Publications

TitleAbstractYear
Filter
PMID
Filter
impact of covid-19 on maternal and neonatal outcomes: a systematic review and meta-analysis.previous outbreaks of severe acute respiratory syndrome coronavirus 1 (sars-cov-1) and middle east respiratory syndrome coronavirus (mers-cov) have been associated with unfavourable pregnancy outcomes. sars-cov-2 belongs to the human coronavirus family, and since this infection shows a pandemic trend it will involve many pregnant women.202033148440
systematic review and meta-analysis of smell and taste disorders in covid-19.loss of smell and taste are considered potential discriminatory symptoms indicating triaging for coronavirus disease 2019 (covid-19) and early case identification. however, the estimated prevalence essential to guide public health policy varies in published literature. this meta-analysis aimed to estimate prevalence of smell and taste loss among covid-19 patients.202032964177
covid-19 in hematological malignancy patients: a protocol for a systematic review and meta-analysis.covid-19 is an international outbreak of the respiratory illness caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2). the diseases themselves, as well as the intensity of chemotherapy, lead to significant immunosuppression, leading hematological malignancy patients susceptible to infections.202032871864
global psychological implications of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) and coronavirus disease-2019 (covid-19). what can be learned from italy. reflections, perspectives, opportunities.on december 31, 2019, the chinese authorities announced that in the city of wuhan, hubei province, central-eastern china, a cluster of pneumonia cases of unknown etiology had developed. a new coronavirus (sars-cov-2) that causes serious problems like pneumonia and even death, has been discovered. this new disease (covid-19) has spread also in italy starting from the first recognized case on february 20. beyond its biological implications, this coronavirus allows us many psychological reflections ...202032849079
generation of chicken igy against sars-cov-2 spike protein and epitope mapping.this new decade has started with a global pandemic of covid-19 caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2), precipitating a worldwide health crisis and economic downturn. scientists and clinicians have been racing against time to find therapies for covid-19. repurposing approved drugs, developing vaccines and employing passive immunization are three major therapeutic approaches to fighting covid-19. chicken immunoglobulin y (igy) has the potential to be used as neutral ...202033134398
non-respiratory presentations of covid-19, a clinical review.severe acute respiratory syndrome coronavirus 2 (sars-cov-2 or covid-19) is a highly infectious viral syndrome currently threatening millions of people worldwide. it is widely recognized as a disease of the pulmonary system, presenting with fever, cough, and shortness of breath. however, a number of extrapulmonary manifestations have been described in the literature.202033039218
can immunization of hens provide oral-based therapeutics against covid-19?in the current worldwide pandemic situation caused by the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) and the newest coronavirus disease (covid-19), therapeutics and prophylactics are urgently needed for a large population. some of the prophylaxis strategies are based on the development of antibodies targeting viral proteins. igy antibodies are a type of immunoglobulin present in birds, amphibians, and reptiles. they are usually obtained from egg yolk of hyper-immunized hens and ...202032872186
a scalable topical vectored vaccine candidate against sars-cov-2.the severe acute respiratory syndrome-coronavirus 2 (sars-cov-2) caused an ongoing unprecedented global public health crises of coronavirus disease in 2019 (covid-19). the precipitously increased death rates, its impact on livelihood and trembling economies warrant the urgent development of a sars-cov-2 vaccine which would be safe, efficacious and scalable. owing to unavailability of the vaccine, we propose a de novo synthesized avian orthoavulavirus 1 (aoav-1)-based topical respiratory vaccine ...202032846910
coronaviruses: an updated overview of their replication and pathogenesis.coronaviruses (covs), enveloped positive-sense rna viruses, are characterized by club-like spikes that project from their surface, an unusually large rna genome, and a unique replication strategy. covs cause a variety of diseases in mammals and birds ranging from enteritis in cows and pigs, and upper respiratory tract and kidney disease in chickens to lethal human respiratory infections. most recently, the novel coronavirus, sars-cov-2, which was first identified in wuhan, china in december 2019 ...202032833200
genome sequencing and characterization analysis of a beijing isolate of chicken coronavirus infectious bronchitis virus.avian infectious bronchitis virus (aibv) is classified as a member of the genus coronavirus in the family coronaviridae. the enveloped virus has a positive-sense, single-stranded rna genome of approximately 28 kilo-bases, which has a 5' cap structure and 3' polyadenylation tract. the complete genome sequence of infectious bronchitis virus (ibv), beijing isolate, was determined by cloning sequencing and primer walking. the whole genome is 27733 nucleotides in length, has ten open reading frames: ...200432214717
genome sequencing and characterization analysis of a beijing isolate of chicken coronavirus infectious bronchitis virus.avian infectious bronchitis virus (aibv) is classified as a member of the genus coronavirus in the family coronaviridae. the enveloped virus has a positive-sense, single-stranded rna genome of approximately 28 kilo-bases, which has a 5' cap structure and 3' polyadenylation tract. the complete genome sequence of infectious bronchitis virus (ibv), beijing isolate, was determined by cloning sequencing and primer walking. the whole genome is 27733 nucleotides in length, has ten open reading frames: ...200432214717
covid-19 and cardiac surgery: the perspective from united kingdom.the emergence of severe acute respiratory syndrome coronavirus 2 in december 2019, presumed from the city of wuhan, hubei province in china, and the subsequent declaration of the disease as a pandemic by the world health organization as coronavirus disease 2019 (covid-19) in march 2020, had a significant impact on health care systems globally. each country responded to this disease in different ways, however this was done broadly by fortifying and prioritizing health care provision as well as in ...202032981073
severe acute respiratory distress syndrome secondary to coronavirus 2 (sars-cov-2).the novel severe acute respiratory syndrome coronavirus 2 (sars-cov-2) causes coronavirus disease 2019 (covid-19) and has created a worldwide pandemic. many patients with this infection have an asymptomatic or mild illness, but a small percentage of patients require hospitalization and intensive care. patients with respiratory tract involvement have a spectrum of presentations that range from scattered ground-glass infiltrates to diffuse infiltrates with consolidation. patients with the latter r ...202033098401
unlocking covid therapeutic targets: a structure-based rationale against sars-cov-2, sars-cov and mers-cov spike.there are no approved target therapeutics against sars-cov-2 or other beta-covs. the beta-cov spike protein is a promising target considering the critical role in viral infection and pathogenesis and its surface exposed features. we performed a structure-based strategy targeting highly conserved druggable regions resulting from a comprehensive large-scale sequence analysis and structural characterization of spike domains across sarsr- and mersr-covs. we have disclosed 28 main consensus druggable ...202032913581
a global treatments for coronaviruses including covid-19.in late december 2019 in wuhan, china, several patients with viral pneumonia were identified as 2019 novel coronavirus (2019-ncov). so far, there are no specific treatments for patients with coronavirus disease-19 (covid-19), and the treatments available today are based on previous experience with similar viruses such as severe acute respiratory syndrome-related coronavirus (sars-cov), middle east respiratory syndrome coronavirus (mers-cov), and influenza virus. in this article, we have tried to ...202032394467
the indian perspective of covid-19 outbreak.the emerging infection of covid-19 was initiated from wuhan, china, have been spread to more than 210 countries around the globe including india. the clinical symptoms of covid-19 are very similar to other respiratory viruses. the number of laboratory-confirmed cases and associated deaths are increasing regularly in various parts of the world. seven coronaviruses (229e, nl63, oc43, hku1, sars, mers and, covid-19) can naturally infect human beings. out of these four (229e-cov, nl63-cov, oc43-cov, ...202032368570
the novel coronavirus: a bird's eye view.the novel coronavirus (2019-ncov) outbreak, which initially began in china, has spread to many countries around the globe, with the number of confirmed cases increasing every day. with a death toll exceeding that of the sars-cov outbreak back in 2002 and 2003 in china, 2019-ncov has led to a public health emergency of international concern, putting all health organizations on high alert. herein, we present on an overview of the currently available information on the pathogenesis, epidemiology, c ...202032020915
additional diagnostic testing of the 2019 novel coronavirus (sars-cov-2).within the last two decades several members of the coronaviridae family namely severe respiratory syndrome (sars-cov) and middle east respiratory syndrome (mers-cov) have demonstrated epidemic potential. in late, 2019 an unnamed genetic relative, later named sars-cov-2 realized its potential in the highly populous neighborhoods of wuhan, china. unchecked, the virus rapidly spread among interconnected communities and related households before containment measures could be in acted. "appropriate" ...202032837527
cathepsin b protease facilitates chikungunya virus envelope protein-mediated infection via endocytosis or macropinocytosis.chikungunya virus (chikv) is an enveloped virus that enters host cells and transits within the endosomes before starting its replication cycle, the precise mechanism of which is yet to be elucidated. endocytosis and endosome acidification inhibitors inhibit infection by chikv, murine leukemia virus (mlv), or sars-coronavirus, indicating that these viral entries into host cells occur through endosomes and require endosome acidification. although endosomal cathepsin b protease is necessary for mlv ...202032635194
gilt restricts the cellular entry mediated by the envelope glycoproteins of sars-cov, ebola virus and lassa fever virus.interferons (ifns) control viral infections by inducing expression of ifn-stimulated genes (isgs) that restrict distinct steps of viral replication. we report herein that gamma-interferon-inducible lysosomal thiol reductase (gilt), a lysosome-associated isg, restricts the infectious entry of selected enveloped rna viruses. specifically, we demonstrated that gilt was constitutively expressed in lung epithelial cells and fibroblasts and its expression could be further induced by type ii interferon ...201931631785
comparison of trends in the quantity and variety of science citation index (sci) literature on human pathogens between china and the united states.the proportion of pathogenic microorganisms in the microbial world is relatively small, while their threat to human health, economic development and social stability is severe. the quantity and variation of science citation index (sci) literature related to pathogenic microorganisms may reflect the level of relevant research and the degree of attention. here we compared trends in the quantity and variety of sci literature relating to certain important pathogenic microorganisms published by scien ...201232214557
complemented palindromic small rnas first discovered from sars coronavirus.in this study, we report for the first time the existence of complemented palindromic small rnas (cpsrnas) and propose that cpsrnas and palindromic small rnas (psrnas) constitute a novel class of small rnas. the first discovered 19-nt cpsrna uuaacaagcuuguuaaaga, named sars-cov-cpsr-19, was detected from a 22-bp dna complemented palindrome tctttaacaagcttgttaaaga in the severe acute respiratory syndrome coronavirus (sars-cov) genome. the phylogenetic analysis supported that this dna complemented p ...201830189613
one-step nested rt-pcr for covid-19 detection: a flexible, locally developed test for sars-cov2 nucleic acid detection.due to the coronavirus pandemic, identifying the infected individuals has become key to limiting its spread. virus nucleic acid real-time rt-pcr testing has become the current standard diagnostic method but high demand could lead to shortages. therefore, we propose a detection strategy using a one-step nested rt-pcr.202032794453
[coronavirus: from common cold to severe pulmonary failure].in december 2019 a new human coronavirus emerged in wuhan, china, which is known as sars-cov‑2. the clinical course of the disease known as coronavirus disease 2019 (covid-19) ranges from mild respiratory symptoms to severe lung failure. the virus is currently rapidly spreading around the world and pushing health systems to the limits of their capacity due to the exponential increase in the number of cases. the origin of sars-cov‑2 lies in the bat coronavirus pool and has now emerged in the huma ...202032292213
the progression of sars coronavirus 2 (sars-cov2): mutation in the receptor binding domain of spike gene.severe acute respiratory syndrome coronavirus 2 (sars-cov2) is a positive-sense single-stranded rna (+ssrna) that causes coronavirus disease 2019 (covid-19). the viral genome encodes twelve genes for viral replication and infection. the third open reading frame is the spike (s) gene that encodes for the spike glycoprotein interacting with specific cell surface receptor - angiotensin converting enzyme 2 (ace2) - on the host cell membrane. most recent studies identified a single point mutation in ...202033163249
diagnostic salivary tests for sars-cov-2.the diagnosis of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) infection relies on the detection of viral rna by real-time reverse transcription polymerase chain reaction (rrt-pcr) performed with respiratory specimens, especially nasopharyngeal swabs. however, this procedure requires specialized medical personnel, centralized laboratory facilities, and time to provide results (from several hours up to 1 d). in addition, there is a non-negligible risk of viral transmission for the ...202033131360
kinetics and isotype assessment of antibodies targeting the spike protein receptor-binding domain of severe acute respiratory syndrome-coronavirus-2 in covid-19 patients as a function of age, biological sex and disease severity.there is an incomplete understanding of the host humoral immune response to severe acute respiratory syndrome (sars)-coronavirus (cov)-2, which underlies covid-19, during acute infection. host factors such as age and sex as well as the kinetics and functionality of antibody responses are important factors to consider as vaccine development proceeds. the receptor-binding domain of the cov spike (rbd-s) protein mediates host cell binding and infection and is a major target for vaccine design to el ...202033072323
analysis of sars-cov-2 mutations in mexico, belize, and isolated regions of guatemala and its implication in the diagnosis.the genomic sequences of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) worldwide are publicly available and are derived from studies due to the increase in the number of cases. the importance of study of mutations is related to the possible virulence and diagnosis of sars-cov-2. to identify circulating mutations present in sars-cov-2 genomic sequences in mexico, belize, and guatemala to find out if the same strain spread to the south, and analyze the specificity of the primers use ...202033049069
high-resolution structure and biophysical characterization of the nucleocapsid phosphoprotein dimerization domain from the covid-19 severe acute respiratory syndrome coronavirus 2.unprecedented by number of casualties and socio-economic burden occurring worldwide, the coronavirus disease 2019 (covid-19) pandemic caused by the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) is the worst health crisis of this century. in order to develop adequate countermeasures against covid-19, identification and structural characterization of suitable antiviral targets within the sars-cov-2 protein repertoire is urgently needed. the nucleocapsid phosphoprotein (n) is a multi ...202033039147
minimize glycemic fluctuation decrease the risk of severe illness and death in patients with covid-19.the recent coronavirus disease (covid-19) is caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) and has been spreading rapidly throughout the continents. the insights in how this viral disease affects general population is thus urgently needed. diabetes mellitus is one of the leading threats for morbidity and mortality globally. infection of coronavirus in diabetic patients may trigger acute hyperglycemia due to increased secretion of hyperglycemic hormones, extensive applica ...202033026669
a rise in facial nerve palsies during the coronavirus disease 2019 pandemic.an increase in spontaneous lower motor neuron facial nerve (viith cranial nerve) palsies was seen during the severe acute respiratory syndrome coronavirus 2 outbreak in our emergency clinic. this led us to perform a single-centre cohort review.202032998780
mass spectrometry and structural biology techniques in the studies on the coronavirus-receptor interaction.mass spectrometry and some other biophysical methods, have made substantial contributions to the studies on severe acute respiratory syndrome coronavirus 2 (sars-cov-2) and human proteins interactions. the most interesting feature of sars-cov-2 seems to be the structure of its spike (s) protein and its interaction with the human cell receptor. mass spectrometry of spike s protein revealed how the glycoforms are distributed across the s protein surface. x-ray crystallography and cryo-electron mic ...202032927621
evolution of early sars-cov-2 and cross-coronavirus immunity.the novel coronavirus, sars-coronavirus (cov)-2 (sars-cov-2), has caused over 17 million infections in just a few months, with disease manifestations ranging from largely asymptomatic infection to critically severe disease. the remarkable spread and unpredictable disease outcomes continue to challenge management of this infection. among the hypotheses to explain the heterogeneity of symptoms is the possibility that exposure to other coronaviruses (covs), or overall higher capability to develop i ...202032878931
more than loss of taste and smell: burning watering eyes in coronavirus disease 2019.to evaluate ocular symptoms in european non-hospitalized patients with severe acute respiratory syndrome-related coronavirus 2 (sars-cov-2) and to investigate associations with the demographic data as well as nasal and general physical symptoms.202032835793
a rational design of a multi-epitope vaccine against sars-cov-2 which accounts for the glycan shield of the spike glycoprotein.the ongoing global health crisis caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2), the virus which leads to coronavirus disease 2019 (covid-19) has impacted not only the health of people everywhere, but the economy in nations across the world. while vaccine candidates and therapeutics are currently undergoing clinical trials, there is yet to be a proven effective treatment or cure for covid-19. in this study, we have presented a synergistic computational platform, including ...202032793875
closing the serological gap in the diagnostic testing for covid-19: the value of anti-sars-cov-2 iga antibodies.during coronavirus disease 2019 (covid-19) pandemic, the early diagnosis of patients is a priority. serological assays, in particular immunoglobulin (ig)m and igg anti-severe acute respiratory syndrome coronavirus 2 (sars-cov-2), have today several applications but the interpretation of their results remains an open challenge. given the emerging role of the iga isotype in the covid-19 diagnostics, we aimed to identify the sars-cov-2 iga antibodies in a covid-19 population seronegative for igm. a ...202032790181
results from a survey in healthy blood donors in south eastern italy indicate that we are far away from herd immunity to sars-cov-2.here we present results from a survey on anti-severe acute respiratory syndrome coronavirus 2 (sars-cov-2) seroprevalence in healthy blood donors from a low incidence coronavirus disease 2019 area (apulia region, south eastern italy). among 904 subjects tested, only in nine cases (0.99%) antibodies against sars-cov-2 were demonstrated. all the nine seropositive patients were negative for the research of viral rna by reverse transcription polymerase chain reaction in nasopharyngeal swabs. these d ...202032790086
expert panel consensus statement on the applications and precaution strategies of bronchoscopy in patients with covid-19.severe acute respiratory syndrome coronavirus 2 (sars-cov-2) is a novel coronavirus with higher transmissibility compared with sars coronavirus (sars-cov) and middle east respiratory distress syndrome coronavirus. coronavirus disease 2019 (covid-19) caused by sars-cov-2 is an unprecedented global crisis that has not been experienced, which is still disrupting health systems, economies, and societies around the world by the rapid spread. bronchoscopy plays an important role in diagnosis and thera ...202032769235
engineering human ace2 to optimize binding to the spike protein of sars coronavirus 2.the spike (s) protein of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) binds angiotensin-converting enzyme 2 (ace2) on host cells to initiate entry, and soluble ace2 is a therapeutic candidate that neutralizes infection by acting as a decoy. by using deep mutagenesis, mutations in ace2 that increase s binding are found across the interaction surface, in the asparagine 90-glycosylation motif and at buried sites. the mutational landscape provides a blueprint for understanding the sp ...202032753553
placental sars-cov-2 in a pregnant woman with mild covid-19 disease.the full impact of coronavirus disease 2019 (covid-19) on pregnancy remains uncharacterized. current literature suggests minimal maternal, fetal, and neonatal morbidity and mortality. covid-19 manifestations appear similar between pregnant and nonpregnant women. we present a case of placental severe acute respiratory syndrome coronavirus 2 (sars-cov-2) virus in a woman with mild covid-19 disease, then review the literature. reverse transcriptase polymerase chain reaction was performed to detect ...202032749712
attenuated novel sars coronavirus 2 infection in an allogeneic hematopoietic stem cell transplant patient on ruxolitinib.severe acute respiratory syndrome coronavirus 2 (sars cov-2) has a high death rate in patients with comorbidities or in an immunocompromised state. we report a mild and attenuated sars cov-2 infection in a patient who is 17 months post stem cell transplantation and maintained on the jak/stat inhibitor ruxolitinib, a proposed novel therapy for sars cov-2 pneumonia.202032727701
coinfection of other respiratory pathogens and hiv in covid-19 patients: is there a pattern?the pandemic caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has led to the elaboration of multiple studies to increase knowledge and understanding, hence, having the ability to accomplish an adequate and timely diagnosis and give an optimal treatment according to the patient's condition. the clinical manifestations of covid-19 pose a series of challenges both in understanding and delimiting the disease secondary to the sars-cov-2 infection. this is due to the fact that th ...202032706411
deciphering the role of host genetics in susceptibility to severe covid-19.coronavirus disease-19 (covid-19) describes a set of symptoms that develop following infection by the severe acute respiratory syndrome coronavirus 2 (sars-cov-2). whilst covid-19 disease is most serious in patients with significant co-morbidities, the reason for healthy individuals succumbing to fulminant infection is largely unexplained. in this review, we discuss the most recent findings in terms of clinical features and the host immune response, and suggest candidate immune pathways that may ...202032695122
the global emergence of severe acute respiratory syndrome coronavirus 2 in human.coronaviruses are spherical and enveloped rna viruses that infect diverse vertebrates like mammals, birds and fish. there are five human coronavirus species and all of their origin is linked to animal like bat and rodent. the two coronavirus species, middle east respiratory syndrome-related coronavirus and severe acute respiratory syndrome-related coronavirus are lethal to human. in the second week of december 2019, there was an outbreak of pneumonia of unknown cause in the people associated wit ...202032656303
chronic treatment with hydroxychloroquine and sars-cov-2 infection.hydroxychloroquine sulfate (hcq) is being scrutinized for repositioning in the treatment and prevention of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) infection. this antimalarial drug is also chronically used to treat patients with autoimmune diseases. by analyzing the portuguese anonymized data on private and public based medical prescriptions we have identified all cases chronically receiving hcq for the management of diseases, such as systemic lupus erythematosus, rheumatoid ...202032644224
excavating sars-coronavirus 2 genome for epitope-based subunit vaccine synthesis using immunoinformatics approach.since the outbreak of severe acute respiratory syndrome-coronavirus 2 (sars-cov-2) in december 2019 in china, there has been an upsurge in the number of deaths and infected individuals throughout the world, thereby leading to the world health organization declaration of a pandemic. since no specific therapy is currently available for the same, the present study was aimed to explore the sars-cov-2 genome for the identification of immunogenic regions using immunoinformatics approach. a series of c ...202032643158
rampant c→u hypermutation in the genomes of sars-cov-2 and other coronaviruses: causes and consequences for their short- and long-term evolutionary trajectories.the pandemic of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has motivated an intensive analysis of its molecular epidemiology following its worldwide spread. to understand the early evolutionary events following its emergence, a data set of 985 complete sars-cov-2 sequences was assembled. variants showed a mean of 5.5 to 9.5 nucleotide differences from each other, consistent with a midrange coronavirus substitution rate of 3 × 10-4 substitutions/site/year. almost one-half of seq ...202032581081
report of positive placental swabs for sars-cov-2 in an asymptomatic pregnant woman with covid-19.currently, limited data on maternal and neonatal outcomes of pregnant women with infection and pneumonia related to sars coronavirus 2 (sars-cov-2) are available. our report aims to describe a case of placental swabs positive for the molecular research on severe acute respiratory syndrome coronavirus 2 (sars-cov-2 rna in an asymptomatic woman with positive rhino-pharyngeal swab for sars-cov-2 who underwent an urgent cesarean section in our obstetrics unit. sample collection, processing, and labo ...202032580461
sars-coronavirus-2 replication in vero e6 cells: replication kinetics, rapid adaptation and cytopathology.the sudden emergence of severe acute respiratory syndrome coronavirus 2 (sars-cov-2) at the end of 2019 from the chinese province of hubei and its subsequent pandemic spread highlight the importance of understanding the full molecular details of coronavirus infection and pathogenesis. here, we compared a variety of replication features of sars-cov-2 and sars-cov and analysed the cytopathology caused by the two closely related viruses in the commonly used vero e6 cell line. compared to sars-cov, ...202032568027
sars-cov-2 coinfections: could influenza and the common cold be beneficial?the novel coronavirus severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has rapidly spread around the world, causing serious illness and death and creating a heavy burden on the healthcare systems of many countries. since the virus first emerged in late november 2019, its spread has coincided with peak circulation of several seasonal respiratory viruses, yet some studies have noted limited coinfections between sars-cov-2 and other viruses. we use a mathematical model of viral coinfect ...202032557776
a pathophysiological perspective on covid-19's lethal complication: from viremia to hypersensitivity pneumonitis-like immune dysregulation.severe acute respiratory syndrome coronavirus 2 (sars-cov-2), the coronavirus responsible for our recent coronavirus disease 2019 pandemic, is driving a lung immunopathology that strongly resembles a severe form of hypersensitivity pneumonitis (hp). a review of recent severe acute respiratory syndrome-related coronavirus (sars-cov) and sars-cov-2 medical reports, as well as described characteristics of hp, lead us to postulate a theory for sars-cov-2 severe disease. we propose that the novel sar ...202032537960
the treatment of inflammatory bowel disease during the sars-cov-2 epidemic – practical advices: (a covid–19-pandémia orvosszakmai kérdései)patients with inflammatory bowel disease are more susceptible to severe viral infections requiring hospitalization regardless of treatment. immunosuppressives and biological treatments multiply the chances of opportunistic and lung infections, especially in combination therapy, so due to the new coronavirus (severe acute respiratory syndrome coronavirus-2) epidemic, which primarily causes respiratory disease, it is advisable to use different therapeutic considerations for effective and safe pati ...202032516119
glucovigilance in covid-19.the coronavirus disease (covid-19) pandemic has influenced clinical care in unprecedented ways. there is an urgent need to share best practice in providing diabetes care services in areas affected by covid. this is a brief review for clinicians managing diabetes in low-income countries based on currently available data. the data is rapidly evolving; however, people with diabetes and its related comorbidities have increased risk for severe disease, and prolonged recovery and mortality. this revie ...202032515386
enhanced receptor binding of sars-cov-2 through networks of hydrogen-bonding and hydrophobic interactions.molecular dynamics and free energy simulations have been carried out to elucidate the structural origin of differential protein-protein interactions between the common receptor protein angiotensin converting enzyme 2 (ace2) and the receptor binding domains of the severe acute respiratory syndrome coronavirus 2 (sars-cov-2) [a. e. gorbalenya et al., nat. microbiol. 5, 536-544 (2020)] that causes coronavirus disease 2019 (covid-19) [p. zhou et al., nature 579, 270-273 (2020)] and the sars coronavi ...202032503918
factors determining the diffusion of covid-19 and suggested strategy to prevent future accelerated viral infectivity similar to covid.this study has two goals. the first is to explain the geo-environmental determinants of the accelerated diffusion of covid-19 that is generating a high level of deaths. the second is to suggest a strategy to cope with future epidemic threats similar to covid-19 having an accelerated viral infectivity in society. using data on sample of n = 55 italian province capitals, and data of infected individuals at as of april 7th, 2020, results reveal that the accelerate and vast diffusion of covid-19 in ...202032498152
evidence for mutations in sars-cov-2 italian isolates potentially affecting virus transmission.italy is the first western country suffering heavy severe acute respiratory syndrome coronavirus 2 (sars-cov-2) transmission and disease impact after coronavirus disease-2019 pandemia started in china. even though the presence of mutations on spike glycoprotein and nucleocapsid in italian isolates has been reported, the potential impact of these mutations on viral transmission has not been evaluated. we have compared sars-cov-2 genome sequences from italian patients with virus sequences from chi ...202032492183
first case of focal epilepsy associated with sars-coronavirus-2.a healthy patient presented to klinikum altmühlfranken weißenburg hospital, germany, with two morning attacks of painful muscle spasm in the left upper and lower limbs, without altered consciousness. full examinations, radiological imaging, electroencephalography, lumbar puncture, and autoimmune profile were either normal or not consistent with patient's complaint. subsequent epileptic episodes were observed on admission day and the following days; thus, the patient was diagnosed with focal epil ...202032484990
no evidence of severe acute respiratory syndrome-coronavirus 2 in semen of males recovering from coronavirus disease 2019.to describe detection of severe acute respiratory syndrome (sars)-coronavirus 2 (cov-2) in seminal fluid of patients recovering from coronavirus disease 2019 (covid-19) and to describe the expression profile of angiotensin-converting enzyme 2 (ace2) and transmembrane serine protease 2 (tmprss2) within the testicle.202032482249
protease inhibitors: candidate drugs to inhibit severe acute respiratory syndrome coronavirus 2 replication.the number of patients infected with severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has rapidly increased, although the who declared a pandemic. however, drugs that function against sars-cov-2 have not been established. sars-cov-2 has been suggested to bind angiotensin-converting enzyme 2, the receptor of the sars coronavirus. sars coronavirus and coronavirus 229e, the cause of the common cold, replicate through cell-surface and endosomal pathways using a protease, the type ii tran ...202032448818
multivariate analyses of codon usage of sars-cov-2 and other betacoronaviruses.coronavirus disease 2019 (covid-19) is a global health concern as it continues to spread within china and beyond. the causative agent of this disease, severe acute respiratory syndrome coronavirus 2 (sars-cov-2), belongs to the genus betacoronavirus, which also includes severe acute respiratory syndrome-related coronavirus (sarsr-cov) and middle east respiratory syndrome-related coronavirus (mersr-cov). codon usage of viral genes are believed to be subjected to different selection pressures in d ...202032431949
can unconventional immunomodulatory agents help alleviate covid-19 symptoms and severity?severe acute respiratory syndrome coronavirus 2 (sars coronavirus 2, or sars-cov-2) is the cause of the respiratory infection known as covid-19. from an immunopathological standpoint, coronaviruses such as sars-cov-2 induce increased levels of a variety of t-helper 1 (th1) and inflammatory cytokines and chemokines, including interleukin-1 (il-1), il-6, ccl2 protein, and cxcl10 protein. in the absence of proven antiviral agents or an effective vaccine, substances with immunomodulatory activity ma ...202032404512
targeting the dimerization of the main protease of coronaviruses: a potential broad-spectrum therapeutic strategy.a new coronavirus (cov) caused a pandemic named covid-19, which has become a global health care emergency in the present time. the virus is referred to as sars-cov-2 (severe acute respiratory syndrome-coronavirus-2) and has a genome similar (∼82%) to that of the previously known sars-cov (sars coronavirus). an attractive therapeutic target for covs is the main protease (mpro) or 3-chymotrypsin-like cysteine protease (3clpro), as this enzyme plays a key role in polyprotein processing and is activ ...202032402186
potential drugs targeting early innate immune evasion of sars-coronavirus 2 via 2'-o-methylation of viral rna.the severe acute respiratory syndrome coronavirus-2 (sars-cov-2) causing the covid-19 respiratory disease pandemic utilizes unique 2'-o-methyltransferase (2'-o-mtase) capping machinery to camouflage its rna from innate immune recognition. the nsp16 catalytic subunit of the 2'-o-mtase is unusual in its requirement for a stimulatory subunit (nsp10) to catalyze the ribose 2'-o-methylation of the viral rna cap. here we provide a computational basis for drug repositioning or de novo drug development ...202032397643
asymptomatic cases with sars-cov-2 infection.on 31 march 2020, chinese health authorization announced that numbers of asymptomatic cases with severe acute respiratory syndrome coronavirus 2 (sars-cov-2) infection will be made to the public daily. this was a very important step since different counties have different capacities for the detection of sars-cov-2 infection and control strategy for the coronavirus disease 2019 outbreak. we summarized the characteristics of asymptomatic sars-cov-2 infections and the transmission potential of asym ...202032383171
the anti-hiv drug nelfinavir mesylate (viracept) is a potent inhibitor of cell fusion caused by the sarscov-2 spike (s) glycoprotein warranting further evaluation as an antiviral against covid-19 infections.severe acute respiratory syndrome coronavirus-2 (sars cov-2) is the causative agent of the coronavirus disease-2019 (covid-19) pandemic. coronaviruses enter cells via fusion of the viral envelope with the plasma membrane and/or via fusion of the viral envelope with endosomal membranes after virion endocytosis. the spike (s) glycoprotein is a major determinant of virus infectivity. herein, we show that the transient expression of the sars cov-2 s glycoprotein in vero cells caused extensive cell f ...202032374457
diagnostic accuracy of an automated chemiluminescent immunoassay for anti-sars-cov-2 igm and igg antibodies: an italian experience.a pandemic of coronavirus disease 2019 (covid-19) caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) has been spreading throughout the world. though molecular diagnostic tests are the gold standard for covid-19, serological testing is emerging as a potential surveillance tool, in addition to its complementary role in covid-19 diagnostics. indubitably quantitative serological testing provides greater advantages than qualitative tests but today there is still little known about ...202032330291
hyperglycemia, hydroxychloroquine, and the covid-19 pandemic.coronavirus disease-2019 (covid-19) infection and its severity can be explained by the concentration of glycosylated severe acute respiratory syndrome-coronavirus 2 (sars-cov-2) viral particles in the lung epithelium, the concentration of glycosylated angiotensin-converting enzyme receptor 2 (ace2) in the lung epithelium, and the degree and control of the pulmonary immune response to the sars-cov-2 spike protein at approximately day 8 to 10 after symptom onset, which may be related to both. bind ...202032293710
clinical outcomes in 55 patients with severe acute respiratory syndrome coronavirus 2 who were asymptomatic at hospital admission in shenzhen, china.an epidemic caused by severe acute respiratory syndrome coronavirus 2 (sars-cov-2) infection has spread unexpectedly in wuhan, hubei province, china, since december 2019. there are few reports about asymptomatic contacts of infected patients identified as positive for sars-cov-2 through screening. we studied the epidemiological and clinical outcomes in 55 asymptomatic carriers who were laboratory confirmed to be positive for sars-cov-2 through nucleic acid testing of pharyngeal swab samples. the ...202032179910
first covid-19 infections in the philippines: a case report.the novel coronavirus (covid-19) is responsible for more fatalities than the sars coronavirus, despite being in the initial stage of a global pandemic. the first suspected case in the philippines was investigated on january 22, 2020, and 633 suspected cases were reported as of march 1. we describe the clinical and epidemiological aspects of the first two confirmed covid-19 cases in the philippines, both admitted to the national infectious disease referral hospital in manila.202032308532
severe acute respiratory syndrome coronavirus spike protein counteracts bst2-mediated restriction of virus-like particle release.bst2/tetherin, an interferon-inducible antiviral factor, can block the cellular release of various enveloped viruses. we previously reported that human coronavirus 229e (hcov-229e) infection can alleviate the bst2 tethering of hiv-1 virions by downregulating cell surface bst2, suggesting that coronaviruses are capable of encoding anti-bst2 factors. here we report our new finding that severe acute respiratory syndrome coronavirus (sars-cov) spike (s) glycoprotein, similar to vpu, is capable of an ...201931199522
covid-19 from wellington new zealand.this paper examines the role of bioethics in the successful control of covid-19 in new zealand. after the severe acute respiratory syndrome (sars) coronavirus episode in toronto researchers developed a framework of values and principles to articulate values that were already commonly accepted "in the community of its intended users," to be used to inform decision-making. new zealand subsequently developed its own framework that was embedded in its pandemic influenza plan. these formed the basis ...202033169244
ace2 and ace: structure-based insights into mechanism, regulation and receptor recognition by sars-cov.angiotensin converting enzyme (ace) is well-known for its role in blood pressure regulation via the renin-angiotensin aldosterone system (raas) but also functions in fertility, immunity, haematopoiesis and diseases such as obesity, fibrosis and alzheimer's dementia. like ace, the human homologue ace2 is also involved in blood pressure regulation and cleaves a range of substrates involved in different physiological processes. importantly, it is the functional receptor for severe acute respiratory ...202033146371
the value of the platelet count and platelet indices in differentiation of covid-19 and influenza pneumonia.it is difficult to distinguish coronavirus disease-2019 (covid-19) from other viral respiratory tract infections owing to the similarities in clinical and radiological findings. this study aims to determine the clinical importance of platelet count and platelet indices in the differentiation of covid-19 from influenza and the value of these parameters in the differential diagnosis of covid-19. the medical records of the patients and the electronic patient monitoring system were retrospectively a ...202033135801
dentistry and covid-19 pandemic: operative indications post-lockdown.a new coronavirus, the seventh member of the coronaviridae family, identified as sars-cov-2, spread in late december 2019 in the territory of wuhan in china. cov-2019 can be transmitted directly from person to person by respiratory drops, direct contact and contaminated material. furthermore, 2019-ncov penetrates cells similarly to the sars coronavirus, i.e., through the ace2 receptor. this may promote human-to-human transmission. patients and dental professionals are exposed daily to pathogenic ...202033135082
practice implications for acute ischemic stroke during the covid-19 pandemic for the indian scenario: realistic and achievable recommendations by the society of neurocritical care (sncc), india.covid-19 disease caused by the sars coronavirus has caused significant morbidity and mortality around the world ever since it was first declared as a pandemic by the world health organization (who) in march 2020. acute neurological manifestations of this disease have also started emerging and being recognized around the world and acute ischemic stroke (ais) or thrombotic stroke is becoming one of the major neurological illnesses related to covid-19. the management of ais is time-critical and maj ...202033132556
impact of the coronavirus disease-19 pandemic on acute cardiovascular emergencies in a third level cardiology hospital: a call for action.the consequences of the coronavirus disease (covid)-19 pandemic go beyond the number of cases and deaths attributed to severe acute respiratory syndrome (sars)-coronavirus-2 infection. the overwhelmed health care systems and the strict social containment measures have had an impact on the threshold at which patients seek medical care for diseases other than covid-19, including cardiovascular conditions.202033120401
experience repatriation of citizens from epicentre using commercial flights during covid-19 pandemic.during the covid-19 pandemic, many countries instituted closure of borders from international and local travels. stranded citizens appeal to their governments to embark on citizen repatriation missions. between february and april 2020, the government of malaysia directed repatriation of its citizens from china, iran, italy and indonesia. we describe the preparation and execution of the repatriation mission using chartered commercial aircraft. the mission objectives were to repatriate as many cit ...202033115412
covid-19 spread in saudi arabia: modeling, simulation and analysis.the novel coronavirus severe acute respiratory syndrome (sars)-coronavirus-2 (cov-2) has resulted in an ongoing pandemic and has affected over 200 countries around the world. mathematical epidemic models can be used to predict the course of an epidemic and develop methods for controlling it. as social contact is a key factor in disease spreading, modeling epidemics on contact networks has been increasingly used. in this work, we propose a simulation model for the spread of coronavirus disease 20 ...202033113936
an unusual inflammatory disease linked to sars coronavirus-2 in children: are we prepared enough? 202033107277
mitraclip insertion to hasten recovery from severe covid-19 disease.•coronavirus disease 2019 (covid-19) caused by severe acute respiratory syndrome (sars) coronavirus 2 has affected 188 countries worldwide with a global death toll of over half a million•patients with valvular heart disease are also at an increased risk of adverse outcomes from coronavirus disease-2019•prognosis of patients with the combination of covid 19 and severe valvular heart disease is poor•this is the first reported case of mitraclip insertion in a patient with severe covid 19 infection. ...202033103013
anesthesia for oral surgeries during the covid-19 pandemic.the severe acute respiratory syndrome corona virus 2(sars-cov2) virus replicates in the nasal cavity, nasopharynx, and the oropharynx. during oral surgery, the risk of viral transmission is high during instrumentation in these areas, while performing airway management procedures, the oral surgery itself, and related procedures. during the corona virus disease 2019 (covid-19) pandemic, patients with an oral pathology usually present for emergency procedures. however, patients with oral cancer, be ...202033100656
acute myelitis and sars-cov-2 infection. a new etiology of myelitis?the etiological agent of coronavirus disease-19 (covid-19), sars-coronavirus-2 (sars-cov-2), emerged in wuhan, china, and quickly spread worldwide leading the world health organization (who) to recognize it not only as a pandemic but also as an important thread to public health. beyond respiratory symptoms, new neurological manifestations are being identified such as headache, ageusia, anosmia, encephalitis or acute cerebrovascular disease. here we report the case of an acute transverse myelitis ...202033099361
deep mutagenesis in the study of covid-19: a technical overview for the proteomics community.the spike (s) of sars coronavirus 2 (sars-cov-2) engages angiotensin-converting enzyme 2 (ace2) on a host cell to trigger viral-cell membrane fusion and infection. the extracellular region of ace2 can be administered as a soluble decoy to compete for binding sites on the receptor-binding domain (rbd) of s, but it has only moderate affinity and efficacy. the rbd, which is targeted by neutralizing antibodies, may also change and adapt through mutation as sars-cov-2 becomes endemic, posing challeng ...202033084449
associations between genetically predicted protein levels and covid-19 severity.it is critical to identify potential causal targets for sars-coronavirus 2, which may guide drug repurposing options. we assessed the associations between genetically predicted protein levels and covid-19 severity. leveraging data from the covid-19 host genetics initiative comparing 6,492 hospitalized covid-19 patients and 1,012,809 controls, we identified 18 proteins with genetically predicted levels to be associated with covid-19 severity at a false discovery rate of <0.05, including 12 that s ...202033083826
acute aorto-iliac occlusion in patient with covid-19.coronavirus (sars-coronavirus-2:sars-cov-2) pandemic is affecting almost every country in the world. even if the major symptoms of coronavirus disease-2019 (covid-19) are respiratory, different symptoms at presentation are now recognized. venous thromboembolism has been reported in infected patients and few but increasing cases of arterial thrombosis have been described. we report a case of acute aorto-iliac and lower limb artery occlusions in a patient presenting with severe covid-19 infection. ...202033075454
anti-covid-19 terpenoid from marine sources: a docking, admet and molecular dynamics study.traditional medicines contain natural products (nps) as main ingredient which always give new direction and paths to develop new advanced medicines. in the covid-19 pandemic, nps can be used or can help to find new compound against it. the sars coronavirus-2 main protease (sars cov-2 mpro) enzyme, arbitrate viral replication and transcription, is target here. the study show that, from the electronic features and binding affinity of all the nps with the enzyme, the compounds with higher hydrophob ...202033071352
the use of copper to help prevent transmission of sars-coronavirus and influenza viruses. a general review.the sars-cov-2 is the causative agent of the covid-19 disease, a severe acute respiratory syndrome-coronavirus (sars-cov). its main transmission pathway is through large respiratory droplets, as well as direct and indirect contact. copper in different formats has been used in research and clinical settings to reduce the risk of bacterial and viral contamination. therefore, this review aims to search for evidence about the biocidal properties of copper over the coronaviridae family. a literature ...202033069048
is there a link between bisphenol a (bpa), a key endocrine disruptor, and the risk for sars-cov-2 infection and severe covid-19?infection by the severe acute respiratory syndrome (sars) coronavirus-2 (sars-cov-2) is the causative agent of a new disease (covid-19). the risk of severe covid-19 is increased by certain underlying comorbidities, including asthma, cancer, cardiovascular disease, hypertension, diabetes, and obesity. notably, exposure to hormonally active chemicals called endocrine-disrupting chemicals (edcs) can promote such cardio-metabolic diseases, endocrine-related cancers, and immune system dysregulation a ...202033066495
discovery of ketone-based covalent inhibitors of coronavirus 3cl proteases for the potential therapeutic treatment of covid-19.the novel coronavirus disease covid-19 that emerged in 2019 is caused by the virus sars cov-2 and named for its close genetic similarity to sars cov-1 that caused severe acute respiratory syndrome (sars) in 2002. both sars coronavirus genomes encode two overlapping large polyproteins, which are cleaved at specific sites by a 3c-like cysteine protease (3clpro) in a post-translational processing step that is critical for coronavirus replication. the 3clpro sequences for cov-1 and cov-2 viruses are ...202033054210
high rates of pulmonary artery occlusions in covid-19. a meta-analysis.covid-19 patients are considered at high risk of venous thromboembolism (vte). the real nature of pulmonary artery occlusions (pao) in covid-19 has been questioned, suggesting that it is caused also by in situ thrombi, rather than only by emboli (pe) from peripheral thrombi.202033053206
[initial experience in the attention of patients with covid-19 in a private third-level hospital in buenos aires city].infection with the sars coronavirus type 2 (covid-19) has a variety of presentations, with little data on the evolution of affected patients in argentina. this is a retrospective and observational study of patients with virological confirmation of coronavirus treated during the months of march to may in a private third-level university hospital in buenos aires. o ne hundred and fifty-five adult patients were included, of which 30.3% attended only for a swab; 59.4% were admitted to the hospital a ...202033048785
detected sars-cov-2 in ascitic fluid followed by cryptococcemia: a case report.sars coronavirus-2 (sars-cov-2) detection in different clinical specimens has raised important insights about its pathogenesis, but some details remain to be understood. in that respect, disrupt viral control seen in solid organ transplant patients on chronic immunosuppression can help unveil pathogenic mechanisms and characterize new coronavirus disease-19 (covid-19) immunological and clinical aspects, as well as secondary complications. we herein report a case of sars-cov-2 detection in asciti ...202033047097
the important role of in-situ simulation in preparing surgeons for the covid-19 pandemic.effective training is vital when facing viral outbreaks such as the sars coronavirus 2 (sars-cov-2) outbreak of 2019. the objective of this study was to measure the impact of in-situ simulation on the confidence of the surgical teams of two hospitals in assessing and managing acutely unwell surgical patients who are high-risk or confirmed to have covid-19.202033039335
rapid, sensitive and specific sars coronavirus-2 detection: a multi-center comparison between standard qrt-pcr and crispr based detectr.recent advances in crispr-based diagnostics suggest that detectr, a combination of isothermal reverse transcriptase loop mediated amplification (rt-lamp) and subsequent cas12 bystander nuclease activation by amplicon targeting ribonucleoprotein complexes, could be a faster and cheaper alternative to qrt-pcr without sacrificing sensitivity/specificity. here we compare detectr with qrt-pcr to diagnose covid-19 on 378 patient samples. patient sample dilution assays suggest a higher analytical sensi ...202033038252
sars-cov-2: how safe is it to fly and what can be done to enhance protection?with lockdown restrictions over coronavirus disease 2019 being relaxed, airlines are returning to the skies. published evidence of severe acute respiratory syndrome (sars) coronavirus 2 transmission on aircraft is limited, but in-flight transmission of respiratory infections such as tuberculosis, influenza and sars has been well described. risk factors include proximity to index patients and sitting in aisle seats. personal protection on aircraft could be enhanced by always wearing a well-fittin ...202033031556
[sars coronavirus-2 vaccines: options and state-of-the-art].since the first reports in mid-january of a serious new viral respiratory infection, covid-19, and the identification of sars-cov-2 as the cause of this disease, researchers work intensely on developing a vaccine that can protect individuals against serious disease and that can limit the spread of the virus. vaccine developers are using a range of platform technologies to do this, each with advantages and disadvantages. close to 30 vaccines are now in clinical testing. the first results are enco ...202033030329
sars-cov-2 infection during pregnancy, a risk factor for eclampsia or neurological manifestations of covid-19? case report.there are no published cases of tonic-clonic seizures and posterior bilateral blindness during pregnancy and severe acute respiratory syndrome (sars) coronavirus (cov) 2 (sars-cov-2) infection. we do not just face new and unknown manifestations, but also how different patient groups are affected by sars-cov-2 infection, such as pregnant women. coronavirus disease 2019 (covid-19), preeclampsia, eclampsia and posterior reversible leukoencephalopathy share endothelium damage and similar pathophysio ...202033023500
reply to letter to the editor: presence of sars-coronavirus-2 in the ileal mucosa: another evidence for infection of gi tract by this virus (gastro-d-20-01382). 202033022278
covid-19: between past and present.since the who declared coronavirus disease 2019 (covid-19) as a pandemic, huge efforts were made to understand the disease, its pathogenesis, and treatment. covid-19 is caused by severe acute respiratory syndrome (sars) coronavirus-2 (sars-cov2), which is closely related to sars-associated coronavirus (sars-cov). this article attempts to provide a timely and comprehensive review of the coronaviruses over the years, and the epidemics they caused in this century with a focus on the current pandemi ...202033017280
in silico molecular docking: evaluation of coumarin based derivatives against sars-cov-2.the unique anthropological coronavirus which has been titled as sars-cov-2 was originally arisen in late 2019 in wuhan, china affecting respiratory infection named as covid-19. coronavirus is disturbing human life in an exceptional method and has converted a public health global crisis. natural products are ahead consideration due to the huge beneficial window and effective anti-inflammatory, immunomodulatory, antioxidant and antiviral possessions. consequently, the present study was intended to ...202033008777
Displaying items 3301 - 3400 of 3881