| effect of cyclophosphamide treatment on clinical and serologic response of rats to infection with leptospira interrogans serovar icterohaemorrhagiae. | young albino rats were immunosuppressed with cyclophosphamide and exposed to virulent and low-virulence leptospira interrogans serovar icterohaemorrhagiae 820k. in rats exposed to virulent and low virulence leptospires, microscopic agglutinating antibody responses occurred later, and longer leptospiremic phase and more massive tissue invasion by the organisms were observed in immunosuppressed rats than in immunocompetent controls. clinical and pathologic signs of illness were more severe in the ... | 1980 | 7224292 |
| leptospira interrogans serovar hardjo vaccination of pregnant beef cows and subsequent growth rate of progeny. | five experiments with leptospira interrogans serovar hardjo vaccine were carried out over a 6-year period in pregnant brahman-cross and sahiwal-cross cows in the dry tropics on northern queensland. the numbers ranged from 127 breeders aged 2 to 5 years in 1972 to 344 breeders aged 2 to 9 years in 1977. half of the cows were vaccinated twice in mid-pregnancy except for 1977, when they were vaccinated once. in 1975-1977 inclusive, half of the heifers were given an additional dose of vaccine at com ... | 1980 | 7225005 |
| leptospira interrogans serovars hardjo and pomona: causes of infections in dairy cows and humans in florida. | leptospirosis was diagnosed in 11 milkers on 3 dairy farms in a florida county. serologic test results identified leptospira interrogans serovar hardjo as the infecting organism in milkers and cows on one farm, and hardjo was isolated from two cows. on the second farm, serovars hardjo and pomona were implicated serologically in the cows and milkers, and pomona was isolated from two milkers. on the third farm, hardjo infection was identified by serologic tests in one milker, and hardjo was isolat ... | 1981 | 7232685 |
| diseases of cattle in the solomon islands. | between 1967 and 1977 a study was made of diseases of cattle in the solomon islands. tuberculosis was found in only 3 herds and was eradicated by 1975. brucellosis serology revealed very few reactors and by 1977 the herds involved were considered free of the disease. significant serological reactions were found to leptospira interrogans serovars pomona, hardjo, autumnalis and jez-bratislava. there was evidence that infectious bovine rhinotracheitis and mucosal disease were present. seventeen par ... | 1980 | 7247885 |
| pathogenic leptospira isolates from the caribbean islands of trinidad, grenada and st. vincent. | all known isolates of leptospira interrogans obtained in trinidad, grenada and st. vincent up to the end of 1979 are listed. there were 80 from trinidad, 20 from grenada and 2 from st. vincent, representing at least 20 serotypes from 11 or more serogroups. six of the serotypes were first reported from trinidad. the leptospires were isolated from man, domestic animals and wildlife species. | 1980 | 7251267 |
| analyses for neutralizing activities of immunoglobulin fractions in anti-leptospiral horse antiserum. | the 7s and 19s fraction isolated from hyperimmunized antileptospiral horse sera by sephadex g-200 gel filtration and gamma- and t-globulin fractions from the antisera by starch block electrophoresis were studied for neutralizing (leptospiricidal) activities against infection with leptospira. the activity was determined by the intracutaneous method with virulent shibaura strain of leptospira interrogans serovar copenhageni. no significant difference in regression coefficient was observed between ... | 1980 | 7265554 |
| serum biochemical changes in dogs with experimental leptospira interrogans serovar icterohaemorrhagiae infection. | inoculation of 2 groups of dogs with 1 x 10(9) and 4 x 10(9) leptospira interrogans serovar icterohaemorrhagiae produced disease varying from transient fever to uremia and death. clinical signs of disease in the severely affected dogs were fever, dehydration, depression, and icterus. laboratory changes in serum of infected dogs included increased urea nitrogen, creatinine, phosphorus, alkaline phosphatase, total bilirubin, aspartate aminotransferase, and alanine aminotransferase. chloride concen ... | 1981 | 7271027 |
| role of cattle in the maintenance of leptospira interrogans serotype hardjo infection in northern ireland. | kidneys of cattle, mice and badgers were cultured for leptospires in an attempt to evaluate the relative importance of these species in the epidemiology of bovine leptospirosis caused by the hebdomadis serogroup. leptospires closely related to serotype hardjo were recovered from 57 (28.5 per cent) of 200 cattle examined but no evidence of infection was found in either badgers or mice, indicating that cattle act as the maintenance host for serotype hardjo. many cattle were seronegative carriers. | 1981 | 7303438 |
| [antagonistic properties of leptospira interrogans]. | | 1981 | 7306364 |
| isolation of antigenically active components from leptospiral serovar-specific lipopolysaccharide antigen by alkaline treatment. | the serovar-specific main antigen (tm antigen) of leptospira interrogans serovar canicola, which as lipopolysaccharide properties, was treated with 0.1 n sodium hydroxide. this treatment degraded the antigen into two major antigenic components, one of high and one of low molecular weight. the component with the lower molecular weight (approximately 4,000 daltons) consisted mainly of carbohydrates, having lost almost all of the fatty acid and protein components of the original antigen. although t ... | 1981 | 7311890 |
| seroepidemiology of leptospira interrogans serovar hardjo in colorado antelope and cattle. | a seroepidemiologic study was conducted to determine the prevalence of leptospira interrogans serovar hardjo infection in colorado cattle and antelope. sera were tested by the microscopic agglutination test, using a standard battery of 12 antigens as well as 4 additional serovars of the hebdomadis serogroup: hardjo, szwajizak, sejroe, and balcanica. sera from 1,856 cattle and 544 antelope were tested. in both populations, the predominant serovar detected was hardjo; hardjo titers greater than or ... | 1981 | 7327994 |
| use of solid medium for isolation of leptospires of the hebdomadis serogroup from bovine milk and urine. | leptospira interrogans serovars hardjo and szwajizak were isolated from the milk of experimentally infected cows only when using bovine albumin polysorbate-80 solid medium. semisolid media, with and without the addition of 5-fluorouracil, and hamster inoculations were also used in the isolation attempts. these cultural isolation methods were also compared using cows' urine. semisolid medium with 5-fluorouracil proved to be the most successful. however, the other methods were satisfactory, with s ... | 1981 | 7340582 |
| a serological survey of leptospira interrogans serotype pomona in alberta and saskatchewan striped skunks and possible transmission between cattle and skunks. | the range of known occurrence of leptospira interrogans serotype pomona is extended to alberta in striped skunks (mephitis mephitis); no evidence of l. sejroe was found. reacting sera from skunks were confined to the southern portion of alberta and adjacent saskatchewan, although a number of reactors were found sufficiently further north in saskatchewan suggesting that a different mode of infection may be functioning there. of 95 skunk sera from near a dairy farm infected with serotype pomona 40 ... | 1981 | 7343072 |
| observations on kidney damage in hamsters following a non-icterohaemorrhagic form of disease resulting from infection by leptospira interrogans serotype icterohaemorrhagiae. | | 1981 | 7343572 |
| leptospirosis in lambs. | two major episodes of acute hemolytic disease in lambs were associated with high mortality. clinical signs were severe depression, dyspnea, and tachycardia. gross postmortem findings included hemoglobinuria and icterus. histologic examination revealed tubular necrosis and periacinar hepatocellular necrosis. leptospira interrogans serotype pomona was proposed as the causative agent because high serum antibody titers for this bacterium were found in lambs and ewes in the affected flocks. | 1980 | 7353986 |
| isolation of antigenic variants of leptospiras from puppies and pigs experimentally infected with leptospira interrogans serovars canicola and pomona. | | 1980 | 7382236 |
| characterization of leptospiral catalase and peroxidase. | peroxidase from leptospira biflexa strain b-16 ad catalase from leptospira interrogans canicola hond utrecht were characterized and compared and both appeared to be heme enzymes as judged by their inhibition profiles and rapid inactivation during catalysis. neither enzyme exhibited monovalent or divalent cation requirements. dialysis of cell-free extracts resulted in loss of peroxidase activity but catalase was unaffected by this procedure. peroxidase had a km for h2o2 of 12.5 microm while catal ... | 1980 | 7407701 |
| haemolysis as a means of distinguishing between leptospira interrogans serovars balcanica and hardjo. | leptospira interrogans serovar balcanica was haemolytic for washed human, cattle, sheep and possum red blood cells (rbc); serovar hardjo was non-haemolytic. a test for haemolysis may prove useful in the preliminary differentiation of balcanica and hardjo isolates. balcanica was non-haemolytic for unwashed rbc from human and bovine donors whose serum contained hebdomadis serogroup antibody. haemolytic activity tended to disappear with repeated subculture of balcanica. | 1980 | 7411589 |
| isolation of leptospira biflexa from commercially prepared deionized water labeled "sterile for tissue culture". | leptospira biflexa were isolated from urine cultures of two patients with clinical and laboratory findings compatible with leptospirosis. neither patient had detectable leptospiral agglutinins. the source of the l. biflexa was water labeled " "sterile for tissue culture" purchased from m. a. bioproducts, formerly microbological associates. m. a. bioproducts water is sterilized by filtration through a 0.22-mum-pore size membrane filter. leptospiral contamination can occur in products sterilized b ... | 1980 | 7419696 |
| isolation of revertants from antigenic variants of leptospiras. | the revertants were isolated from the antigenic variants of leptospira interrogans serovar copenhageni shibaura by plating the variants on the solid medium containing the homologous immune serum, and by noting the growth of small colonies. the revertants which produced the small colonies were antigenically identical with the parents. the variants which retained their antigenicity for 2 to 3 years produced only a small number of revertants. on the other hand, the variants which phenotypically cha ... | 1980 | 7424250 |
| pathogenesis of experimental leptospira interrogans serotype icterohaemorrhagiae infection in the guinea pigs: possible role of endotoxin of intestinal bacteria in the development of lesions. | germ-free guinea pigs were infected with a virulent strain of leptospira interrogans serotype icterohaemorrhagiae to evaluate the possible role of endotoxin of intestinal bacteria in the development of hemorrhages and hepatic and renal failure. clinical manifestations, necropsy findings and histological lesions were similar to those seen in control animals. in the second part of the experiment, endotoxin was not detected by the limulus test in the blood of ten guinea pigs during the five day cou ... | 1980 | 7427777 |
| the prevalence of antibodies to members of leptospira interrogans in cattle. | a total of 1,355 random samples taken from bovine serums submitted for brucellosis testing in victoria were submitted to the microscopic agglutination test for the presence of antibody to 12 serovars of leptospira interrogans. the most common reaction obtained was to serovar hardjo, although the percentage of reactors varied from 24.8% in the metropolitan area to 56.3% in north-eastern victoria (mean 40.6%). a total of 86.3% of farms from which 3 or more samples were taken had at least one react ... | 1980 | 7436939 |
| isolation of leptospira interrogans serovar hardjo from sheep. | | 1980 | 7436944 |
| serological survey of leptospiral antibodies in swine in quebec. | the prevalence of reactors to different serovars of leptospira interrogans was determined in 117 swine premises in quebec. a total of 926 sera were tested, using the microscopic agglutination method, against six leptospiral serovars: pomona, icterohaemorrhagiae, grippotyphosa, hardjo, canicola and ballum. of the sera tested, 30 (3.2%) reacted to one of the three following serovars: pomona (2%), icterohaemorrhagiae (1.1%) and ballum (0.1%). | 1980 | 7438003 |
| surface colonies of leptospira interrogans. | observations of colonial growth of leptospira interrogans serovar pomona, bj, on soft-agar (1% agar) plates revealed the presence of both surface and subsurface colonies. the organisms from both types of colonies appeared to be similar in motility, morphology, antigenic composition, and pathogenicity. passage in vivo tended to produce a higher incidence of surface colonies, whereas passage in vitro tended to produce a higher incidence of subsurface colonies, suggesting the importance of environm ... | 1981 | 7462407 |
| the hemorrhagic syndrome of leptospirosis: an experimental study in guinea pigs. | the hemorrhagic syndrome of leptospirosis was studied in guinea pigs. the study correlates hematological, histopathological and immunohistochemical alterations in sixty animals inoculated by the intraperitoneal route with 1ml of the culture of virulent strain of leptospira interrogans serovar copenhageni. leptospirae antigens were detected by immunoperoxidase, chiefly in liver, kidney and heart muscle capillaries. possible pathogenic mechanisms responsible for hemorrhagic syndrome are discussed ... | 1995 | 7480909 |
| is1500, an is3-like element from leptospira interrogans. | copies of an insertion-sequence (is)-like element were isolated from two closely related serovars of leptospira interrogans sensu stricto. nucleotide sequence analysis of the 1236 bp element showed a characteristic is structure with terminal imperfect inverted repeats (irs) flanking a 1159 bp central region. this element was designated is1500. four open reading frames (orfa-orfd) were found in the central 'unique' region of is1500. similarities were detected between orfa and orfb and the putativ ... | 1995 | 7496528 |
| [return to estrus following first insemination in sow herds (incidence and association with reproductivity and various blood parameters)]. | as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics to get an impression of the economic importance. these objectives wer ... | 1993 | 7505958 |
| immunochemical studies of opsonic epitopes of the lipopolysaccharide of leptospira interrogans serovar hardjo. | leptospiral lipopolysaccharides (lps) are the main antigens responsible for immunity in leptospirosis. in this investigation we studied the nature of the antigenic determinants of lps extracted from leptospira interrogans serovar hardjo (reference strain hardjoprajitno). the reactions of anti-lps monoclonal antibodies (mabs) mum/f1-4/hardjo (igm) and mum/f1-6/hardjo (igg) with whole cell lysates in western immunoblotting analysis were unaffected by proteinase k treatment. periodate treatment of ... | 1994 | 7513591 |
| effective treatment with dihydrostreptomycin of naturally infected cows shedding leptospira interrogans serovar hardjo subtype hardjobovis. | the efficacy of dihydrostreptomycin in stopping the shedding of leptospira hardjo subtype hardjobovis was studied in naturally infected cows. blood and urine samples were collected from dairy cows kept on a farm where the farmer had contracted l hardjobovis infection. a microscopic agglutination test and an elisa were used to determine specific antibody responses in serum. polymerase chain reaction was used to detect bacterial shedding in urine. on the first sample collection date, 6 cows were s ... | 1994 | 7514850 |
| a neutral sugar is responsible for serovar specificity of the antigenic determinant of leptospira interrogans serovar canicola. | to provide information on the chemical structures of antigenic determinants of leptospira, glycolipids of leptospira interrogans serovar canicola strain hond utrecht iv (ut-iv) and its antigenic variant selected in the presence of a serovar-specific monoclonal antibody were compared physicochemically. gas-liquid chromatography-mass spectrometry analysis revealed that the glycolipid of ut-iv contained 6 neutral sugar species; rhamnose, mannose, galactose, glucose, and unknown sugars iii and iv, i ... | 1994 | 7528287 |
| [16s rrna reverse transcription-polymerase chain reaction of leptospires]. | we amplified the leptospiral rnas of leptospira interrogans serovar lai strain lai and l. biflexa serovar patoc strain patoc i, extracted by the method of sio2-high concentration salt solution (8 mol/l guhcl) absorption, with the 16s rrna gene primers of leptospira interrogans by reverse transcription-polymerase chain reaction (rt-pcr). it demonstrated that the detecting sensitivity by naked eye after electrophoresis could be 100 times higher when we amplified dna and rna of leptospires at the s ... | 1994 | 7528714 |
| [transcript expression of the cpl 5x, bmd-3a, bmd-10 interrogans leptospira]. | total rna of leptospira interrogans sv lai strain 017 was prepared by the method of licl-urea, and was used in dot hybridization with biotin-labelled dna probes. the probes included bmd-3a, bmd-10, which were the leptospirial protective antigen genes, and cpl 5x, which was the genus specific gene of interrogans leptospira. all of the three probes have shown various degrees of hybridization signs, proving that they all have transcript expression in leptospira. the transcript expression is the mai ... | 1994 | 7538094 |
| leptospira icterohemorrhagiae and leptospire peptidolgycans induce endothelial cell adhesiveness for polymorphonuclear leukocytes. | we have examined the effect of the virulent leptospira interrogans strain teramo, serotype icterohemorrhagiae, on the adherence of human neutrophilic polymorphonuclear leukocytes (pmn) to cultured human umbilical vein endothelial cells (hec). selective pretreatment of hec with intact or sonicated leptospires caused a dose- and time-dependent increase of hec-pmn adhesion (13.2% +/- 2.5% adherence to untreated hec versus 46.3% +/- 5.6% adherence to hec pretreated for 4 h with 10(8) intact leptospi ... | 1995 | 7542637 |
| leptospira interrogans serovar sejroe infection in a group of laboratory dogs. | interstitial nephritis was seen histologically in 19 (59%) out of 32 pure-breed beagle dogs (16 males and 16 females) subjected to standard safety tests. in these animals no clinical abnormalities were observed and all the tested parameters (haematology, biochemistry and urine analysis) were within the normal ranges. leptospiral antibody titres ranging from 1 : 100 to 1 : 6400, against a serovar (hardjo) belonging to the sejroe serogroup, were detected by the microscopic agglutination test (mat) ... | 1995 | 7564215 |
| seroepidemiologic study of three zoonoses (leptospirosis, q fever, and tularemia) among trappers in québec, canada. | this study was undertaken to evaluate the prevalence of antibodies against francisella tularensis, coxiella burnetii, and certain serovars of leptospira interrogans among trappers in québec, canada. muskrat trapping was identified as a risk factor for f. tularensis infection, whereas having a cat at home apparently protected trappers against infection by l. interrogans. high percentages of control sera were positive for antibodies against c. burnetii (15%) and l. interrogans (5%), most frequentl ... | 1995 | 7583933 |
| association of leptospiral seroreactivity and breed with uveitis and blindness in horses: 372 cases (1986-1993). | recurrent uveitis, a leading cause of blindness in horses, often develops as a sequela to systemic leptospirosis. over a 7-year period, 63 of 112 (56%) horses with uveitis were seropositive for leptospira interrogans serovar pomona, but only 23 of 260 (9%) horses without uveitis were seropositive. odds-ratio analysis revealed that seropositive horses were 13.2 times more likely to have uveitis than were seronegative horses. of the 63 seropositive horses with uveitis, 59% developed blindness, com ... | 1995 | 7591929 |
| need for vaccination of sewer workers against leptospirosis and hepatitis a. | this study compared the prevalence of leptospira interrogans and hepatitis a virus (hav) antibodies in serum samples from sewer workers and controls. | 1995 | 7663634 |
| [a clinico-epidemiological study of leptospirosis in adults in the province of ciego de avila]. | a clinical epidemiological study of reported leptospirosis cases in adults in the period 1984-1988 in the province ciego de avila, republic of cuba, was conducted. the most frequent symptoms and signs were: fever, headache and arthralgia. eighty-two percent of patient were anicteric. the most frequent presumptive diagnosis included leptospirosis, virosis, and febrile syndrome. sporadic cases predominated over cluster cases. the incidence of cases was higher from october to december. sixty-five p ... | 1995 | 7667520 |
| inhibition of na,k-atpase by an endotoxin extracted from leptospira interrogans: a possible mechanism for the physiopathology of leptospirosis. | clinical manifestations of leptospirosis include disorders of the electrolytical balance which might be related to inhibition of na,k-atpase. although the physiopathological cellular mechanism of leptospirosis remains unknown, a bacterial endotoxin has been incriminated. therefore, we evaluated whether a glycolipoprotein fraction extracted from leptospira interrogans and known to be cytotoxic might inhibit na,k-atpase. this glycolipoprotein fraction (glp) inhibited na,k-atpase activity in rabbit ... | 1995 | 7671008 |
| comparison of genetic maps for two leptospira interrogans serovars provides evidence for two chromosomes and intraspecies heterogeneity. | genetic maps were constructed for leptospira interrogans serovars icterohaemorrhagiae and pomona. previously we independently constructed physical maps of the genomes for these two serovars. the genomes of both serovars consist of a large replicon (4.4 to 4.6 mb) and a small replicon (350 kb). genes were localized on the physical maps by using southern blot analysis with specific probes. among the probes used were genes encoding a variety of essential enzymes and genes usually found near bacteri ... | 1993 | 7690025 |
| characterization of leptospiraceae by 16s dna restriction fragment length polymorphisms. | chromosomal dna from 37 leptospiracae representing genetic species, groups and reference strains together with five leptospire isolates and escherichia coli were digested with the restriction endonucleases bamhi, clai and ecori. the southern blots were hybridized with a biotinylated e. coli 1.5 kb 16s rdna probe and gave 36 reproducible and unique patterns. with the exception of the type strain (leptospira interrogans serovar icterohaemorrhagiae rga) and neotype strain (serovar icterohaemorrhagi ... | 1993 | 7691982 |
| prevalence of antibodies to different leptospira interrogans serovars in pigs on large farms. | a seroepidemiological survey was carried out in the province of badajoz (south-western spain) in order to determine the presence and spread of leptospira interrogans. the 521 sera tested were drawn from breeding sows on 28 large farms (15 with fewer than 60 and 13 with over 60 breeders). immunological testing was performed using the martin-pettit micro-agglutination technique. pigs with titres equal to or greater than 1:100 were considered positive. haemolysed and/or contaminated test sera were ... | 1994 | 7701864 |
| [scientific raisins from 125 years smw (swiss medical weekly). a brief report on the discovery of the pathogen (spirochaeta icterohaemorrhagiae nov. sp.) of so-called weil's disease in japan and on current studies of the disease. 1916]. | | 1995 | 7732354 |
| recognition of leptospira interrogans antigens by vaccinated or infected dogs. | antigenic recognition of leptospiral antigens by vaccinated or infected dogs was studied by microagglutination test (mat) and by western blots. in western blots, serovar specific antigens detected by mat migrated in the 18-31 kda zone. the 25-31 zone seemed to be linked to antigens indicating virulence of the strain. these antigens are lps. the first antibodies made after infection are produced against lps migrating in the 14 kda zone. many protein antigens are common in leptospires belonging to ... | 1994 | 7801528 |
| protective effects of serum thymic factor to leptospira interrogans serovar copenhageni infection in mongolian gerbils. | the susceptibility to leptospira interrogans serovar copenhageni in mongolian gerbils treated with 10 micrograms of serum thymic factor (fts) 1 day before infection was examined. susceptibility of gerbils treated 5 times with 10 micrograms of fts was also investigated. mortality of fts-treated gerbils was significantly lower than that of controls when small challenge doses were used. to analyse the fts-induced resistance to leptospiral infection, natural killer (nk) cell activity and macrophage ... | 1994 | 7801529 |
| evaluation of an enzyme-linked immunosorbent assay that uses the 41-kd flagellin as the antigen for detection of antibodies to borrelia burgdorferi in cattle. | an elisa was developed to detect antibodies to the 41-kd flagellin (p41) of borrelia burgdorferi in serum obtained from cattle. absorption studies, immunoblot analysis, immunoelectron microscopy, and correlation of results of the p41-elisa and the p39-elisa as well as measurement of the antibody to p41 in calves challenge-exposed with borrelia theileri were used to assess the specificity of the p41-elisa. antigens derived from escherichia coli, leptospira interrogans serovar hardjo, and b burgdo ... | 1994 | 7802386 |
| sheep as maintenance host for leptospira interrogans serovar hardjo subtype hardjobovis. | transmission of leptospira interrogans serovar hardjo subtype hardjobovis from naturally infected sheep to uninfected sheep and calves was studied. a microscopic agglutination test and elisa were used to determine specific antibody responses in serum. polymerase chain reaction was used to detect bacterial shedding in urine. six sheep were derived from a dairy farm where cows were infected with l hardjobovis. three of these sheep were seropositive for l hardjobovis, and 1 also shed leptospires in ... | 1994 | 7802389 |
| a review of laboratory techniques and their use in the diagnosis of leptospira interrogans serovar hardjo infection in cattle. | this paper reviews the laboratory diagnosis of leptospira hardjo infection in cattle. two genotypes of l hardjo, hardjoprajitno and hardjobovis, have been identified in cattle, but only hardjobovis has been isolated in australia. there are problems with diagnosis and control of bovine leptospirosis. infection is usually subclinical and the serological titres vary greatly in peak and duration. leptospires may be excreted in urine for up to 18 months. low microscopic agglutination test titres may ... | 1994 | 7818437 |
| rapid and specific detection of pathogenic leptospira species by amplification of ribosomal sequences. | we have developed an assay for the detection of pathogenic leptospira that is based on the polymerase chain reaction. with the combination of agarose gel electrophoresis and blotting, pathogenic leptospira can be discriminated specifically from nonpathogenic leptospira and other bacterial species. this method, based on the amplification of 16s ribosomal rna sequences, is able to detect 10 leptospiral cells/ml in cattle urine samples and 100 leptospiral cells/ml in pig urine samples. using this a ... | 1994 | 7866864 |
| lyme disease spirochetes in a wild fox (vulpes vulpes schrencki) and in ticks. | lyme disease spirochetes were demonstrated in a wild female fox (vulpes vulpes schrencki) and in ixodes persulcatus ticks collected from the fox on sapporo, hokkaido, japan. spirochetes were detected in i. persulcatus, as well as skin lesions, brain, heart, kidney, and liver of the fox. five of seven isolates reacted with a monoclonal antibody against borrelia afzelii specific osp b. deoxyribonucleic acid (dna) relatedness of a brain isolate was 89% to b. afzelii, and ranged from 50 to 67% to th ... | 1994 | 7933292 |
| seroprevalence to leptospira interrogans serovar hardjo in merino stud rams in south australia. | a serological survey of 2160 merino stud rams on 36 farms detected positive reactions greater than or equal to 1/100 in 42% of animals using the microscopic agglutination test (mat) to leptospira interrogans serovar hardjo. twenty flocks had seroprevalence values greater than 30% with 15 flocks having values > or = 60%. the enzyme-linked immunosorbent assays showed that 47% and 3% of rams on the 36 farms were positive for igg and igm antibodies, respectively. forty-five percent of hardjo reactio ... | 1994 | 7945098 |
| survey of antibodies against various infectious disease agents in racing camels in abu dhabi, united arab emirates. | prevalence of antibodies against some important disease agents in sera from racing camels in abu dhabi (united arab emirates) is reported. antibodies against brucella abortus were detected in 1.5% of racing camels, but only 0.76% had titres sufficient for the animals to be considered infected. the complement fixation test revealed antibodies against coxiella burnetii (causative agent of q fever) in 7.9% of camels (with a geometrical mean titre of 13) and against parainfluenza virus type 3 in 5.6 ... | 1994 | 7949353 |
| characterization of an antigenic oligosaccharide from leptospira interrogans serovar pomona and its role in immunity. | an antigenic oligosaccharide fraction derived from the lipopolysaccharide of leptospira interrogans serovar pomona was isolated by endo-glycosidase h digestion and column chromatography. the oligosaccharide contained rhamnose, ribose, glucose, and glucosamine and inhibited the binding of opsonic, protective monoclonal antibodies directed against the lipopolysaccharide. when conjugated to diphtheria toxoid, the oligosaccharide elicited the production of agglutinating, opsonic antibodies. | 1994 | 7960129 |
| return to oestrus after first insemination in sow herds (incidence, seasonality, and association with reproductivity and some blood parameters). | as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics in order to get an impression of the economic importance of reproduct ... | 1994 | 7985351 |
| decreased erythrocyte osmotic fragility during canine leptospirosis. | erythrocyte osmotic fragility (eof) was carried out in nineteen dogs naturally infected by leptospira interrogans serovar icterohaemorrhagiae/copenhagi. a decreased eof was observed, suggesting a modification of erythrocyte components secondary to disturbances that occur during canine leptospirosis, such as renal damage and hepatic disease. | 1994 | 7997768 |
| seroprevalence of leptospirosis in a rural flood prone district of bangladesh. | leptospirosis is a worldwide zoonotic disease. in the present investigation, a total of 89 human sera from a flood prone district of bangladesh was screened by a one-point microscapsule agglutination test (mcat). mcat-positive and -doubtful sera were further tested by microscopic agglutination test (mat) against 16 reference serovars of leptospira interrogans, and the antibody titres determined. in mcat, 34 sera were positive and 22 were doubtful. among those positive and doubtful sera, 33 and 2 ... | 1994 | 8005218 |
| leptospirosis patient with aids: the first case reported. | a case of renal icterohemorrhagic leptospirosis involving a patient with acquired immunodeficiency syndrome (aids) is reported. despite the low levels of cd4+ t lymphocytes, the clinical course of leptospirosis was similar to that observed in non-immunodepressed patients, and no worsening of aids occurred due to the infection by the spirochete. serologic conversion was observed in the microscopic agglutination test, with maximum titer of 1:3,200. the patient had positive urine cultures for lepto ... | 1994 | 8008919 |
| comparative pathogenicity study of leptospira interrogans serovar pomona strains. | the comparative pathogenicity study of two leptospira interrogans serovar pomona strains isolated from pig herds of different epizootiological status is reported. using monoclonal antibodies (mabs), the isolates were identified as leptospira interrogans serovar pomona. the results obtained for the reference strain of l. pomona were identical with those of the two isolates, with the exception of monoclonal serum designated 61-7, which gave a 1:30 titre with the reference strain. in a pig herd com ... | 1993 | 8017234 |
| detection of leptospiral dna by pcr. | an ecori fragment (1.2 kb) which is highly conserved among leptospira interrogans isolated in korea was cloned into pbluescript vector from l. interrogans serovar lai wh20. the ecori fragment was sequenced, and a pair of primers (lp1 and lp2) was designed for pcr assay. pcr amplification of target dna obtained from cultured l. interrogans showed that 274 bp could be detected when as little as 100 fg of leptospiral genomic dna was used in the reaction mixture. no amplification of dna was detected ... | 1994 | 8027306 |
| detection and identification of leptospira interrogans serovars by pcr coupled with restriction endonuclease analysis of amplified dna. | primers for pcr were selected from a sequenced fragment of clone pl590, which contains a repetitive element present in the genome of leptospira interrogans serovar hardjo type hardjoprajitno (m. l. pacciarini, m. l. savio, s. tagliabue, and c. rossi, j. clin. microbiol. 30:1243-1249, 1992). a specific dna fragment was amplified from the genomic dnas of serovar hardjo type hardjoprajitno and nine serovars also belonging to l. interrogans as a consequence of the spread of the same or a closely rel ... | 1994 | 8027346 |
| the effect of vaccination against leptospira interrogans serovar hardjo infection at the time of service on pregnancy rates in dairy cows. | fertility data from 16 dairy herds vaccinated against hardjo infection were used to assess pregnancy rates in cattle vaccinated around the day of mating. there was no improvement in pregnancy rates 30-60 d after vaccination. pregnancy rates in the period 5 d before and 10 d after vaccination were statistically lower than those found in 30-60 d around vaccination. | 1994 | 8038799 |
| leptospirosis complicated by a jarisch-herxheimer reaction and adult respiratory distress syndrome: case report. | leptospirosis, severe infection due to leptospira interrogans, is a potentially lethal disease that causes multiple organ failure. in addition to hepatic, renal, and cns involvement, which are classic complications of leptospirosis, the disease may also be complicated by adult respiratory distress syndrome. treatment with penicillin may precipitate a severe jarisch-herxheimer reaction. the mechanisms of leptospira-induced toxicity remain obscure. we report a near-fatal case of leptospirosis in a ... | 1994 | 8086528 |
| leptospira species categorized by arbitrarily primed polymerase chain reaction (pcr) and by mapped restriction polymorphisms in pcr-amplified rrna genes. | reference strains from 48 selected serovars representing eight species of leptospira were examined by two polymerase chain reaction (pcr)-based strategies. first, mapped restriction site polymorphisms (mrsp) were examined in pcr products from portions of rrs (16s rrna gene) and rrl (23s rrna gene). twenty mrsp and 2 length polymorphisms were used to group reference strains into 16 mrsp profiles. species assignments were consistent with those obtained by a second method, genomic fingerprinting wi ... | 1993 | 8094390 |
| molecular analysis of the hsp (groe) operon of leptospira interrogans serovar copenhageni. | a chromosomal gene library of leptospira interrogans serovar copenhageni strain wijnberg was constructed in phage lambda gt11. plaque immunoassay with r alpha p64 antiserum identified one clone expressing a putative groel homologue. dna sequence analysis of the 2.4 kb ecori-bam hi cloned fragment from strain wijnberg revealed two open reading frames encoding polypeptides of 10.5 kda (hsp10) and 58 kda (hsp58). sequence comparison of the deduced amino acid sequences of these orfs confirmed the op ... | 1993 | 8101351 |
| the search for improved methods for diagnosing leptospirosis: the approach of a laboratory in brescia, italy. | the authors describe work in progress at the laboratory in brescia, italy, on the application of molecular methods to the diagnosis of leptospirosis. this work includes the following: a) development of polymerase chain reaction (pcr) assays capable of amplifying specific deoxyribonucleic acid fragments from most leptospira interrogans strains. b) development of a microtitre-based assay for rapid detection of pcr-positive samples. c) characterisation of leptospira strains through restriction endo ... | 1993 | 8104548 |
| biological activity of a peptidoglycan extracted from leptospira interrogans: in vitro studies. | peptidoglycan (pg) has been isolated from some species of spirochaetes, including leptospira interrogans. although leptospiral pg has been chemically characterized, no study has been carried out on its potential biological activity. since pg of treponema and borrelia is biologically active both in vivo and in vitro, we investigated the capacity of a leptospiral pg preparation to induce relevant biological effects. pg extracted from l. interrogans strain teramo was mitogenic at 0.1 microgram ml-1 ... | 1993 | 8126423 |
| effect of streptomycin treatment on the shedding of and the serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis in experimentally infected cows. | shedding patterns of and serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis (l. hardjobovis) have been studied in experimentally infected cows treated with streptomycin in comparison to experimentally infected cows receiving no such treatment. fourteen cows were experimentally infected with l. hardjobovis, and blood and urine samples were collected weekly for 24 weeks. the microscopic agglutination test (mat) and enzyme-linked immunosorbent assay (elisa) were used t ... | 1993 | 8128596 |
| [development of a test system for detecting leptospira interrogans using the polymerase chain reaction]. | based on polymerase chain reaction a test-system has been elaborated permitting one to identify the leptospirae of the most common serogroups (icterohaemorrhagiae, canicola, javanica, ballum, pyrogenes, pomona, habdomadis, sejroe, tarassovi) of the species leptospira interrogans. sensitivity of the technique is 1-10 cells in a sample. the specificity of the system has been shown to depend on the temperature of the primers annealing. the elaborated system exceeds all other systems for leptospiral ... | 1994 | 8133844 |
| [a polymerase chain reaction method for studying host persistence of pathogenic leptospira]. | polymerase chain reaction has for the first time been shown to be applicable to indication of leptospira interrogans in the organs of infected animals with acute or chronic leptospirosis (on the model of golden syrian hamsters). polymerase chain reaction is superior to microscopic and bacteriological analyses in identification of leptospirae in organ suspensions. the sensitivity of the technique is 1-10 cells per sample in studies of kidney or brain suspensions or 100-1000 cells in studies of li ... | 1994 | 8133845 |
| [pcr amplification of the leptospiral dnas from different genus and species with the variable sequences of 16s rrna gene]. | we designed a pair of primers from the variable regions (v2 and v4) of 16s rrna gene of leptospira interrogans, i. e. pi: 5'ggg aac cta ata ctg gat gg; pii: 5' aca tag ttt caa gtg gag gc, and amplified the leptospiral dnas from different genus and species. when denaturing with 55 degrees c, all dnas of l. interrogans had the same products not only in length but also with kpn i-digested pattern. the dna of l. biflexa could be amplified with a c. a. 280 bp-band but not digested by kpn i, while the ... | 1993 | 8150433 |
| [restriction endonuclease analysis of pomona serogroup of leptospira interrogans]. | restriction endonuclease analysis (rea) was performed on dnas from the type strains of the pomona serogroup of leptospira interrogans by using ecori and hhai restriction enzyme, and the electrophoretic patterns obtained were compared with patterns obtained from 27 isolates from pig kidneys collected at abattoirs in victoria, which belong to pomona serogroup previous identified by mat. all of the isolates were identified as serovar pomona. | 1993 | 8178514 |
| leptospirosis in equine fetuses, stillborn foals, and placentas. | leptospirosis was diagnosed in 51 equine fetuses and 16 stillborn foals with gestational ages from 3 1/2 to 11 months. diagnosis was based on one or more of the following: positive fetal antibody titer, positive fluorescent antibody test, demonstration of spirochetes in kidney and/or placental sections stained by the warthin-starry technique, high leptospiral titers in aborting mares, or isolation of leptospira spp. from fetal organs. gross lesions were observed in 80.3% of the fetuses, stillbor ... | 1993 | 8212458 |
| [the use of nonpathogenic leptospira as diagnostic antigens for the diagnosis of leptospira infections in cattle]. | the seroprevalence of leptospira antibodies was determined in 4377 bovine sera by microagglutination assay using 11 leptospira interrogans serovars. in 10% (439 samples) of the sera, a positive reaction was detected. these included 275 sera (62.6%) with reaction to l. grippotyphosa, 159 (36.2%) to l. saxkoebing and 5 (1.1%) sera with reactions to other serovars. multiple reactions were found in 9.8% of the 439 positive sera, whereby the sejroe group dominated (65%) within the possible combinatio ... | 1993 | 8216195 |
| association between cessation of leptospiruria in cattle and urinary antibody levels. | the shedding of leptospira interrogans serovar hardjo in the urine of cattle and the local and systemic response to these organisms was monitored in experimentally and naturally infected animals. twenty yearling heifers, 10 infected by the instillation of leptospires into the conjunctival sac (supraconjunctival route) and 10 infected intrauterinely, shed leptospires for up to 60 weeks after infection. five of 15 naturally infected pregnant heifers with microscopic agglutination test titres > or ... | 1993 | 8235087 |
| cross-reactivity between b. burgdorferi and other spirochetes affects specificity of serotests for detection of antibodies to the lyme disease agent in dogs. | western immunoblots, the kinetics-based enzyme-linked immunosorbent assay (kela), and the microagglutination test were used to evaluate cross-reactivity among antibodies to serovars of leptospira interrogans (leptospiral serovars), and b. burgdorferi from naturally infected dogs, and to serpulina (treponema) hyodysenteriae from vaccinated rabbits. whole-cell lysates from borrelia spp., leptospiral serovars, and serpulina spp. were used for sds-page, western blots, and kela. crossreactivity occur ... | 1993 | 8236777 |
| [antigen analysis of mcab e4b7d5 directed against outer envelope of leptospira interrogans serovar lai by sds-page and immunoblot]. | mcab e4b7d5 was prepared by hybridoma technology in balb/c mice immunized to outer envelope of leptospira interrogans serovar lai. this mcab agglutinated specifically with all the 13 serovars of icterohaemorrhagiae serogroup in mat test at high titres and protected the guinea pigs against the attack of virulent strain (017) of serovar lai. sds-page and immunoblot were used to analyse the reaction of the outer envelopes of the five strains of leptospira (leptospira interrogans icterohaemorrhagiae ... | 1993 | 8244286 |
| isolation of leptospira interrogans serovars hardjo and zanoni from a dairy herd in north queensland. | | 1993 | 8257323 |
| serologic survey for leptospirae in european brown bears (ursus arctos) in croatia. | from 1981 to 1991, sera of 42 european brown bears (ursus arctos) from three areas in croatia were tested for antibodies against 12 leptospira interrogans serovars: grippotyphosa, sejroe, australis, pomona, canicola, icterohaemorrhagiae, tarassovi, saxkoebing, ballum, bataviae, poi, and hardjo. diagnostic levels of antibody were found in 17 (40%) of 42 sera. evidence of exposure to at least one of the serovars was found in seven of 14 free-ranging bears from the lika region, four of 12 free-rang ... | 1993 | 8258865 |
| identification of leptospira interrogans strains by monoclonal antibodies and genomic analysis. | a recombinant probe derived from a genomic library of serovar hardjo strain hardjoprajitno, and a panel of serovar specific monoclonal antibodies (mabs) were used for the characterization of 31 leptospira isolates from cattle and swine. the two methods performed equally well in serovar identification except for the distinction of the genotypes hardjoprajitno and hardjobovis within serovar hardjo which could only be obtained by genomic analysis. the combination of immunological and genetic inform ... | 1993 | 8264422 |
| [amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr]. | based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ... | 1993 | 8288193 |
| isolation of leptospira interrogans serovar grippotyphosa from the skin of a dog. | leptospira interrogans serovar grippotyphosa was isolated from the skin of a 14-year-old male dog with deteriorating health. necropsy revealed numerous lesions characteristic of aged dogs, but no evidence of acute hepatitis or nephritis, which are common features of pathogenic leptospira infections. antibody to leptospira was not detected in the dog's serum by microagglutination. leptospires grew slowly in barbour-stoenner-kelly medium, a medium commonly used to isolate borrelia, but then grew a ... | 1993 | 8288477 |
| cloning and analysis of the leub gene of leptospira interrogans serovar pomona. | the leub gene of leptospira interrogans serovar pomona strain kenniwicki has been cloned on a 9.5 kb plasmid, pwvl1, by complementation of escherichia coli leub mutants. subcloning and tn5 mutagenesis showed that the region required for complementation was approximately 1.2 kb in length. enzyme assays showed that the product of the cloned gene was a beta-isopropylmalate dehydrogenase. defects in the leua, leuc and leud genes of e. coli were not complemented by pwvl1. the nucleotide sequence of t ... | 1993 | 8336106 |
| antimicrobial effects of a new carboxyquinolone drug, q-35, on five serogroups of leptospira interrogans. | new carboxyquinolone drugs, including the recently developed q-35, were evaluated for their in vitro potency against five serogroups of leptospira interrogans. q-35, ofloxacin, ciprofloxacin, and tosufloxacin showed mics (0.05 to 0.20 microgram/ml) comparable to those of tetracycline. however, mbcs of these drugs varied between 10- and 100-fold above the mic for most strains tested. q-35 was shown to be active against l. interrogans in vitro as judged by the mics obtained. | 1993 | 8388204 |
| [a severe course of leptospirosis with acute kidney failure and extensive icterus (weil disease)]. | a 77-year-old man developed a fever up to 38.4 degrees c, with diarrhoea, acute renal failure (creatinine up to 8.7 mg/dl; urea up to 308 mg/dl) and marked jaundice (total bilirubin up to 24.3 mg/dl). in addition there was thrombocytopenia, conjunctivitis and epistaxis, as well as cerebral symptoms with somnolence and general slowing up. at first he was thought to have cholangitis resulting from previously diagnosed gall-stones, and he was therefore treated with ampicillin, 2 g two times daily, ... | 1993 | 8404498 |
| outbreak of leptospirosis associated with swimming. | between july 7 and 18, 1991, five boys from a small town in rural illinois experienced the onset of an acute febrile illness subsequently confirmed as leptospirosis by serologic tests. a cohort study found that swimming in a small swimming hole, steel tunnel pond, was associated with disease (p < 0.01), the attack rate being 28%. leptospira interrogans serovar grippotyphosa was isolated from urine cultures from two of the case patients and from a culture of steel tunnel pond water. a high seropr ... | 1993 | 8417426 |
| opsonization of treponema pallidum is mediated by immunoglobulin g antibodies induced only by pathogenic treponemes. | rabbit antisera to leptospira interrogans, borrelia hermsii, and treponema phagedenis biotype reiter, reactive to shared spirochetal antigens, failed to enhance phagocytosis of treponema pallidum by macrophages, while immunoglobulin g to treponema pallidum subsp. pertenue and treponema paraluiscuniculi promoted phagocytosis. opsonic antibodies are directed to pathogen-restricted, not shared spirochetal, antigens. | 1993 | 8423106 |
| identification of species-specific, non-cross-reactive proteins of borrelia burgdorferi. | the low specificity of diagnostic tests for lyme disease is due to the fact that borrelia burgdorferi possesses many antigenic proteins that are cross-reactive with other spirochetes and bacteria. the low sensitivity is a result of high (> or = 1:100) dilutions used for patient sera during testing to eliminate non-specific cross-reactivity. the present study was conducted to identify species-specific non-cross-reactive protein(s) of b. burgdorferi that might be used as antigen(s) in serologic te ... | 1993 | 8425377 |
| a new leptospiral serovar in the icterohaemorrhagiae serogroup isolated from an ox in zimbabwe. | a strain of leptospira interrogans that was isolated from an ox slaughtered in zimbabwe and belonged to serogroup icterohaemorrhagiae could not be identified when we compared it with 18 reference strains belonging to this serogroup by using cross-agglutinin absorption, monoclonal antibody, and restriction endonuclease dna analyses. the name zimbabwe is proposed for the new serovar containing this strain; the type strain of this serovar is strain sbf 23. | 1993 | 8427806 |
| prevalence of leptospiral agglutinins among conservancy workers in madras city, india. | in a study of 584 corporation conservancy (sanitation) workers who lived mostly in slums, and who worked in four corporation circles of madras city, india, 192 (32.9%) were found to be positive for agglutinins to leptospira interrogans. seropositivity prevalence increased with age, but was similar in males and females except in the youngest age group, where males predominated. prevalence in the four study areas ranged between 17.8 and 40.5% (p < 0.01). among 152 sera in which one serogroup predo ... | 1993 | 8429573 |
| decision support models of leptospirosis in dairy herds. | following the results of a survey which found that 61 per cent of dairy farmers felt that they needed more information about leptospirosis, and the strategies for its control and the costs and benefits involved, this paper describes the construction and preliminary results of two models of the disease intended to help explore the risks and financial implications of leptospira interrogans serovar hardjo infection for dairy producers. | 1993 | 8430482 |
| bacterial agents detected in a 10-year study of bovine abortions and stillbirths. | in a 10-year survey started in 1980, specimens from 8,995 bovine abortions and stillbirths were submitted to the south dakota animal disease research and diagnostic laboratory. of these, 8,962 were suitable for some type of examination. bacteria were determined to be the cause of 1,299 (14.49%). the 5 bacteria most commonly associated with bovine abortion or stillbirth were actinomyces pyogenes, 378 (4.22%); bacillus spp., 321 (3.58%); listeria spp., 121 (1.35%); escherichia coli, 98 (1.09%); an ... | 1993 | 8466983 |
| restriction-endonuclease analysis of australian isolates of leptospira interrogans serovar hardjo from cattle with agalactia and abortion. | polyacrylamide gel electrophoresis and agarose gel electrophoresis were used to resolve restriction endonuclease digests of 20 australian isolates of leptospira interrogans cultured from urine samples of cattle with agalactia and abortion. the restriction endonuclease profiles of 19 isolates closely matched the profiles of l interrogans serovar hardjo subtype hardjobovis reference strains. the remaining isolate had a different restriction profile from subtype hardjobovis and subtype hardjoprajit ... | 1993 | 8476365 |
| chemotaxis of leptospires to hemoglobin in relation to virulence. | a guinea pig-lethal line of leptospira interrogans serovar copenhageni strain shibaura, but not an avirulent line of the same strain, moved in larger numbers toward hemoglobin than toward distilled water (control) in a u-shaped polypropylene tube. l. interrogans serovar lai strains 017 and kh-1, which were also guinea pig lethal, showed a similar move to hemoglobin. no such move toward hemoglobin was shown by 14 avirulent strains of l. interrogans (with one exception) or any of the 8 strains of ... | 1993 | 8478123 |
| leptospiral abortion and leptospiruria in horses from the same farm. | leptospirosis was documented as the cause of abortion in a 5-year-old mare. leptospires were detected in tissue specimens from fetal kidneys and from placenta by histologic evaluation of silver-stained sections. antibodies against leptospira interrogans serovar pomona were detected in fetal serum at a titer of 1,600 by use of a microscopic agglutination test. the mare had serum titers of 6,400; 0; 400; 800; 3,200; and 6,400 to l interrogans serovars bratislava, canicola, grippotyphosa, hardjo, i ... | 1993 | 8496088 |
| serological survey for canine leptospirosis in the pretoria area. | canine serum samples (n = 400) from the pretoria area were tested for leptospira antibodies, using the microscopic agglutination test. the prevalence of antibodies (inconclusive and positive titres) was 1.5%. reactions were only against leptospira interrogans serovars tarassovi and pyrogens. leptospirosis does not appear to be an important canine disease in the pretoria area. | 1993 | 8496894 |
| association between clinical lameness and borrelia burgdorferi antibody in dairy cows. | results of an elisa, indirect fluorescent antibody (ifa) test, and immunoblot analysis (western blotting) for antibody to borrelia burgdorferi in a sample of 216 lactating dairy cows were compared. the microscopic microtitration agglutination test for antibody to 6 serovars of leptospira interrogans was also performed to evaluate possible cross-reactivity between b burgdorferi and l interrogans. using western blotting as the standard test against which the elisa and ifa test were compared, the e ... | 1993 | 8498742 |
| antimicrobial activity of two bactenecins against spirochetes. | bac5 and bac7 are antimicrobial peptides of bovine neutrophils that act on enteric gram-negative bacteria. we report here that these two peptides immobilize and kill leptospira interrogans and leptospira biflexa with mbcs of 6 to 25 micrograms/ml. conversely, although both peptides bind to borrelia burgdorferi, the organism is resistant to their action. | 1993 | 8514417 |
| use of nondenaturing silver-stained polyacrylamide gel analysis of polymerase chain reaction amplification products for the differential diagnosis of leptospira interrogans infection. | a 285-bp dna fragment was amplified using the polymerase chain reaction from 38 leptospira serovars of six different genomic species. the fragments amplified exhibited differential mobilities on nondenaturing polyacrylamide gels resulting from sequence-dependent conformational alterations. leptospira interrogans serovars could be distinguished from those of other species on this basis. | 1995 | 8582141 |
| [significance of human leptospirosis in mexico. detection of leptospira antibodies in a blood donor population]. | the presence of specific serum antibodies has been used as a diagnostic test for human leptospirosis. the presence of these antibodies in humans is indicative of an active natural infection. its detection after exposure denotes the presence of immunity. serum samples from 206 adult blood donors were analyzed with a microscopic agglutination assay against 7 serovars of leptospira interrogans. a total of 7% were positive with the following serovar distribution; shermani 53%, canicola 33%, pyrogens ... | 1995 | 8582567 |