Publications

TitleAbstractYear
Filter
PMID
Filter
biomonitoring of air pollution in a seasonally dry tropical suburban area using wheat transplants.air pollution has been identified as a serious problem throughout the world which causes tremendous loss to the crops by affecting plant growth and yield. earlier, air pollution was restricted to urban and industrial regions. over the last few decades, however, it has become evident that pollutants can be transported over long distances and hence their impact may be felt widely over rural areas. the present study was conducted to evaluate the impact of urban air pollution on suburban agriculture ...200515736874
a new intervarietal linkage map and its application for quantitative trait locus analysis of "gigas" features in bread wheat.a doubled-haploid (dh) population from an intervarietal cross between the japanese cultivar 'fukuho-komugi' and the israeli wheat line 'oligoculm' was produced by means of wheat x maize crosses. one hundred seven dh lines were genotyped to construct a simple sequence repeat (ssr) based linkage map with rflp, rapd, and inter-simple sequence repeat markers. out of 570 loci genotyped, 330 were chosen based on their positions on the linkage map to create a "framework" map for quantitative trait locu ...200515729398
a high-density genetic map of hexaploid wheat (triticum aestivum l.) from the cross chinese spring x sq1 and its use to compare qtls for grain yield across a range of environments.a population of 96 doubled haploid lines (dhls) was prepared from f1 plants of the hexaploid wheat cross chinese spring x sq1 (a high abscisic acid-expressing breeding line) and was mapped with 567 rflp, aflp, ssr, morphological and biochemical markers covering all 21 chromosomes, with a total map length of 3,522 cm. although the map lengths for each genome were very similar, the d genome had only half the markers of the other two genomes. the map was used to identify quantitative trait loci (qt ...200515719212
partial sequences of nitrogen metabolism genes in hexaploid wheat.our objective was to partially sequence genes controlling nitrogen metabolism in wheat species in order to find sequence polymorphism that would enable their mapping. primers were designed for nitrate reductase, nitrite reductase, glutamate dehydrogenase and glutamate synthase (gogat), and gene fragments were amplified on triticum aestivum, t. durum, t. monococcum, t. speltoides and t. tauschii. we obtained more than 8 kb of gene sequences, mainly as coding regions (60%). polymorphism was quanti ...200515714330
alteration of the embryo transcriptome of hexaploid winter wheat (triticum aestivum cv. mercia) during maturation and germination.grain dormancy and germination are areas of biology that are of considerable interest to the cereal community. we have used a 9,155-feature wheat unigene cdna microarray resource to investigate changes in the wheat embryo transcriptome during late grain development and maturation and during the first 48 h of postimbibition germination. in the embryo 392 mrnas accumulated by twofold or greater over the time course from 21 days postanthesis (dpa) to 40 dpa and on through 1 and 2 days postgerminati ...200515714317
[effect of malonate on the structural and functional changes of wheat triticum aestivum l. root cells].a study was made of respiration, output of k+ and ultrastructure of wheat root cells treated for 6 h with malonic acid (ma) (15 mm), an inhibitor of succinate dehydrogenase. after a 1 h treatment, on the background of a decrease in respiration, and output of k+ an increased number of lumens of smooth endoplasmic reticulum was observed. these changes may be the result of lipid biosynthesis. within first hours of treatment with ma, the mitochondrial matrix was becoming more brightened, and after 3 ...200415704878
the transcript composition of egg cells changes significantly following fertilization in wheat (triticum aestivum l.).here, we report the transcript profile of wheat egg cells and proembryos, just after the first cell division. microdissected female gametophytes of wheat were used to isolate eggs and two-celled proembryos to construct cell type-specific cdna libraries. in total, 1197 expressed sequence tags (ests) were generated. analysis of these ests revealed numerous novel transcripts. in egg cells, 17.6% of the clustered ests represented novel transcripts, while 11.4% novel clusters were identified in the t ...200515703054
inheritance of the light intensity response in spring cultivars of common wheat.the effects of low/high light intensities and day length on ear emergence time in climatic chambers were studied in 12 common wheat (triticum aestivum l.) cultivars of different ecogeographical origin. low light intensity (li) affected the time to ear emergence in all the wheat cultivars of both the photoperiod sensitive and insensitive genotypes, increasing the number of days to ear emergence (dee). based on the increase in dee, we chose samples with different light intensity responses among th ...200415703045
development of primers specific for lmw-gs genes located on chromosome 1d and molecular characterization of a gene from glu-d3 complex locus in bread wheat.glutenins are multimeric aggregates of high molecular weight (hmw) and low molecular weight (lmw) subunits, which determine the quality in wheat. development of locus-specific primers is an important step toward cloning specific lmw glutenin subunits (lmw-gs) by pcr method. based on the publicly available, a pair of primer, namely primer 3 (5' ttgtagaaactgccatcctt 3') and primer 4 (5' gtcaccgctgcat cgacata 3') was designed and verified to specific for lmw-gs genes located on chromosome 1d in thi ...200415703035
sorption of copper and zinc to the plasma membrane of wheat root.sorption of cu(2+) and zn(2+) to the plasma membrane (pm) of wheat root (triticum aestivum l cv. scout 66) vesicles was measured at different ph values and in the presence of organic acids and other metals. the results were analyzed using a gouy-chapman-stem model for competitive sorption (binding and electrostatic attraction) to a negative binding site. the binding constants for the two investigated cations as evaluated from the sorption experiments were 5 m(-1) for zn(2+) and 400 m(-1) for cu( ...200415702373
distribution and remobilization of iron and copper in wheat.the amount of iron (fe) and copper (cu) that is loaded into grains of wheat (triticum aestivum) depends on both the amount of nutrient taken up by the plant post-anthesis and the amount that is remobilized from vegetative organs as they senesce. previous reports have shown that these two micronutrients behave quite differently in wheat in that cu is readily remobilized to the grain whilst fe shows poor remobilization. the object was to quantify the distribution of fe and cu in wheat and to show ...200515701664
[variation of betaine and proline contents in wheat seedlings under salt stress].glycine betaine (gb) and proline contents of leaf and root were simultaneously determined by hplc-esi-ms at seedling stage in the three wheat (triticum aestivum l.) varieties (salt tolerance from high to low), sw12, ningchun no.4 and chinese spring (c.s) under 5 different salt stress levels. the gb contents among sw12, ningchun no.4 and c.s were found outstanding difference by anova (p<0.01) and consistent with salt tolerance in wheat. proline contents were not different among 3 wheat varieties ...200515692186
[functional analysis of vernalization-related gene ver17 in flower development using antisense rna strategy in winter wheat].to understand the function of vernalization-related gene ver17 in winter wheat (triticum aestivum l. cv. jingdong no.1), an antisense rna strategy was used. the antisense ver17 with a vector pbi121 was constructed and transformed into winter wheat by using the pollen-tube-pathway method. fourteen independent transgenic plants transformed with antisense ver17 and five control transformants transformed with pbi121 blank vector were obtained and confirmed by gus histochemical assay and pcr-southern ...200515692181
wheat genetic diversity trends during domestication and breeding.it has been claimed that plant breeding reduces genetic diversity in elite germplasm which could seriously jeopardize the continued ability to improve crops. the main objective of this study was to examine the loss of genetic diversity in spring bread wheat during (1) its domestication, (2) the change from traditional landrace cultivars (lcs) to modern breeding varieties, and (3) 50 years of international breeding. we studied 253 cimmyt or cimmyt-related modern wheat cultivars, lcs, and triticum ...200515690175
large deletions within the first intron in vrn-1 are associated with spring growth habit in barley and wheat.the broad adaptability of wheat and barley is in part attributable to their flexible growth habit, in that spring forms have recurrently evolved from the ancestral winter growth habit. in diploid wheat and barley growth habit is determined by allelic variation at the vrn-1 and/or vrn-2 loci, whereas in the polyploid wheat species it is determined primarily by allelic variation at vrn-1. dominant vrn-a1 alleles for spring growth habit are frequently associated with mutations in the promoter regio ...200515690172
mapping of gluten t-cell epitopes in the bread wheat ancestors: implications for celiac disease.celiac disease is a prevalent disorder characterized by a chronic intestinal inflammation driven by hla-dq2 or -dq8-restricted t cells specific for ingested wheat gluten peptides. the dominant t-cell responses are to epitopes that cluster within a stable 33mer fragment formed by physiologic digestion of distinct alpha-gliadins. celiac disease is treated by excluding all gluten proteins from the diet. conceivably, a diet based on baking-quality gluten from a wheat species that expresses no or few ...200515685550
characterization of b- and c-type low molecular weight glutenin subunits by electrospray ionization mass spectrometry and matrix-assisted laser desorption/ionization mass spectrometry.low molecular weight glutenin subunits (lmw-gs) are typically subdivided into three groups, according to their molecular weights and isoelectric points, namely the b-, c-, and d groups. enriched b- and c-type lmw-gs fractions extracted from the bread wheat cultivar chinese spring were characterized using high performance liquid chromatography (hplc) directly interfaced with electrospray ionization mass spectrometry and hplc coupled off-line with matrix-assisted laser desorption/ionization mass s ...200515682464
effect of fungicide treatment on the quality of wheat flour and breadmaking.fungicides are applied to crop plants to ensure disease protection and improve growth. to assess the effects of five commercial foliar and spike fungicides in four different combinations on wheat (triticum aestivum l.), various quality parameters and flour processing properties, including baking quality, were determined. three commonly used wheat cultivars with different quality classes (e, b, and c) were tested. falling number, crude protein content, water absorption ability, protease activity, ...200415675809
regulation by vrn-1/fr-1 chromosomal intervals of cbf-mediated cor/lea gene expression and freezing tolerance in common wheat.vrn-1/fr-1 chromosomal regions of common wheat possess major qtls for both winter hardiness (fr) and vernalization requirement (vrn). the vrn-1/fr-1 intervals are assigned to long arms of the homologous group 5 chromosomes. to investigate the role of the vrn-1/fr-1 intervals on the low-temperature (lt) inducibility of wheat cor/lea genes and its putative transcription factor gene wcbf2, lt response of these genes was monitored using near-isogenic lines (nils) for the vrn-1 loci. the wcbf2 transc ...200515668223
combining ability in the f1 and f2 generations of diallel cross in hexaploid wheat (triticum aestivum l. em. thell).the f(1) and f(2) progenies of a ten-parent diallel cross (excluding reciprocals) of hexaploid wheat (triticum aestivum l. em. thell) were analyzed for combining ability for quantitative and quality traits. the results indicated significant differences among the parents for general combining ability (gca) and crosses for specific combining ability (sca) for all the characters studied. the gca and sca components of variance were significant for all the traits. however, the gca component of varian ...200415660971
heterosis studies for yield and its components in bread wheat over environments.a set of diallel crosses involving 10 parents was made to have information on the extent of heterosis over mid-parent and better parent and inbreeding depression for yield and yield contributing characters under three different environments. marked heterobeltiosis for grain yield and its important components were observed. for grain yield, 83 crosses showed significant positive heterobeltiosis in all the three sowing dates, however, twenty crosses showed significant consistent heterobeltiosis fo ...200415660970
a ph-stating mechanism in isolated wheat (triticum aestivum) aleurone layers involves malic acid transport.acidification of the starchy endosperm by the aleurone layer following germination has been established; however, the physiological and metabolic responses of this tissue to external ph have been incompletely investigated. in this investigation, isolated wheat (triticum aestivum) aleurone layers were incubated in different solutions at initial ph values of 3, 4 and 6 in the absence of phytohormones. after 24 h of incubation, the initial ph of all malate and succinate buffers shifted towards a va ...200415658800
genetic and biochemical analysis of common wheat cultivars lacking puroindoline a.puroindoline a (pin-a) and puroindoline b (pin-b), two basic isoforms encoded by the pina-d1 and pinb-d1 loci respectively, involved in controlling grain texture in wheat, were isolated from starch granules of soft wheat cultivars using three different extraction procedures, and fractionated by acidic polyacrylamide gel electrophoresis (a-page). tris buffer containing 1% triton x-114 extracted pin-a and small amounts of pin-b, whereas 1% sds preferably extracted pin-b. large amounts of both puro ...200515657742
differential exudation of two benzoxazinoids--one of the determining factors for seedling allelopathy of triticeae species.benzoxazinoids (bx) are natural phytotoxins that function as chemical defense compounds in several species. the release of bx by intact plant roots associated these compounds with root allelopathy in triticeae species; however, the significance of exudate concentrations of bx for plant-plant interactions is still a controversial question. a biological screening of 146 cultivars of four triticeae species (triticum aestivum l., triticum durum desf., triticum spelta l., and secale cereale l.) demon ...200515656658
influence of the gibberellin-sensitive rht8 dwarfing gene on leaf epidermal cell dimensions and early vigour in wheat (triticum aestivum l.).the gibberellin-insensitive rht-b1b and rht-d1b dwarfing genes are known to reduce the size of cells in culms, leaves and coleoptiles of wheat. resulting leaf area development of gibberellin-insensitive wheats is poor compared to standard height (rht-b1a and rht-d1a) genotypes. alternative dwarfing genes to rht-b1b and rht-d1b are available that reduce plant height, such as the gibberellin-responsive rht8 gene. this study aims to investigate if rht8 has a similar dwarfing effect on the size of l ...200515655105
characterization of est-derived microsatellites in the wheat genome and development of essr markers.est-derived microsatellites or simple sequence repeats (essr) occur in expressed sequence tags (est). here we report characteristics of essrs in the wheat genome, construction of consensus chromosome bin maps of ssr-containing ests ((ssr)ests), and development of essr markers for the 21 wheat chromosomes. a perl script known as misa was used to identify essrs in wheat ests available in the database http://wheat.pw.usda.gov/cgi-bin/ace/search/west ). among 492,832 ests from the database, 36,520 ( ...200515650880
[molecular study and c-banding of chromosomes in common wheat alloplasmic lines obtained from the backcross progeny of barley-wheat hybrids hordeum vulgare l. (2n = 14) x triticum aestivum l. (2n = 42) and differing in fertility].we studied common wheat alloplasmic lines differing in fertility traits, which had been obtained from the backcross progeny of barley-wheat hybrids hordeum vulgare l. (2n = 14) x triticum aestivum l. (2n = 42), using molecular analysis and chromosome c-banding. it was found that the nuclei of all alloplasmic lines studied, regardless of their fertility traits, contained only the common wheat chromosomes (2n = 42). the formation of line l-79(10)(3)f6, stable for self-fertility, from line l-79(10) ...200415648150
[effect of an introgression from aegilops cylindrica host on manifestation of productivity traits in winter common wheat f2 plants].the effect of introgression of a chromosome 1d segment from aegilops cylindrica to winter common wheat on productivity traits in f2 plants was studied using storage protein loci as genetic markers. an allele of the gliadin-coding gli-d1 locus served as a marker of the introgression. using of two- and three-locus interaction models, it was shown that the introgression tagged with gli-d1 affected the manifestation of productivity traits (productive tillering, grain weight per plant and grain numbe ...200415648149
[detection of the introgression of genome elements of the aegilops cylindrica host. into the triticum aestivum l. genome by issr and ssr analysis].to reveal sites of the donor genome in wheat crossed with aegilops cylindrica, which acquired conferred resistance to fungal diseases, a comparative analysis of introgressive and parental forms was conducted. two systems of pcr analysis, issr and ssr-pcr, were employed. upon use of 7 issr primers in genotypes of 30 individual plants bc1 f9 belonging to lines 5/55-91 and 5/20-91, 19 issr loci were revealed and assigned to introgressive fragments of aegilops cylindrica genome in triticum aestivum. ...200415648148
development of the single nucleotide polymorphism marker of the wheat lr1 leaf rust resistance gene.the range of publicly available data on plant nucleotide sequences opens a new possibility in the design of snp assays. the purpose of this study was to identify point mutations in genomic sequences closely linked to the lr1 leaf rust resistance gene, and to develop snp markers based on primer extension (snupe) facilitating efficient marker-based selection procedures, e.g. the pyramiding of resistance genes. studies were performed on the panel of 37 wheat cultivars, the set of 41 thatcher near-i ...200415647804
combined use of linked markers for genotyping the pm1 locus in common wheat.genotyping of 98 wheat cultivars/lines was carried out with molecular markers that are linked to the pm1 locus: two bi-allelic (dominant) markers: the sequence-tagged site xsts638-7a and the amplified fragment length polymorphism xe39m58-77-7a; and the multi-allelic simple sequence repeat marker xgwm344-7a. employing segregation data recorded in the population chinese spring x virest (pm1e), genetic mapping revealed that xgwm344-7a and xe39m58-77-7a were distally linked to pm1e in the repulsion ...200415647799
high level of genetic diversity among spelt germplasm revealed by microsatellite markers.the genetic diversity of spelt (triticum aestivum (l.) thell. subsp. spelta (l.) thell.) cultivated presently is very narrow. although the germplasm collections of spelt are extensive, the related genetic knowledge is often lacking and makes their use for genetic improvement difficult. the genetic diversity and structure of the spelt gene pool held in gene banks was determined using 19 simple sequence repeat (ssr) markers applied to 170 spelt accessions collected from 27 countries and 4 continen ...200415644962
[rapd marker analysis of continuous divergent selection in cross-bred population of wheat (triticum aestivum l.)].a base population was established through multi-parent random crossing by using taigu dominant male-sterile wheat, and then five cycles of 2-way selection for four quantitative characters were conducted. the dynamic changes of genetic structures in the open-pollinated wheat population were examined by rapd technique. seven primers in rapd analysis amplified 116 sites. the results of gene frequencies and phenotypic bands showed abundant genetic variations existed in the population. the percentage ...200315639875
[physiological effects of taurine on the growth of wheat (triticum aestivum l.) seedlings].wheat (triticum aestivum l.) seedlings were grown in taurine solution at concentrations of 10, 100, 500, 1000 and 5000 mg/l, and the photochemistry efficiency, the relative permeability of membrane, membrane lipid peroxidation and the growth indexes in wheat seedlings were determined. the results showed that taurine treatments distinctly promoted the growth of wheat seedlings and increased root length, plant height, dry weight and fresh weight single plant of wheat seedlings. in addition, the ph ...200415627716
[effects of nitric oxide on root growth and its oxidative damage in wheat seedling under salt stress].effects of nitric oxide (no), a substance newly found to have protective functions in plants, on root growth of wheat (triticum aestivum l. yangmai 158) seedlings under salt stress were studied. sodium nitroprusside (snp), an no donor, markedly alleviated the inhibitory effect of salt on root elongation at salt concentrations around 150 mmol/l, but was ineffective when nacl concentration was at 300 mmol/l or higher. it was most effective at 0.05-0.1 mmol/l, and had harmful effect at 0.30-5 mmol/ ...200415627712
cloning and characteristics of an allene oxide synthase gene (taaos) of winter wheat.allene oxide synthase (aos) is the first enzyme in the lipoxygenase pathway which leads to the formation of jasmonic acid (ja). a full length cdna of taaos was cloned in winter wheat (triticum aestivum l. cv. jinghua no.3) seedlings. the open reading frame encompassed 1410 bp encoding a polypeptide of 470 amino acids with calculated molecular mass of 51.9 kd. southern blot analysis suggested there are three copies of the gene in wheat genome. the taaos mrna could be strongly induced by exogenous ...200415627690
[research advances in wheat (triticum aestivum) allelopathy].wheat (triticum aestivum) is the main food crop in the world, and plays an important role in agricultural production. in order to enhance wheat yield, herbicides and germicides were intensively applied and made negative effects on the environment. wheat possesses allelopathic potential for weed suppression and disease control through the release of secondary metabolites from its living plants or residues, which could avoid the environment pollution brought by herbicides and germicides. this pape ...200415624846
transfer of small chromosome fragments of agropyron elongatum to wheat chromosome via asymmetric somatic hybridization.the chromosome constitution of hybrids and chromatin patterns of agropyron elongatum (host)neviski in f5 somatic hybrid lines ii -1-3 and i-1-9 between triticum aestivum l. and a. elongatum were analyzed. based on the statistic data of pollen mother cells, f5 i-1-9 and ii-1-3 had 20-21 bivalents with a frequency of 84.66% and 85.28%, of which, 89.83% and 89.57% were ring bivalents. the result indicated that both hybrid lines were basically stable in the chromosome constitution and behavior. rapd ...200415623155
[resolving capacity of monosomic line analysis in cytogenetic studies of common wheat].basing on statistic analysis of the character of homologue pairing in the series of monosomic lines of wheat milturum 553 it was found that the diversions of monosomic and disomic plants from their original parent were caused by the changes in the system of actions and interrelations of genes caused by hemizygous state of chromosomes. resolving capacity of monosomic line analysis as a method of cytogenetic investigations of wheat was demonstrated. input of each chromosome in determination of mei ...200815619985
agropyron elongatum chromatin localization on the wheat chromosomes in an introgression line.the introgressed small-chromosome segment of agropyron elongatum (host.) neviski (thinopyrum ponticum podp.) in f5 line ii-1-3 of somatic hybrid between common wheat (triticum aestivum l.) and a. elongatum was localized by sequential fluorescence in situ hybridization (fish), genomic in situ hybridization (gish) and karyotype data. karyotype analysis offered basic data of arm ratios and relative lengths of 21 pairs of chromosomes in parent wheat jinan177 and hybrid ii-1-3. using special high rep ...200515616822
[trends in genetic diversity change of spring bread wheat cultivars released in russia in 1929-2003].using genealogy analysis, we studied genetic diversity of 340 cultivars of spring bread wheat that were released on the territory of russia in 1929-2003. trends in the temporal change of genetic diversity were inferred from analysis of a set of n x m matrices, where n is the number of the released cultivars and m is the number of original ancestors. the pool of original ancestors of the spring bread wheat cultivars for the total period of study included 255 landraces, of which 88 were from the f ...200415612570
[effects of cytokinin preparations on the stability of the photosynthetic apparatus of two wheat cultivars under water deficiency].carboxylase activities of the key enzyme of carbon metabolism, ribulose-bisphosphate carboxylase/oxygenase (rubisco; ec 4.1.1.39), and phosphoenolpyruvate carboxylase (pepc; ec 4.1.1.31), as well as intensities of carbon dioxide photosynthetic assimilation in young seedlings and adult leaves of the wheat triticum aestivum l. cultivars mironovskaya 808 (a more tolerant) and lyutestsens 758 (a less tolerant), were compared under conditions of progressive water deficiency. the water stress had more ...201315609857
real time rt-pcr and flow cytometry to investigate wheat kernel hardness: role of puroindoline genes and proteins.developing seeds from triticum aestivum (wheat) cultivars were collected after flowering and analysed for puroindoline a and b gene expression by real time rt-pcr. mature seeds were investigated for the presence and the amount of starch-associated puroindoline a and b proteins by flow cytometry. puroindoline a gene and protein were found to have a predominant role in controlling wheat kernel hardness.200415604827
a mini exon in the sucrose:sucrose 1-fructosyltransferase gene of wheat.we previously reported the cloning of a wheat sucrose:sucrose 1-fructosyltransferase (1-sst) cdna, designated wft2. wft2 proteins have fructosyltransferase enzyme activity and initiate fructan synthesis (biosci. biotechnol. biochem. 66 (2002) 2297). in the current study, we cloned a genomic dna fragment carrying the full-length 1-sst gene from winter wheat (triticum aestivum). the genomic 1-sst gene is 3326 bp in length and contains four exons and three introns. exon 2 has only 9 bp. this sequen ...200415602819
chloroplast and nuclear dna variation in common wheat: insight into the origin and evolution of common wheat.to understand the origin and evolution of common wheat, chloroplast (ct) and nuclear dna variations were studied in five hexaploid and three tetraploid wheat subspecies. based on chloroplast simple sequence repeats at 24 loci, they were classified into two major plastogroups. plastogroup i consisted of 11 plastotypes, including the major plastotype h10 that occurred at the highest frequency (59%) in common wheat. plastogroup ii consisted of five plastotypes and occurred in eight out of 27 access ...200415599057
[exogenous nitric oxide alleviates osmotic stress-induced membrane lipid peroxidation in wheat seedling leaves].when wheat (triticum aestivum l. yangmai 158) seedling (with three fully expanded leaves) roots were treated with 15% peg-6000 in combination with different concentrations (0.1 and 0.5 mmol/l) of exogenous nitric oxide donor sodium nitroprusside (snp) and no(-)(3)/no(-)(2) (control), the enhancement of lipoxygenase (lox) activity in wheat seedling leaves under osmotic stress was delayed at the lower concentration of snp treatment (0.1 mmol/l), while the generation rate of o(-.)(2), the enhanceme ...200415599047
two point mutations identified in emmer wheat generate null wx-a1 alleles.in this report, the wx-a1 mutations carried by a triticum dicoccoides line from israel and a triticum dicoccum line from yugoslavia are characterized. a single nucleotide insertion in the t. dicoccoides null allele and a single nucleotide deletion in the t. dicoccum null allele each cause frameshift mutations that induce premature termination codons more than 55 nucleotides upstream of the last exon-exon junction. in both mutants, wx-a1 transcripts were detectable in 10 day post-anthesis endospe ...200515592661
preferential expression of a hlp homolog encoding a mitochondrial l14 ribosomal protein in stamens of common wheat.interaction between nucleus and cytoplasm has essential roles in plant development, including that of floral organs. we isolated a wheat homolog whlp of arabidopsis huellenlos paralog (hlp) gene encoding a mitochondrial (mt) ribosomal protein l14. transient expression analysis using the green fluorescent protein (gfp) fusion protein showed that 50 amino residues located on the n-terminal of the wheat hlp homolog (whlp) protein acted as a mt-targeting signal (mts). expression patterns of the whlp ...200415588583
ftir imaging of wheat endosperm cell walls in situ reveals compositional and architectural heterogeneity related to grain hardness.endosperm cell walls of cultivars of wheat (triticum aestivum l.) selected for their endosperm texture (two soft and two hard) were analysed in situ by fourier transform infrared (ftir) microspectroscopy. ftir imaging coupled with statistical analysis was used to map the compositional and structural heterogeneity within transverse sections from which cell contents had been removed by sonication. in the majority of grains analysed, two distinct populations of endosperm cells could be identified b ...200515580525
a reverse genetic, nontransgenic approach to wheat crop improvement by tilling.we report the use of tilling (targeting induced local lesions in genomes), a reverse genetic, nontransgenic method, to improve a quality trait in a polyploid crop plant. waxy starches, composed mostly of amylopectin, have unique physiochemical properties. wheat with only one or two functional waxy genes (granule-bound starch synthase i, or gbssi) produces starch with intermediate levels of amylopectin. we have identified 246 alleles of the waxy genes by tilling each homoeolog in 1,920 allohexapl ...200515580263
[analysis of intraspecific divergence of hexaploid wheat triticum spelta l. by chromosome c-banding].intraspecific divergence of hexaploid wheat triticum spelta was studied by chromosome c-banding in 41 accessions of different geographic origins. the spelt accessions did not differ in karyotype structure or heterochromatin distribution from common wheat, but showed greater intraspecific polymorphism for chromosome rearrangements (translocations, inversions) and banding patterns. on evidence of c-banding patterns, spelt was assumed to occupy an intermediate position between tetraploid and hexapl ...200415575503
the relation of starch phosphorylases to starch metabolism in wheat.tissues of wheat (triticum aestivum l., var. star) exhibit three starch phosphorylase activity forms resolved by non-denaturing polyacrylamide gel affinity electrophoresis (p1, p2 and p3). compartmentation analysis of young leaf tissues showed that p3 is plastidic, whereas p1 and p2 are cytosolic. p1 exhibits a strong binding affinity to immobilized glycogen upon electrophoresis, whereas p2 and the chloroplastic p3 do not. cytosolic leaf phosphorylase was purified to homogeneity by affinity chro ...200415564531
a nearest-neighboring-end algorithm for genetic mapping.high-throughput methods are beginning to make possible the genotyping of thousands of loci in thousands of individuals, which could be useful for tightly associating phenotypes to candidate loci. current mapping algorithms cannot handle so many data without building hierarchies of framework maps.200515564296
relationship between atpase activity and conjugated polyamines in mitochondrial membrane from wheat seedling roots under osmotic stress.the effects of osmotic stress on the atpase activity, the contents of -sh group and conjugated polyamines in mitochondrial membrane from wheat seedling [triticum aestivum l. cv. yumai no. 18 (drought-tolerant) and cv. yumai no. 9 (drought-sensitive)] roots were investigated. the results showed that atpase activity and -sh group content decreased with polyethylene glycol(peg) 6000(-0.55 mpa) treatment for 7 d, in concert with the decrease of the ratio of noncovalently conjugated spermidine (ncc-s ...200415559797
[resistance to fungal diseases in hybrid progeny from crosses between common wheat variety saratovskaia 29 and the amphidiploid triticum timopheevii/triticum tauschii (aaggdd)].the progeny of bc6f2-bc9f(2)-4 has been analyzed for resistance to brown rust (lr genes) and powdery mildew (pm genes). this progeny was obtained due to introgression of the alien material from the synthetic hexaploid wheat triticum timopheevii/aegilops squarrosa (= triticum tauschii aaggdd, 2n = 42) into the common wheat variety saratovskaya 29. against the background of natural infection, the lines resistant to both diseases and to either of them were developed. the brown-rust and powdery-mild ...200415559157
[barley chromosome identification using genomic in situ hybridization in the genome of backcrossed progeny of barley-wheat amphiploids [h. geniculatum all. (2n = 28) x t. aestivum l. (2n = 42)] (2n = 70)].genomic in situ hybridization (gish) has been used to study characteristics of the formation of alloplasmic lines detected among self-pollinated backcrossed progeny (bc1f5-bc1f8) of barley--wheat amphiploids [hordeum geniculatum all. (2n = 28) x triticum aestivum l. (2n = 42)] (2n = 70). the chromosome material of the wild barley h. geniculatum has been shown to contribute to these lines. for example, fifth-generation plants (bc1f5) had genotypes (2n = 42w + 2g), (2n = 42w + 1g + 1tg), and (2n = ...200415559151
[the effect of lr19-translocation on in vitro androgenesis and inheritance of leaf-rust resistance in dh3 lines and f2 hybrids of common wheat].leaf-rust resistance and androgenesis were studied in the anther cultures of triticum aestivum l., which included saratovskaya 29 cultivar, the isogenic line ps29, and three f1 hybrids (l503/s55, l504/s58, ats7/l1063) with 7ds-7dl-7ae#1l translocation of lr19 gene (lr19 translocation) from agropyron elongatum (host) p.b. the lr19 translocation was shown to affect the induction of embryogenesis and green plant regeneration. the frequencies of lr19 translocation differed in f2 hybrids obtained by ...200415559150
qtl analysis and comparative genomics of herbage quality traits in perennial ryegrass (lolium perenne l.).genetic control of herbage quality variation was assessed through the use of the molecular marker-based reference genetic map of perennial ryegrass (lolium perenne l.). the restriction fragment length polymorphism (rflp), amplified fragment length polymorphism (aflp) and genomic dna-derived simple sequence repeat-based (ssr) framework marker set was enhanced, with rflp loci corresponding to genes for key enzymes involved in lignin biosynthesis and fructan metabolism. quality traits such as crude ...200515558228
[effect of salicylic acid on the activity of antioxidant enzymes in wheat under conditions of salination].the effect of pretreatment with 0.05 mm salicylic acid (sa) on the activity of superoxide dismutase (sod) and peroxidase in the roots of four-day-old seedlings of wheat (triticum aestivum l.) was studied under conditions of salination. the level of the stress-induced accumulation of active oxygen species and, therefore, activities of sod and peroxidase in seedlings pretreated with sa were significantly lower than in untreated seedlings, which indicates that these enzymes contribute to the protec ...201515553791
detection and mapping of qtl for earliness components in a bread wheat recombinant inbred lines population.earliness, an adaptative trait and factor of variation for agronomic characters, is a major trait in plant breeding. its constituent traits, photoperiod sensitivity (ps), vernalization requirement (vr) and intrinsic earliness (ie), are largely under independent genetic controls. mapping of major genes and quantitative trait loci (qtl) controlling these components is in progress. most of the studies focusing on earliness considered it as a whole or through one (or two) of its components. the purp ...200415551039
two quality-associated hmw glutenin subunits in a somatic hybrid line between triticum aestivum and agropyron elongatum.high-molecular-weight glutenin subunits (hmw-gss) from hybrid line ii-12 between wheat (triticum aestivum l.) and agropyron elongatum (host) nivski were characterized with sds-page. out of these hmw-gss, two subunits, h1bx and h1by, had mobilities similar to the subunits 1bx13 and 1by16 from common wheat 4072, which was used as control. polyclonal antibodies (pabs) of h1bx and h1by were prepared, and western blotting showed that the pabs had strong affinities for h1bx and h1by, separately. the s ...200415551037
single and joint toxicity of chlorimuron-ethyl, cadmium, and copper acting on wheat triticum aestivum.investigation of the toxicological effects of some agricultural pollutants on germination rate and on shoot and root elongation of wheat (triticum aestivum) was carried out. seeds of wheat were exposed to various concentrations of chlorimuron-ethyl with or without cadmium and copper addition. the inhibitory rates of seed germination and shoot and root elongation of wheat were calculated. significant linear relationships between the root and shoot elongation and the concentration of chlorimuron-e ...200515546632
sex ratios of sitodiplosis mosellana (diptera: cecidomyiidae): implications for pest management in wheat (poaceae).sex ratios of populations of the wheat midge sitodiplosis mosellana gehin, developing on wheat triticum aestivum l., were determined at reproduction, adult emergence, and dispersal. the patterns of sex ratio through the life cycle of s. mosellana result from: (i) a genetic mechanism that causes all or nearly all of the progeny of individual females to be a single sex, with an overall sex ratio that is slightly biased at 54-57% females; (ii) a differential mortality during diapause that increases ...200415541195
a biocatalyst for the removal of sulfite from alcoholic beverages.the presence of sulfites in alcoholic beverages, particularly in wines, can cause allergic responses with symptoms ranging from mild gastrointestinal problems to life threatening anaphylactic shock in a substantial portion of the population. we have developed a simple and inexpensive biocatalytic method that employs wheatgrass (triticum aestivum) chloroplasts for the efficient oxidation of sulfites in wines to innocuous sulfates. a sufficiently high rate of sulfite oxidation was obtained in the ...200515540199
radionuclide transport above a near-surface water table: iv. soil migration and crop uptake of chlorine-36 and technetium-99, 1990 to 1993.vertical distributions of (36)cl and (99)tc are presented from deep and shallow lysimeters above artificially controlled water tables for a 4-yr experiment from 1990 to 1993. activity concentration profiles were all measured in late summer when a winter wheat (triticum aestivum l. cv. pastiche) crop was harvested. after harvest, activity concentrations in different organs of the crop were determined and crop uptake quantified as both an inventory ratio (ir) and a transfer factor (tf(w)), weighte ...201315537950
selective transcriptional down-regulation of anther invertases precedes the failure of pollen development in water-stressed wheat.water deficit during male meiosis in wheat (triticum aestivum l.) causes pollen sterility. with a view to identifying the internal trigger for this failure, it was found that water stress specifically impairs the activities of vacuolar and cell-wall invertases in anthers prior to the arrest of pollen development. the enzymes are affected only when water deficit occurs around meiosis. three invertase cdnas, two encoding the cell-wall (ivr1, ivr3) and one the vacuolar (ivr5) isoform, were isolated ...200515533880
immunochemical approach to the problem of differential determination of natural forms of abscisic acid.an original modification of the standard elisa procedure for differential determination of different forms of abscisic acid (aba) is proposed. it is shown that endogenous forms of aba may be quantitatively determined in plant tissues subjected to minimal treatment, without purification of the hormones and their chemical modification. the modification has been approved when analyzing changes in the content of different aba forms in plant tissues differing in physiological activity. quantitative d ...200415527409
fingerprinting of common wheat cultivars with an alw44i-based aflp method.a simplified aflp method, based on methylation-sensitive alw44i restriction endonuclease, has been developed and evaluated for fingerprinting 15 wheat cultivars. the selected germplasms represented groups of spring and winter wheats with and without the 1bl.1rs translocation. ten selective primers yielded 57 markers, including 19 polymorphic bands. three markers (15.8%) were specific to wheat carrying the 1bl.1rs translocation, thus conflicting with the frequency expected by random marker distri ...200415523150
effect of chemical amendments on the concentration of cadmium and lead in long-term contaminated soils.the availability of metal in contaminated soil can be reduced by the addition of soil amendments. the objectives of this study are to study the effects of applying different soil amendments on the concentration of cd and pb in soil solution, dtpa or edta extractable cd and pb, and the uptake of cd and pb by wheat (triticum vulgare) when growing in long-term cd and pb-contaminated soils, more than 20 years. the soil amendments, including check, compost, zinc oxide, calcium carbonate, calcium carb ...200415519390
a rapid response of beta-amylase to nitric oxide but not gibberellin in wheat seeds during the early stage of germination.the effects of nitric oxide (no) and gibberellic acid (ga(3)) on the responses of amylases in wheat (triticum aestivum l.) seeds (caryopses) were investigated during the first 12 h of germination. ga(3) had no effects on the activities of alpha-amylase (ec 3.2.1.1) or beta-amylase (ec 3.2.1.2), either in intact seeds or embryoless halves within 12 h. in contrast, addition of sodium nitroprusside (snp), an no donor, was able to induce a rapid increase in beta-amylase activity without affecting al ...200515517355
construction of a full-length cdna library from young spikelets of hexaploid wheat and its characterization by large-scale sequencing of expressed sequence tags.the polyploid nature of wheat is a key characteristic of the plant. full-length complementary dnas (cdnas) provide essential information that can be used to annotate the genes and provide a functional analysis of these genes and their products. we constructed a full-length cdna library derived from young spikelets of common wheat, and obtained 24056 expressed sequence tags (ests) from both ends of the cdna clones. these ests were grouped into 3605 contigs using the phrap method, representing exp ...200415514442
a chromosome bin map of 16,000 expressed sequence tag loci and distribution of genes among the three genomes of polyploid wheat.because of the huge size of the common wheat (triticum aestivum l., 2n = 6x = 42, aabbdd) genome of 17,300 mb, sequencing and mapping of the expressed portion is a logical first step for gene discovery. here we report mapping of 7104 expressed sequence tag (est) unigenes by southern hybridization into a chromosome bin map using a set of wheat aneuploids and deletion stocks. each est detected a mean of 4.8 restriction fragments and 2.8 loci. more loci were mapped in the b genome (5774) than in th ...200415514046
a chromosome bin map of 2148 expressed sequence tag loci of wheat homoeologous group 7.the objectives of this study were to develop a high-density chromosome bin map of homoeologous group 7 in hexaploid wheat (triticum aestivum l.), to identify gene distribution in these chromosomes, and to perform comparative studies of wheat with rice and barley. we mapped 2148 loci from 919 est clones onto group 7 chromosomes of wheat. in the majority of cases the numbers of loci were significantly lower in the centromeric regions and tended to increase in the distal regions. the level of dupli ...200415514045
deletion mapping of homoeologous group 6-specific wheat expressed sequence tags.to localize wheat (triticum aestivum l.) ests on chromosomes, 882 homoeologous group 6-specific ests were identified by physically mapping 7965 singletons from 37 cdna libraries on 146 chromosome, arm, and sub-arm aneuploid and deletion stocks. the 882 ests were physically mapped to 25 regions (bins) flanked by 23 deletion breakpoints. of the 5154 restriction fragments detected by 882 ests, 2043 (loci) were localized to group 6 chromosomes and 806 were mapped on other chromosome groups. the numb ...200415514044
analysis of expressed sequence tag loci on wheat chromosome group 4.a total of 1918 loci, detected by the hybridization of 938 expressed sequence tag unigenes (ests) from 26 triticeae cdna libraries, were mapped to wheat (triticum aestivum l.) homoeologous group 4 chromosomes using a set of deletion, ditelosomic, and nulli-tetrasomic lines. the 1918 est loci were not distributed uniformly among the three group 4 chromosomes; 41, 28, and 31% mapped to chromosomes 4a, 4b, and 4d, respectively. this pattern is in contrast to the cumulative results of est mapping in ...200415514042
chromosome bin map of expressed sequence tags in homoeologous group 1 of hexaploid wheat and homoeology with rice and arabidopsis.a total of 944 expressed sequence tags (ests) generated 2212 est loci mapped to homoeologous group 1 chromosomes in hexaploid wheat (triticum aestivum l.). est deletion maps and the consensus map of group 1 chromosomes were constructed to show est distribution. est loci were unevenly distributed among chromosomes 1a, 1b, and 1d with 660, 826, and 726, respectively. the number of est loci was greater on the long arms than on the short arms for all three chromosomes. the distribution of ests along ...200415514039
construction and evaluation of cdna libraries for large-scale expressed sequence tag sequencing in wheat (triticum aestivum l.).a total of 37 original cdna libraries and 9 derivative libraries enriched for rare sequences were produced from chinese spring wheat (triticum aestivum l.), five other hexaploid wheat genotypes (cheyenne, brevor, tam w101, bh1146, butte 86), tetraploid durum wheat (t. turgidum l.), diploid wheat (t. monococcum l.), and two other diploid members of the grass tribe triticeae (aegilops speltoides tausch and secale cereale l.). the emphasis in the choice of plant materials for library construction w ...200415514038
development of an expressed sequence tag (est) resource for wheat (triticum aestivum l.): est generation, unigene analysis, probe selection and bioinformatics for a 16,000-locus bin-delineated map.this report describes the rationale, approaches, organization, and resource development leading to a large-scale deletion bin map of the hexaploid (2n = 6x = 42) wheat genome (triticum aestivum l.). accompanying reports in this issue detail results from chromosome bin-mapping of expressed sequence tags (ests) representing genes onto the seven homoeologous chromosome groups and a global analysis of the entire mapped wheat est data set. among the resources developed were the first extensive public ...200415514037
responses of female orange wheat blossom midge, sitodiplosis mosellana, to wheat panicle volatiles.air entrainment samples of volatiles from panicles of intact wheat, triticum aestivum, cultivar 'lynx' were collected at the ear emergence/early anthesis growth stage. in an olfactometer bioassay, both freshly cut panicles and an air entrainment sample were found to attract female orange wheat blossom midge adults, sitodiplosis mosellana. coupled gas chromatography-electroantennography (gc-eag) analyses of panicle volatiles located six electrophysiologically active components. these were identif ...200415503522
effect of salinity on tissue architecture in expanding wheat leaves.salinity greatly reduces the leaf cross-sectional area of wheat (triticum aestivum l.) during its development, which may lead to variation in the architectural properties of growing leaves that would result in a change in leaf physiological functions. our objective was to characterize the effect of salinity on the spatial distribution of the cross-sectional area and the anatomy of large and small veins of a growing wheat leaf. spring wheat was grown in a growth chamber in soils with or without 1 ...200515503127
sequence composition, organization, and evolution of the core triticeae genome.we investigated the composition and the basis of genome expansion in the core triticeae genome using aegilops tauschii, the d-genome donor of bread wheat. we sequenced an unfiltered genomic shotgun (trs) and a methylation-filtration (tmf) library of a. tauschii, and analyzed wheat expressed sequence tags (ests) to estimate the expression of genes and transposable elements (tes). the sampled d-genome sequences consisted of 91.6% repetitive elements, 2.5% known genes, and 5.9% low-copy sequences o ...200415500466
simultaneous painting of three genomes in hexaploid wheat by bac-fish.fluorescence in situ hybridization (fish) is widely used in the physical mapping of genes and chromosome landmarks in plants and animals. bacterial artificial chromosomes (bacs) contain large inserts, making them amenable for fish mapping. in our bac-fish experiments, we selected 56 restriction fragment length polymorphism (rflp)-locus-specific bac clones from the libraries of triticum monococcum and aegilops tauschii, which are the a- and d-genome donors of wheat (triticum aestivum, 2n = 6x = 4 ...200415499412
[a preliminary study on gene expression profile induced by water stress in wheat (triticum aestivum l.) seedling].in the present research, suppression subtractive hybridization (ssh) and high density membrane techniques were employed to analysis genes induced by water stress in wheat seedling at 2-leaf stage. the purpose was to comprehensively understand the genetic bases of drought resistance and to find the key genes related to drought resistance in wheat. a total of 181 positive clones were obtained by screening the ssh library including 1 530 individual recombinant clones. the result of the sequence hom ...200415481541
degradation studies on benzoxazinoids. soil degradation dynamics of 2,4-dihydroxy-7-methoxy-(2h)-1,4-benzoxazin-3(4h)-one (dimboa) and its degradation products, phytotoxic allelochemicals from gramineae.benzoxazinoids have been described as important allelochemicals from gramineae as well as acanthaceae, rannunculaceae, and scrophulariaceae plants. several bioactivities have been described and evaluated for these compounds, including fungistatic, antifeedant, and phytotoxic. in ongoing studies about allelochemicals as natural herbicide models, the description of soil dynamics in phytotoxic agents has high importance, because the possible biotransformations developed by soil microorganisms could ...200415478999
engineering high-level aluminum tolerance in barley with the almt1 gene.acidity is a serious limitation to plant production on many of the world's agricultural soils. toxic aluminium (al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. recent work has shown that the almt1 gene of wheat (triticum aestivum) encodes a malate transporter that is associated with malate efflux and al tolerance. we generated transgenic barley (hordeum vulgare) plants expressing almt1 and assessed their ability to exude mala ...200415471989
compositions and sorptive properties of crop residue-derived chars.chars originating from the burning or pyrolysis of vegetation may significantly sorb neutral organic contaminants (nocs). to evaluate the relationship between the char composition and noc sorption, a series of char samples were generated by pyrolyzing a wheat residue (triticum aestivum l.) for 6 h at temperatures between 300 degrees c and 700 degrees c and analyzed for their elemental compositions, surface areas, and surface functional groups. the samples were then studied for their abilities to ...200415461175
[effect of the 5r(5a) alien chromosome substitution on the growth habit and winter hardiness of wheat].the growth habit, ear emergence time, and frost tolerance of wheat/rye substitution lines have been studied in cultivars rang and mironovskaya krupnozernaya whose chromosome 5a is substituted with chromosome 5r of onkhoyskaya rye. hybrid analysis has demonstrated that the spring habit of the recipient cultivars rang and mironovskaya krupnozernaya is controlled by dominant gene vrn-a1 located in chromosome 5a. onokhoyskaya rye has a dominant gene for the spring habit (sp1) located in chromosome 5 ...200415458211
durum wheat as a candidate for the unknown female progenitor of bread wheat: an empirical study with a highly fertile f1 hybrid with aegilops tauschii coss.hexaploid bread wheat was derived from a hybrid cross between a cultivated form of tetraploid triticum wheat (female progenitor) and a wild diploid species, aegilops tauschii coss. (male progenitor). this cross produced a fertile triploid f1 hybrid that set hexaploid seeds. the identity of the female progenitor is unknown, but various cultivated tetraploid triticum wheats exist today. genetic and archaeological evidence suggests that durum wheat ( t. turgidum ssp. durum) may be the female progen ...200415448900
determination and evaluation of the sequence and textural effects of the puroindoline a and puroindoline b genes in a population of synthetic hexaploid wheat.aegilops tauschii (2 n=2 x=14, dd) is a rich source of genetic variability for hexaploid wheat ( triticum aestivum, 2 n=6 x=42, aabbdd) improvement. this variability can be accessed through utilizing synthetic hexaploid wheat lines, which contain genomes from ae. tauschii and t. turgidum (2 n=4 x=28, aabb). numerous desirable characteristics can and have been introgressed into common hexaploid wheat with this germplasm. in this work, the genetic variability in the two puroindoline genes (a and b ...200415448897
auxin induces an increase of ca2+ concentration in the cytosol of wheat leaf protoplasts.auxin addition to protoplasts isolated from leaves of 6-day-old wheat seedlings (triticum aestivum l. cv. kadett) induced a rapid increase in the cytosolic calcium concentration [ca2+]cyt. the shifts in [ca2+]cyt were detected by use of fluorescence microscopy in single protoplasts loaded with the calcium binding tetra[acetoxymethyl]ester of the fluorescent dye, fura 2. addition of the synthetic auxin naphthyl acetic acid, 1-naa, induced an increase in [ca2+]cyt within 5-10s, while the physiolog ...200415384405
molecular cloning and comparative analysis of a y-type inactive hmw glutenin subunit gene from cultivated emmer wheat (triticum dicoccum l.).cultivated emmer (triticum dicoccum, 2n = 4x = 28, aabb) is closely related to bread wheat and possesses extensive allelic variations in high molecular weight glutenin subunit (hmw-gs) composition. these alleles may be an important genetic resource for wheat quality improvement. to isolate and clone hmw-gs genes from cultivated emmer, two pairs of allele-specific (as) pcr primers were designed to amplify the coding sequence of y-type hmw-gs genes and their upstream sequences, respectively. the r ...200415383071
characterization of the common wheat (triticum aestivum l.) mutation line producing three pistils in a floret.in a normal wheat (triticum ssp.l.) spike, one floret carries only one pistil that will further develop into one grain after fertilization. the cultivated common wheat (t. aestivum l.) mutation line three pistils (tp) carried three pistils in a floret. although one or two of the pistils died out before seed set in some florets, there were exist many florets that set three seeds. normally, it was observed that there were one to three seeds in different florets of the same spike. therefore, this m ...200415383067
[comparative characteristics of reproduction of the wheat striped mosaic virus in winter and spring triticum aestivum l. in natural agrocoenosis and during clinostatting].microgravity (a transformed environment) was produced with the use of a multi-purpose clinostat. object of the investigation was wheat striped mosaic virus (wsmv) affecting a great variety of wheat species in natural agrocoenosis, and super-dwarf cultivar apogee in the transformed environment. enzyme immunodetection (das-elisa) as well as electron microscopy were employed for virus identification. viral reproduction was found high (titre 1/2560) in winter and spring wheat species in agrocoenosis ...200615372798
construction of a subgenomic bac library specific for chromosomes 1d, 4d and 6d of hexaploid wheat.the analysis of the hexaploid wheat genome (triticum aestivum l., 2 n=6 x=42) is hampered by its large size (16,974 mb/1c) and presence of three homoeologous genomes (a, b and d). one of the possible strategies is a targeted approach based on subgenomic libraries of large dna inserts. in this work, we purified by flow cytometry a total of 10(7) of three wheat d-genome chromosomes: 1d, 4d and 6d. chromosomal dna was partially digested with hindiii and used to prepare a specific bacterial artifici ...200415365624
1h magnetization transfer in hydrated gluten and flour: effects of wheat aging.the interaction of water with flour or gluten in hydrated samples was investigated by proton magnetization transfer measurements. flour and gluten from both durum and bread wheat seeds, either unaged or artificially aged over different periods of time, were investigated. measurements were performed at several radio frequency power levels and frequency offsets, and the data were quantitatively modeled by two interacting pools, a liquid (water) and a solid (macromolecules) one. a super-lorentzian ...201715360294
[effect of vernalization and red light illumination of seedlings of bread wheat (triticum aestivum l.) on the temperature profile of the camp phosphodiesterase activity].phenotypic manifestations of vrn (vernalization) and ppd (photoperiodism) genes responsible for transition of bread wheat triticum aestivum l. to generative growth (flowering) are mutually related. since the mechanism of phytochrome-induced photoperiodism involves the enzymes of cyclic adenosine monophosphate metabolism and phosphodiesterase in particular, we tested involvement of phosphodiesterase in the process of winter wheat vernalization and formation of flowering competence in alternate wh ...201615354954
conserved extracellular cysteine residues and cytoplasmic loop-loop interplay are required for functionality of the heptahelical mlo protein.we performed a structure-function analysis of the plasma membrane-localized plant-specific barley (hordeum vulgare) mlo (powdery-mildew-resistance gene o) protein. invariant cysteine and proline residues, located either in extracellular loops or transmembrane domains that have been conserved in mlo proteins for more than 400 million years, were found to be essential for mlo functionality and/or stability. similarly to many metazoan g-protein-coupled receptors known to function as homo- and heter ...200515352871
proteomic analysis of aneuploid lines in the homeologous group 1 of the hexaploid wheat cultivar courtot.three monosomic lines (msls) and three nullisomic lines (nsls) of the homeologous group 1 and one euploid line of the bread wheat triticum aestivum cultivar courtot were used in a proteomic approach to investigate the effects of zero, one or two doses of chromosomes 1a, 1b and 1d on the amount of endosperm proteins. polypeptides whose amounts changed significantly between each aneuploid line and the euploid line were identified using image analyses of two-dimensional gel electrophoresis patterns ...200415352243
[mechanisms of protective action of wheat germ agglutinin on cell growth in wheat seedling roots under salinity].effects of 20 nm wheat germ agglutinin (wga) on relative growth rate, mitotic index (mi) and the cell area in the root extension zone were investigated in seedling of triticum aestivum l. under the influence of 2% nacl. it was elucidated that pretreatment of wheat seedling with wga prevented a salinity induced inhibition of root cell growth, and accelerated the restoration of cell growth after stress removal. the protective wga effect on root cell growth may be due, presumably, to reorganization ...200415346789
dissecting large and complex genomes: flow sorting and bac cloning of individual chromosomes from bread wheat.the analysis of the complex genome of common wheat (triticum aestivum, 2n = 6x = 42, genome formula aabbdd) is hampered by its large size ( approximately 17 000 mbp) and allohexaploid nature. in order to simplify its analysis, we developed a generic strategy for dissecting such large and complex genomes into individual chromosomes. chromosome 3b was successfully sorted by flow cytometry and cloned into a bacterial artificial chromosome (bac), using only 1.8 million chromosomes and an adapted pro ...200415341637
Displaying items 5901 - 6000 of 7762