| salmonellosis in red deer calves (cervus elaphus). | | 1978 | 355957 |
| [allergic reactivity and the hypothalamus]. | | 1978 | 355990 |
| cloning of chemically synthesized lactose operators. ii. ecori-linkered operators. | a 40 base, mainly duplex dna segment, with the following sequence paattccacatgtggaattgtgagcggataacaatttgtt (3') ggtgtacaccttaacactcgcctattgttaaacaccttaap (5') has been synthesized by combination of chemical and enzymatic methods. it consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the ecori restriction endonuclease. this segment has been ligated into the pmb9 plasmid and the resulting operator ... | 1978 | 357249 |
| high-resolution 13c nuclear magnetic resonance studies of glucose metabolism in escherichia coli. | high-resolution 13c nuclear magnetic resonance spectra of suspensions of escherichia coli cells have been obtained at 90.5 mhz by using the fourier transform mode. anaerobic cells incubated with [i-13c]glucose show a time course of glycolysis in which the alpha and beta glucose anomers disappear at different rates, lactate, succinate, acetate, alanine, and valine accumulate as end products of glycolysis, and fructose bisphosphate appears as an intermediate. it is shown that fructose bisphosphate ... | 1978 | 358201 |
| [a new influenza subunit vaccine: hemagglutinating antibodies one year after vaccination (author's transl)]. | the antibody response to a new influenza subunit vaccine was compare d one year after vaccination with the responses induced by two other influenza vaccines. the subunit vaccine was given either in a high dose form containing 2100 iu, or in a low dose form containing 700 iu. as comparison a split vaccine was used containing 800 iu and ai(oh)3 as adjuvant and a whole virus vaccine containing 2100 iu. of the 399 vaccinated subjects which had taken part in this study 151 were available for hemagglu ... | 1978 | 365774 |
| [phage typing of rough e. coli strains isolated from urine (author's transl)]. | a differentiation of e. coli rough strains is generally not well established in bacteriological urine diagnosis although these strains are relatively often isolated from urine samples of patients with urinary tract infections (see table 2). an exact characterization of rough strains seems to be necessary especially for the distinction between recurrent and reinfection during therapy and follow-up studies. the application of phage typing for characterization of e. coli rough strains isolated from ... | 1978 | 373321 |
| the preparation and characterization of a cell-free system from saccharomyces cerevisiae that translates natural messenger ribonucleic acid. | a cell-free protein-synthesizing system has been prepared from saccharomyces cerevisiae by differential centrifugation of lysed spheroplasts. the preparation, a modified 100,000 x g supernatant fraction, contains ribosomes and monosomes, ribosomal subunits, translation factors, and aminoacyl-trna synthetases, but no polysomes. after removal of small amounts of remaining mrna with micrococcal nuclease, protein synthesis is stringently dependent on the addition of mrna, as well as amino acids and ... | 1979 | 374404 |
| isolation of trypanosoma cruzi from the blood of infected mice by column chromatography. | trypomastogotes of three strains of trypanosoma cruzi were isolated from the blood of infected mice employing lymphoprep for separation of the red blood cells and a column of deae cellulose for removal of white cells and platelets. an average recovery of 45 to 58 percent of actively motile, infective organisms, free of contaminating blood cells was obtained. protein and carbohydrate assays of the separated organisms revealed significant differences between the tulahuen, a reticulotropic strain, ... | 1979 | 375218 |
| artificial reproduction of arthritis in calves by intubation of a virulent strain of mycoplasma mycoides subsp mycoides. | | 1979 | 377780 |
| unusual pattern of nucleoside polyphosphate hydrolysis by the acid phosphatase (optimum ph = 2.5) of escherichia coli. | | 1979 | 378222 |
| pharmacological investigation on asclepin--a new cardenolide from asclepias curassavica. part ii. comparative studies on the inotropic and toxic effects of asclepin, g-strophantin, digoxin and digitoxin). | the cardiac effects of asclepin, a new glycoside from the plant asclepias curassavica, were studies in vitro (isolated atrium and heart of guineapig) and in vivo (anaesthetized cat) and were compared with g-strophanthin, digoxin, digitoxin, or digitoxigenin, resp. asclepin showed a marked positive inotropic effect as evidenced by the increase in the force of contraction, measured by (dp/dt)max and (formula: see text). it was found to be more active than the other glycosides. | 1978 | 380581 |
| u.s. court stops hew's selection of intermediary. | | 1979 | 387571 |
| [nuclease-antibodies in infections with serratia marcescens (author's transl)]. | a total of 467 presumable healthy men of age eighteen yielded titres of anti-serratia-nuclease that ranged from 1:4 to 1:6. one third of 56 patients, who had been infected with serratia marcescens (urinary-, wound-, respiratory-infections, and bacteremia) yielded raised anti-nuclease titres, which amounted maximaly 1:16. the diagnostic utility of this serological test was discussed. | 1979 | 387574 |
| synthesis and properties of fluorescent nucleotide substrates for dna-dependent rna polymerases. | a new class of fluorescent nucleotide analogs which contain the fluorophore 1-aminonaphthalene-5-sulfonate attached via a gamma-phosphoamidate bond has been synthesized. both the purine and pyrimidine analogs have fluorescence emission maxima at 460 nm. cleavage of the alpha-beta-phosphoryl bond produces change in both the absorption and fluorescence emission spectra. the fluorescence of the pyrimidine analogs is quenched; cleavage of the alpha-beta-phosphoryl bond of the utp analog produces abo ... | 1979 | 387781 |
| the association of var1 with the 38 s mitochondrial ribosomal subunit in yeast. | | 1979 | 387793 |
| api and minitek systems in identification of clinical isolates of anaerobic gram-negative bacilli and clostridium species. | a comparison of the api and minitek methods of biochemical testing was made on a variety of anaerobic bacteria. although api and minitek results were not compared to more standardized or conventional procedures of identification, multiple repeat testing of the two systems was done on routine clinical isolates and known organisms to determine (i) whether the reactions were reliably consistent, (ii) the ease of reading the two systems with respect to the frequency of questionable results, and (iii ... | 1979 | 387809 |
| primary plate identification of group a beta-hemolytic streptococci utilizing a two-disk technique. | a two-disk system is described which allows primary plate identification of group a beta-hemolytic streptococci. group a beta-hemolytic streptococci could be visualized on primary throat culture plates by using trimethoprim-sulfamethoxazole to inhibit normal flora. in the heavily inoculated area of trypticase soy agar plates containing 5% sheep blood, a 25-microgram/ml trimethoprim-sulfamethoxazole disk was placed contiguous to a 0.04-u bacitracin disk. a total of 259 throat specimens were exami ... | 1979 | 387811 |
| metabolism of arachidonic acid in ionophore-stimulated neutrophils. esterification of a hydroxylated metabolite into phospholipids. | [14c]arachidonic acid incubated with human neutrophils was esterified into phospholipids and triglycerides. stimulation of these labeled neutrophils with ionophore a23187 (2 microm) results in release of [14c]arachidonate from phospholipid and its metabolism to prostaglandin e2 and 5-hydroxy-6,8,11,14-eicosatetraenoic acid (5-hete), a lipoxygenase product. the released arachidonate is also metabolized to a polar lipid of unknown composition here disignated compound a. 5-hete was found to be rele ... | 1979 | 387819 |
| serum opsonic activity in rodent malaria: functional and immunochemical characteristics in vitro. | the functional and immunochemical characteristics of serum opsonic activity in rodent malaria were examined in the present study. schizont- and late trophozoite-enriched populations of plasmodium berghei-infected red blood cells (irbc) were isolated on a ficoll density-gradient and used in an in vitro phagocytosis system composed of serum and monolayer cultures of rat peritoneal macrophages. hyperimmune serum augmented the phagocytosis of irbc to a greater degree than did nonimmune serum. when e ... | 1979 | 387873 |
| [inductions of adjuvant arthritis in rats and footpad swelling reaction in mice by injection with the purified cell wall fraction from in vitro grown mycobacterium lepraemurium hawaii (author's transl)]. | | 1979 | 389918 |
| human plasma angiotensinogen: a review of purification procedures. | the current status of the purification and characterization of human angiotensinogen is reviewed. one problem encountered in the past has been the copurification of a protein with similar porperties. this protein has tentatively been designated alanine-protein. an efficient separation of angiotensinogen and alanine-protein was obtained on a zinc chelate column. alanine-protein has been purified and its amino acid and carbohydrate composition determined. the cooh-terminal amino acid and the nh2-t ... | 1979 | 390363 |
| [properties of plague microbe revertants obtained from l forms]. | | 1979 | 390929 |
| isolation of pathogens other than yersinia pestis during plague investigations. | from 1975 to 1978, 37 isolates of pasteurella multocida, 1 of salmonella enteriditis, and 5 of francisella tularensis were recovered from 42 mammalian specimens and 1 flea pool submitted for examination for evidence of infection with yersinia pestis. most of the specimens were collected during investigations of either a human plague infection or a reported epizootic among rodent populations. all specimens were of species regularly or occasionally involved in plague or tularemia cycles in nature ... | 1979 | 392123 |
| lung compliance and lung morphology following artificial ventilation in the premature and full-term rabbit neonate. | rabbit neonates delivered on day 27--30 of gestation were subjected to intermittent positive pressure ventilation (ippv) for 60 min. tidal volume was standardized to 10 ml/kg, and the insufflation pressure required to maintain this tidal volume was recorded. the quasistatic compliance of the lung-thorax system, corrected for variations in body weight, was significantly lower in animals delivered on day 27--28 than in those delivered on day 29--30. immature animals with low lung-thorax complianc ... | 1979 | 394314 |
| [the molecular biology of aging -- 15: structure and function of the genetic apparatus in aging. ii. synthesis and metabolism of rna]. | with aging in different organs there are similar or tissue specific changes of the ribonucleic acids in respect of the quantity, the spectrum of different rna species and the metabolism of rna. among these processes the template function of the chromatin and the behaviour of the rna polymerases are important influencing factors. in aging the sensitivity of the rna synthesis against hormonal stimulation is decreased in the most cases. a survey about the results of many in vivo and in vitro experi ... | 1979 | 395770 |
| genetic modification of macrophage functions in relation to antibody responsiveness and resistance to infection. | | 1979 | 397751 |
| immunity in plague: protection of the vervet (cercopithecus aethips) against pneumonic plague by the oral administration of live attenuated yersinia pestis. | protection against pneumonic plague by the oral administration of a live, attenuated yersinia pestis vaccine, ev76 (paris) f, was evaluated in the vervet (cercopithecus aethips). six animals were vaccinated with a dose of 1.175 x 10(9) colony-forming units (cfu); all tolerated the dose and developed antibodies to fraction i of y. pestis. three immunized animals were challenged with an inhaled dose of 3.2 x 10(6) cfu (160 ld50 [50% lethal dose]) of virulent y. pestis strain 195/p and two survived ... | 1977 | 402428 |
| [toxicity of bacterial polysaccharides (a review of the literature)]. | | 1977 | 402887 |
| the role of cellular locomotion in leukemic infiltration. an organ culture study on penetration of l 5222 rat leukemia cells into the chick embryo mesonephros. | the significance of cellular locomotion for leukemic infiltration was investigated using l 5222 rat leukemia cells. previous cinemicrographic studies have shown that these cells are able to locomote only after formation of a uropod-like posterior extension. this characteristic locomotive configuration of l 5222 cells is easily recognizable in scanning electron micrographs and appropriate sections. leukemia cells were inoculated on slices of chick embryo mesonephros incubated for 24h; at this tim ... | 1977 | 403674 |
| nature of collagens synthesized by monkey periodontal-ligament fibroblasts in vitro. | 1. first subcultures of fibroblast-like cells from adult monkey periodontal ligament were incubated in the presence of 14c-labelled amino acids and produced significant amounts of type-i and type-iii collagens. 2. the proportion of type-iii collagen produced was calculated on the basis of the recovery of procollagens from deae-cellulose chromatography to be approx. 20%, and at least 10% when analysed as collagens on cm-cellulose chromatography. 3. sodium dodecyl sulphate/polyacrylamide-gel elect ... | 1978 | 415740 |
| amino acid degrading enzymes for cancer therapy. | the development of microbial enzymes for cancer therapy presents difficulties not commonly experienced with biological drugs. the development of the enzyme asparaginase from escherichia coli in the usa and of the serologically different asparaginase from the plant pathogen erwinia carotovora in this establishment, has not only added to the choice of antileukaemia drugs but also provided a valuable guide to the selection and development of new therapeutic enzymes. our own programme has led to the ... | 1977 | 415922 |
| development of a pulmonary technique to assess inhaled bronchoactive agents in the conscious rhesus monkey. | | 1978 | 416200 |
| [carbon polymer stomata in vesicostomy and other urinary diversion procedures (author's transl)]. | implants of pure carbon are ideal for prosteses because of their tissue acceptability and lack of incrustation. animal experiments with biocarbon implants were tested as subfascial implantations, coeco-, ileo-, and vesicostomies, (n = 37). the results showed lack of reaction and good healing of the stomata, lack of incrustation, and water tight urinary diversion. based on these animal experiments biocarbon vesicostomies were carried out successfully in six patients. the follow up period was 3--1 ... | 1979 | 419640 |
| what is your diagnosis? | | 1979 | 422469 |
| effects of ccnu on hematopoiesis in rats. | the effect of orally administered ccnu on proliferating and cytokinetically "resting" bone marrow cells was studied in rats. the resting bone marrow cells were selectively labeled with 3h-thymidine by the "complete 3h-thymidine labeling method." the results show a reduction in the number of absolute bone marrow cells to about 40% of the original value in 3 days. regeneration was completed only after 22 days. no difference was found in the destructive or the regenerative pattern of cfu-c, myelopo ... | 1979 | 427820 |
| catecholamines and intracranial pressure. | | 1979 | 430167 |
| contribution of adrenal medulla, spleen and lymph, to the plasma levels of dopamine beta-hydroxylase and catecholamines induced by hemorrhagic hypotension in dogs. | | 1979 | 438992 |
| ketone bodies are selectively used by individual brain regions. | close study of 3-hydroxybutyrate uptake by brain suggests that its metabolism is limited by permeability. furthermore, the permeability characteristics vary from region to region; areas known to have no blood-brain barrier show the highest rate of utilization. the results imply that rather than substitute fuels, ketone bodies should be considered supplements which partially supply specific areas but are incapable of supporting the entire energy requirement of all brain regions. | 1979 | 451608 |
| [sensitivity of different strains of the causative agent of plague to disinfectants]. | various strains of the plague microbe was found to have statistically significant differences in their sensitivity to phenol, formaldehyde and chloramine. these differences did not correlate with the origin, virulence and nutritional requirements of the plague strains. the sensitivity of the plague microbe to formaldehyde and phenol was found to be related to the permeability of its cell wall. | 1979 | 463428 |
| studies on conformational changes in f-actin of glycerinated muscle fibers during relaxation by means of polarized ultraviolet fluorescence microscopy. | by means of polarized ultraviolet fluorescence microscopy the conformational changes of f-actin occuring in glycerinated muscle fibers of rabbit and barnacle (balanus rostratus hock.) under the influence of adenosine triphosphate in the presence of ethylene glycol bis(beta-amino-ethyl ether)-n,n'-tetraacetic acid were discovered. these changes seem to be located near the surface of the globules thus hampering the penetration of univalent iones and neutral molecules into the f-actin macromolecule ... | 1979 | 470613 |
| [cyst formation by methanosarcina]. | the morphology of a coccoid, methane producing bacterium growing on acetate was studied. the organism is capable of forming morphologically differentiated cells, nicrocysts, whose structure resembles that of bacterial surviving cells. the organism from peculiar macrocysts in the enrichment culture. in its other characteristics, the organism is similar to methanococcus mazei. however, it clasibied as methanosarcina, biotype 3, due to the characteristic formation of multicellular pseudococci. | 1979 | 470629 |
| consequences of ca2+ deficiency on macromolecular synthesis and adenylate energy charge in yersinia pestis. | a 37 but not 26 degrees c virulent yersinia pestis is known to require at least 2.5 mm ca2+ for growth; this requirement is potentiated by mg2+. after shift of log-phase cells (doubling time of 2 h) from 26 to 37 degrees c in ca2+-deficient medium, shutoff of net ribonucleic acid synthesis preceded that of protein and cell mass. with 2.5 mm mg2+, about two doublings in cell mass and number occurred before restriction with synthesis of sufficient deoxyribonucleic acid to account for initiation an ... | 1979 | 479109 |
| purification and chemical characterization of antigens from sheep erythrocytes. | a mixture of glycoproteins and glycolipids was solubilized from sheep erythrocytes membranes under the effect of high ionic strength (2 m nacl, 0.5 m tris). several antigenic fractions could be purified from the mixture using gel filtration on sephadex g-200 and block electrophoresis on pevikon c870; two fractions were found to raise antibodies in a primary reaction and these antibodies effectively sensitized erythrocytes to lysis by complement. the majority of other fractions elicited a weaker ... | 1979 | 511033 |
| possible pneumonic plague. | | 1979 | 511127 |
| experimental plague in the california ground squirrel. | in experiments to determine the current susceptibility to plague, it was demonstrated that 256 yersinia pestis (a local strain of high virulence) were required to produce a 50% infectious dose (id50) in california ground squirrels (spermophilus beecheyi) that had been collected in southeastern monterey county, california; 6,070 y. pestis were required to produce a 50% lethal dose (ld50). (the ld50 was about 24 times the id50.) the frequency of serologic response to the specific fraction 1 antige ... | 1979 | 512421 |
| human plague in new mexico: report of three autopsied cases. | plague is a deadly disease of obvious concern to individuals, communities, and public health officials. the rapid recognition of plague victims is of paramount importance in saving the lives of the victims and in the protection of contacts. three autopsied plague cases have been presented and the pathological features have been discussed. | 1979 | 512611 |
| [first results obtained in man with ethinyl estradiol sulfonate given for various indications (proceedings)]. | | 1979 | 515140 |
| a study of low-frequency vibrations of human arteries. | | 1979 | 515171 |
| [allergenic and anaphylactoid properties of carcinostatic compounds of platinum]. | different effects of platinum salts on the organism were studied comparatively. the toxic effect was estimated by ld50; the carcinogenic one--by the action on ehrlich ascites tumor; the anaphylactoid effect was evaluated by the degree of the arterial pressure fall, the development of bronchospasm and an increased blood histamine level in cats under intravenous injection of platinum salts. the sensitization action of platinum salts was assessed on guinea pigs. all these effects are found to be de ... | 1979 | 516565 |
| inhomogeneous distribution of filipin-sterol complexes in the ciliary membrane of rat tracheal epithelium. | pieces of rat trachea fixed in a glutaraldehyde solution containing 300 mum filipin, a sterol-specific polyene antibiotic (elias et al., '78), were freeze-fractured in order to study the distribution of cholesterol within the ciliary membrane. filipin-sterol complexes, recognizable as 25-30-nm protrusions on fracture faces, appeared densely and uniformly distributed over most of the ciliary membrane, but were absent from the region of the ciliary necklace. it is possible, therefore, that the cil ... | 1979 | 517447 |
| histologic diagnosis of diseases of malabsorption. | the diagnoses which may be arrived at by examination of peroral small bowel mucosal biopsy specimens are presented. celiac sprue, unclassified sprue (refractory sprue), infectious gastroenterititis, stasis syndrome and kwashiorkor have a severe mucosal lesion. other clinical conditions are required to establish the diagnosis in these diseases. a number of diseases have specific diagnostic features. included are whipple's disease, abetalipoproteinemia, collagenous sprue, primary intestinal lympho ... | 1979 | 517556 |
| [effects of ionizing radiations on the ultrastructure of bursa of fabricius]. | the alterations induced in the lymphoid and epitelial cells of the bursa of fabricius in chicks exposed at different doses of gamma rays mainly occur during the interfase. the extent of these alterations appears reduced in comparison with that observed in the chick thymus treated in the same way. | 1979 | 518763 |
| studies on selective induction of lysosomal enzyme activities in mouse peritoneal macrophages. | | 1979 | 522087 |
| [problems of the disease due to mycobacteria other than tubercle bacilli: history of studies and unsolved problems (author's transl)]. | | 1979 | 522347 |
| experimental granulomatous inflammation: ii. effect of injection of intact and disrupted killed tubercle bacilli into freund adjuvant-sensitized cavies. | the reaction of freund adjuvant-immunized cavies to subsequent injection of mycobacterium tuberculosis h37ra is confirmed as an immunologically mediated phenomenon. ultrasonic disruption of mycobacteria to be injected as "challenge" markedly increases the intensity of the consequent 24-48 h reaction and subsequent fibrosis in freund adjuvant-sensitized cavies and has an apparently inhibiting effect on the extent of subsequent granuloma formation with marked reduction of the density of epithelioi ... | 1979 | 523183 |
| [new cases of opisthorchiasis and their anatomopathological picture in cats in warmia]. | | 1979 | 524889 |
| insulin responsiveness of adipose tissue from normal weight subjects with early diabetes. | in normal weight subjects, classified by a 2-h glucose infusion test as having normal (11), borderline (3) or pathological (9) carbohydrate tolerance (cht), subcutaneous adipose tissue was removed under intracutaneous anesthesia by surgical biopsy. the biological responsiveness of isolated adipocytes as well as adipose tissue fragments measured as incorportion of (1-14c) glucose into co2 or triglycerides was studied in the absence or presence of different insulin concentrations. in persons with ... | 1979 | 525210 |
| serially etched shark enameloid observed by incident light microscopy. | longitudinal and transverse tooth sections of isurus oxyrinchus were serially etched in 2.6% nitric acid. the changing optical properties of the etched surfaces were observed during the serial etchings, and the descent of the enameloid surfaces was measured. shark enameloid seems to be less effectively etched by acid than human enamel; this difference may be due to differences in solubility between fluorapatite and hydroxyapatite. most of the information regarding the structure of the enameloid ... | 1979 | 525241 |
| hybridization and heat tolerance in rats. | buffalo and fisher inbred rats and their f1--f4 hybrids were exposed to heat, 96 degrees f and 30% humidity, at 35 days of age. fisher rats which are of lighter weight survive significantly longer than buffalo rats which are heavier. body weight was significantly depressed in all hybrids. only in f2 hybrids was heat tolerance similar to that of the fisher inbreds. in all other hybrids, it was lower. no heterosis was found under the conditions used. | 1979 | 525249 |
| toluene dioxygenase: purification of an iron-sulfur protein by affinity chromatography. | | 1979 | 526270 |
| the relationship between early automatic and late voluntary compensatory responses to muscle stretch in the long flexor of the human thumb [proceedings]. | | 1979 | 529071 |
| effect of vibration on the mechanical resistance of the human forearm to small imposed sinusoidal movements [proceedings]. | | 1979 | 529079 |
| disaccharide competition with hexose transport in the rat perfused liver [proceedings]. | | 1979 | 529099 |
| adrenergic stimulation of mucus secretion in the human bronchus [proceedings]. | | 1979 | 529116 |
| reflex action of amplitude-modulated vibration in man [proceedings]. | | 1979 | 529124 |
| effect of sodium on the absorption of glucose and galactose across the rat jejunum measured in vivo [proceedings]. | | 1979 | 529125 |
| nucleic acid and protein metabolism in the pancreas, spleen, thymus, lung, cardiac and skeletal muscle and lens of undernourished female rats. | | 1979 | 533871 |
| the effect of temporary exercising of a joint during an immobilization period: an experimental study on rabbits. | the right hind limbs of adult rabbits were immobilized for 5 weeks. the rabbits were then allowed to move freely for 8 weeks. the rabbits of the control group were immobilized uninterruptedly. in a second group of rabbits the plaster was removed during the immobilization period 6 days a week for 5 minutes for careful exercise and in a third group of rabbits, for violent exercise. the temporary careful exercise was of no benefit and was sometimes harmful, and the violent exercise was usually inju ... | 1979 | 535243 |
| euthanasia: a serene voyage to death? | modern western culture regards death as a threatening enemy, whereas the ancients, as is the case in eastern philosophy, recognized both the fight with, and the releasing surrender to death. dying is quite often a serene voyage, be it through old age, sickness, was or even suicide. attentive listening to those who face the termination of incurable disease reveals the voice of enlightenment: 'euthanasia' also means 'clarified dying'. an attitude like this alleviates our recoil and assists in a su ... | 1979 | 535362 |
| antiplague antibodies against yersinia pestis fraction-i antigen in serum from rodents either experimentally infected or captured in harbor areas of japan, 1971--1977. | antiplague indirect hemagglutination tests were investigated with yersinia pestis fraction-i antigen and sera from experimentally infected rodents. the same tests with sera treated with acetone or acetone-2-mercaptoethanol were performed in parallel. technical conditions were determined to insure the specificity and reproducibility of the reactions. utilizing the methods studied, we carried out serological surveillance of plague with sera from wild rats (rattus rattus and r. norvegicus) captured ... | 1979 | 537520 |
| vein grafts in microvascular surgery. | the judicious use of vein grafts will lessen the incidence of thrombosis in microvascular surgery and help to overcome problem of vessels loss. vein grafts are readily available and do not pose any major disadvantages. | 1979 | 539801 |
| identification of a new allele of es-i segregating in an inbred strain of mice. | a new allele of es-1, designated es-1e, has been identified in the mouse. this allele was discovered segregating among the progeny of a strain dba/2j male and is apparently the result of a spontaneous mutation within this strain. genetic analyses have shown that this mutation is heritable and, further, that both heterozygous and homozygous progeny are viable and fertile. to date, no discernible deleterious effects have been identified as associated with this mutation. | 1979 | 540008 |
| identification of a new allele of es-i segregating in an inbred strain of mice. | a new allele of es-1, designated es-1e, has been identified in the mouse. this allele was discovered segregating among the progeny of a strain dba/2j male and is apparently the result of a spontaneous mutation within this strain. genetic analyses have shown that this mutation is heritable and, further, that both heterozygous and homozygous progeny are viable and fertile. to date, no discernible deleterious effects have been identified as associated with this mutation. | 1979 | 540008 |
| [the development and testing of an electronically controlled light sequence bar for the electro oculographic study of the pursuit movement of the human eye (author's transl)]. | | 1979 | 540121 |
| [characteristics of human neutrophils obtained by the chamber method of "skin window"]. | viability, morphology and function of healthy human cells migrated into the chamber through the "skin window" were studied. after 18 to 20 hours there were 42.0 +/- 5.3 (x 10(6))/cm2 viable cells characterized by a high content of mature neutrophils (98.6 +/- 0.6%). normal reactivity of migrated neutrophils was observed using the nitroblue tetrazolium reduction test. the chamber variant of the "skin window" method is recommended as a simple physiological technique for preparing pure populations ... | 1979 | 540158 |
| [human phrenic nerve: analysis of nerve fibre types on the base of their acetylcholinesterase activity (author's transl)]. | as marked differences in the acetylcholinesterase (ache)-activity of myelinated nerve fibres of ventral and dorsal spinal roots can be found also in human post mortem material (zenker et al. 1978), the karnovsky-method for histochemical demonstration of ache-activity has been used for differentiation of motor and sensory fibres in the human phrenic nerve. in cross sections of the phrenic nerve 1--2 cm above its entrance into the diaphragm, after an incubation period of 24 hours, 86% of the medul ... | 1979 | 543560 |
| liver involvement in essential mixed cryoglobulinemia. | twenty-one of 30 patients with essential mixed cryoglobulinemia (emc) had evidence of liver involvement. the liver disease was characterized by the absence of clinical symptoms, hepatosplenomegaly, mild elevation of enzymes, abnormal bsp retention and low albumin levels. histology, available in 12 patients, showed either chronic persistent or chronic active hepatitis or liver cirrhosis; 44% of the patients had hbsag or hbsab in sera and/or cryoglobulins, confirming the high frequency of exposure ... | 1979 | 545644 |
| plague antibody in large african mammals. | plague hemagglutinating antibodies to a titer of 1:1,024 were demonstrated in 6.6% of buffalo and 0.3% of elephant sera tested 1 year after a plague epidemic in the same area. | 1979 | 546794 |
| correlation between gross observations of tumors and neoplasms diagnosed microscopically in carcinogenesis bioassays in rats. | microscopic diagnoses of spontaneous and induced neoplasms in f344 rats in two carcinogenesis bioassays were correlated with the gross observations made at the time of necropsy. the results for a negative and a positive compound with reference to carcinogenicity, indicate that of the gross descriptions indicative of tumors, 37 percent and 24 percent respectively, were not diagnosed as neoplasms microscopically. however, some of the gross lesions were diagnosed histologically as nonneoplastic les ... | 1979 | 547015 |
| crown gall: economic importance and control. | many plants of economic importance are possible hosts for agrobacterium tumefaciens, the causal organism of the crown gall tumor disease. damage has been reported on stone fruit (australia), vineyard (hungary, bulgaria), lettuce (brasil) ... in western-europe, crown gall seems to be of less economic importance for plants growing in the open air. however, plants cultivated in greenhouses have a greater chance to be tumorized, because of the more favourable circumstances for tumor induction. moder ... | 1979 | 549390 |
| vestibular influences on the cat's cerebral cortex. | | 1979 | 551452 |
| cyclic kinetics and mathematical expression of the primary immune response to soluble antigen. vii. the conveyer hypothesis and its mathematical expression. | the conveyer hypothesis is based on the fact that because of clone predetermination, antibody production takes place in an organism without the presence of antigen as a result of natural cell differentiation. soluble antigen is an analogue of a specific mitogen which gives rise to reproduction mainly of cells carrying on their surface the immunoglobulin receptors to the given antigen. the mathematical model of the conveyer hypothesis takes into account the initial conditions, among them the back ... | 1977 | 557428 |
| endemic human plague in new mexico: risk factors associated with infection. | a retrospective case-control study was conducted to identify risk factors, other than contact with infected animal tissues, for infection caused by yersinia pestis in non-indian residents of areas with endemic sylvatic plague in new mexico. the study group consisted of 16 persons who had bacteriologically confirmed cases of plague in the period 1975-1976 and 45 controls who were matched by age, sex, and location of residence. participants were questioned about outdoor activities, environmental c ... | 1979 | 574152 |
| plague and pregnancy. a case report. | | 1977 | 576693 |
| [change in the frequency of blocking in xenopsylla cheopis (aphaniptera) fleas infected with the causative agent of plague under the action of indandione blood anticoagulants]. | | 1979 | 583178 |
| [effect of the digestive process on the survival of the plague agent in xenopsylla gerbilli minax fleas]. | hystological investigations of experimentally infected x. gerbilli minax have shown that at the early stages of the digestion, while in the intestine compact clots of non-digested blood, are preserved, proceeds the reproduction of the plague agent. with the decay of the alimentary clot it changes into the dying off of the microbe population and after the ceasing of digestion the accumulation of bacteria renews again. simultaneously with the changes in the number of microbes their morphology vari ... | 1977 | 593719 |
| another focus of sylvatic plague in kenya. | | 1977 | 612432 |
| [occurrence of induced vitamin-dependent mutants of yersinia pestis]. | vitamin-dependent mutants were isolated from yersinia pestis after the treatment with supermutagens. from 13 mutants obtained 10 appeared to be unstable. the stable vitamin-dependent mutants were revealed with the frequency of 2.5.10(-11) divided by 4.9.10(-11) by the indirect method of selection and 5.10(-7) by the use of davis's method. the frequency of amino acid and nitrogen base dependent auxotroph isolation was significantly higher than that of the vitamin-dependent mutants. | 1977 | 614956 |
| [epizootiological importance of frontopsylla hetera (siphonaptera) fleas in the gorno-altai natural plague focus]. | experiments conducted during all seasons have established that f. hetera, one of the mass species of fleas in mountain altai, can be infected both by the strain of selective virulence typical to this nidus and by the non-typical non-virulent mountain-altai strain of plague agent. the non-virulent strain does not form in fleas the block of proventriculus and within 1.5-2 months they become free from the microbe. at the infection with the typical strain of the altai subspecies rare transmissions o ... | 1978 | 622294 |
| atypical plague bacilli isolated from rodents, fleas, and man. | | 1978 | 637172 |
| [problem of preservation of the causative agent of plague in nature as a methodological task in epidemiology of anthropozoonoses]. | | 1978 | 651804 |
| [increased invasiveness as one of the manifestations of phenotype variability of the plague microbe in fleas]. | experimental studies conducted on genetically connected virulent subcultures of y. pestis showed that the death of albino mice infected by flea bite occurred earlier than in the animals infected by a syringe subcutaneously. a high invasiveness of y. pestis subcultures isolated from fleas (in comparison with the initial strains and subcultures from the animals) persisted for 2--3 passages in their cultivation on artificial nutrient media. | 1978 | 665025 |
| biological species in praomys (mastomys) natalensis (smith), a rodent carrier of lassa virus and bubonic plague in africa. | plague has been known from countries surrounding rhodesia from as early as 1935, but was first reported from rhodesia in 1974. part of our investigation of the complex ecosystem involving yersinia pestis is critical assessment of the evolutionary status of natural populations belonging to formal, taxonomic species of implicated rodents. we present data on chromosomal and hemoglobin variation in sympatric populations and laboratory produced hybrids that give unequivocal evidence for at least two ... | 1978 | 677375 |
| mechanisms of long and short term immunity to plague. | long and short term immunity to plague was produced in normal mice by using, respectively, an antibiotic resistant yersinia pestis and yersinia pseudotuberculosis. both immunogens were used live. passive serum transfer experiments, together with assays for the bactericidal activity of macrophages and delayed hypersensitivity tests, showed that the short term immunity was of a humoral nature and the long term immunity was cell mediated. the plague virulence markers of the two immunogens were: y. ... | 1978 | 680791 |
| serological surveillance of plague in endemic areas of south india. | | 1978 | 700838 |
| [characteristics of the polysaccharide-containing somatic antigens isolated from the k-1 strain of the plague microbe and its antibiotic-resistant variants]. | immunochemical analysis of 2 polysaccharide-containing structures of the lypopolysaccharide of the plague causative agent (main somatic antigen and lipopolysaccharide) isolated from k-1 strain and a number of its antibiotic resistant mutants was carried out. it was shown that development of resistance to streptomycin alone or its combination with monomycin did not cause detectable changes in the monosaccharide composition and serological properties of the cultures tested. more significant change ... | 1978 | 708003 |
| consequences of aspartase deficiency in yersinia pestis. | growing cells of yersinia pseudotuberculosis, but not those of closely related yersinia pestis, rapidly destroyed exogenous l-aspartic and l-glutamic acids, thus prompting a comparative study of dicarboxylic amino acid catabolism. rates of amino acid metabolism by resting cells of both species were determined at ph 5.5, 7.0, and 8.5. regardless of ph, y. pseudotuberculosis destroyed l-glutamic acid, l-glutamine, l-aspartic acid, and l-asparagine at rates greater than those observed for y. pestis ... | 1978 | 711677 |
| [resistance to plague of mice experimentally infected with "yersinia enterocolitica" (author's transl)]. | | 1978 | 718023 |
| [production of l forms of the plague microbe]. | experiments were conducted in vitro. the process of formation of unstable l-form cultures of pasteurella pestis under the effect of penicillin was studied. a comparatively high frequency of this phenomenon in various strains was demonstrated. a possible role of the l-transformation process in the persistence of the causative agent in the organism of wild animals in endemic foci of infection is put forward. | 1978 | 747008 |
| [arthropodan vectors of human parasites: their pathology and defence reactions (author's transl)]. | many infectious diseases of man are transmitted by arthropods. it is not known whether the carriers were primarily susceptible or insusceptible as the cycle first came into existence. similarly so little is understood, why some arthropods are suitable vectors and other close relatives are not suitable. only the hypothesis that the agents are original parasites and not at all commensals or symbionts can reasonably explain the evolution of the cycles. it is shown by means of numerous examples how ... | 1976 | 769379 |