium hirsutum l.). | the bzip transcription factor (tf) act as an important regulator for the abscisic acid (aba) mediated abiotic stresses signaling pathways in plants. here, we reported the cloning and characterization of ghabf2, encoding for typical cotton bzip tf. overexpression of ghabf2 significantly improved drought and salt stress tolerance both in arabidopsis and cotton. however, silencing of ghabf2 made transgenic cotton sensitive to peg osmotic and salt stress. expression of ghabf2 was induced by drought ... | 2016 | 27713524 |
| na(+) compartmentalization related to salinity stress tolerance in upland cotton (gossypium hirsutum) seedlings. | the capacity for ion compartmentalization among different tissues and cells is the key mechanism regulating salt tolerance in plants. in this study, we investigated the ion compartmentalization capacity of two upland cotton genotypes with different salt tolerances under salt shock at the tissue, cell and molecular levels. we found that the leaf glandular trichome could secrete more salt ions in the salt-tolerant genotype than in the sensitive genotype, demonstrating the excretion of ions from ti ... | 2016 | 27698468 |
| ghcam7-like, a calcium sensor gene, influences cotton fiber elongation and biomass production. | calcium signaling regulates many developmental processes in plants. calmodulin (cam) is one of the most conserved calcium sensors and has a flexible conformation in eukaryotes. the molecular functions of cam are unknown in cotton, which is a major source of natural fiber. in this study, a gossypium hirsutum l.cam7-like gene was isolated from upland cotton. bioinformatics analysis indicated that the ghcam7-like gene was highly conserved as compared with arabidopsis atcam7. the ghcam7-like gene sh ... | 2016 | 27669397 |
| impact of insect management on population dynamics and insecticide resistance of tarnished plant bug (hemiptera: miridae). | while transgenic plants targeting lepidopteran and coleopteran insects have been available for almost 20 yr, there are no transgenic crops that target hemipteran insects such as tarnished plant bug, lygus lineolaris (palisot de beauvois), though at least one company lists potential products in advanced stages of development. a resistance management model for the u.s. mid-south was developed to aid in resistance risk assessments for transgenic crops targeting l. lineolaris, and validated against ... | 2016 | 27651293 |
| histone modifications define expression bias of homoeologous genomes in allotetraploid cotton. | histone modifications regulate gene expression in eukaryotes, but their roles in gene expression changes in interspecific hybrids or allotetraploids are poorly understood. histone modifications can be mapped by immunostaining of metaphase chromosomes at the single cell level and/or by chromatin immunoprecipitation-sequencing (chip-seq) for analyzing individual genes. here, we comparatively analyzed immunostained metaphase chromosomes and chip-seq of individual genes, which revealed a chromatin b ... | 2016 | 27637746 |
| enhanced plant growth promoting role of phycomolecules coated zinc oxide nanoparticles with p supplementation in cotton (gossypium hirsutum l.). | this report focuses on application of zinc oxide nanoparticles (znonps) carrying phycomolecule ligands as a novel plant growth promoter aimed at increasing the crop productivity. the present investigation examined the effect of znonps on plant growth characteristics, and associated biochemical changes in cotton (gossypium hirsutum l.) following growth in a range of concentrations (25-200 mg l(-l) znonps) in combination with 100 mm p in a hydroponic system. treated plants registered an increase i ... | 2017 | 27622847 |
| metabolic engineering of cottonseed oil biosynthesis pathway via rna interference. | cottonseed oil is recognized as an important oil in food industry for its unique characters: low flavor reversion and the high level of antioxidants (vitamine) as well as unsaturated fatty acid. however, the cottonseed oil content of cultivated cotton (gossypium hirsutum) is only around 20%. in this study, we modified the accumulation of oils by the down-regulation of phosphoenolpyruvate carboxylase 1 (ghpepc1) via rna interference in transgenic cotton plants. the qrt-pcr and enzyme activity ass ... | 2016 | 27620452 |
| genome-wide characterization and expression analysis of myb transcription factors in gossypium hirsutum. | myb family proteins are one of the most abundant transcription factors in the cotton plant and play diverse roles in cotton growth and evolution. previously, few studies have been conducted in upland cotton, gossypium hirsutum. the recent release of the g. hirsutum genome sequence provides a great opportunity to identify and characterize the entire upland cotton myb protein family. | 2016 | 27613381 |
| cloning and functional analysis of the promoter of an ascorbate oxidase gene from gossypium hirsutum. | apoplastic ascorbate oxidase (ao) plays significant roles in plant cell growth. however, the mechanism of underlying the transcriptional regulation of ao in gossypium hirsutum remains unclear. here, we obtained a 1,920-bp promoter sequence from the gossypium hirsutum ascorbate oxidase (ghao1) gene, and this ghao1 promoter included a number of known cis-elements. promoter activity analysis in overexpressing pghao1::gfp-gus tobacco (nicotiana benthamiana) showed that the ghao1 promoter exhibited h ... | 2016 | 27597995 |
| identification and characterization of the ghhsp20 gene family in gossypium hirsutum. | in higher plants, heat shock protein 20 (hsp20) plays crucial roles in growth, development and responses to abiotic stresses. in this study, 94 ghhsp20 genes were identified in g. hirsutum, and these genes were phylogenetically clustered into 14 subfamilies. out of these, 73 paralogous gene pairs remained in conserved positions on segmental duplicated blocks and only 14 genes clustered into seven tandem duplication event regions. transcriptome analysis showed that 82 ghhsp20 genes were expressed ... | 2016 | 27580529 |
| identification of favorable snp alleles and candidate genes for traits related to early maturity via gwas in upland cotton. | early maturity is one of the most important and complex agronomic traits in upland cotton (gossypium hirsutum l). to dissect the genetic architecture of this agronomically important trait, a population consisting of 355 upland cotton germplasm accessions was genotyped using the specific-locus amplified fragment sequencing (slaf-seq) approach, of which a subset of 185 lines representative of the diversity among the accessions was phenotypically characterized for six early maturity traits in four ... | 2016 | 27576450 |
| the ghtt2_a07 gene is linked to the brown colour and natural flame retardancy phenotypes of lc1 cotton (gossypium hirsutum l.) fibres. | some naturally coloured brown cotton fibres from accessions of gossypium hirsutum l. can be used to make textiles with enhanced flame retardancy (fr). several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre fr is not yet fully understood. in this study, we show that both the brown colour and enhanced fr of the lc1 lint colour locus are linked to a 1.4mb inversion on chromosome a07 ... | 2016 | 27567364 |
| characterization and functional analysis of pebp family genes in upland cotton (gossypium hirsutum l.). | upland cotton (gossypium hirsutum l.) is a naturally occurring photoperiod-sensitive perennial plant species. however, sensitivity to the day length was lost during domestication. the phosphatidylethanolamine-binding protein (pebp) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. recent evidence indicates that pebp family genes play an important role in generating mobile flowering signals. we isolated h ... | 2016 | 27552108 |
| mapping qtls for drought tolerance in an f2:3 population from an inter-specific cross between gossypium tomentosum and gossypium hirsutum. | cotton is one of the most important natural fiber crops in the world. its growth and yield is greatly limited by drought. a quantitative trait locus (qtl) analysis was therefore conducted to investigate the genetic basis of drought tolerance in cotton (gossypium spp) using 188 f2:3 lines developed from an inter-specific cross between a wild cotton species, g. tomentosum, and an upland cotton, g. hirsutum (cri-12). a genetic map was constructed using 1295 simple sequence repeat markers, which amp ... | 2016 | 27525919 |
| de novo transcriptome analysis reveals insights into dynamic homeostasis regulation of somatic embryogenesis in upland cotton (g. hirsutum l.). | plant regeneration via somatic embryogenesis (se) is the key step for genetic improvement of cotton (gossypium hirsutum l.) through genetic engineering mediated by agrobacteria, but the molecular mechanisms underlying se in cotton is still unclear. here, rna-sequencing was used to analyze the genes expressed during se and their expression dynamics using rnas isolated from non-embryogenic callus (nec), embryogenic callus (ec) and somatic embryos (ses). a total of 101, 670 unigenes were de novo as ... | 2016 | 27511192 |
| response and tolerance mechanism of cotton gossypium hirsutum l. to elevated temperature stress: a review. | cotton is an important multipurpose crop which is highly sensitive to both biotic and abiotic stresses. proper management of this cash crop requires systematic understanding of various environmental conditions that are vital to yield and quality. high temperature stress can severely affect the viability of pollens and anther indehiscence, which leads to significant yield losses. cotton can respond to withstand adverse environmental condition in several phases among which the accumulation of chem ... | 2016 | 27446165 |