| development and trifoliin a-binding ability of the capsule of rhizobium trifolii. | the age-dependent lectin-binding ability of rhizobium trifolii 0403 capsular polysaccharide (cps) was examined by following the development of the capsule and its ability to interact with the white clover lectin trifoliin a. bacteria grown on agar plates for 3, 5, 7, 14, and 21 days were examined by electron microscopy and immunofluorescence microscopy with antibodies prepared against either r. trifolii 0403 cps or trifoliin a after pretreatment with the lectin. the capsule began to develop at o ... | 1984 | 6376470 |
| preservation of rhizobium viability and symbiotic infectivity by suspension in water. | three rhizobium japonicum strains and two slow-growing cowpea-type rhizobium strains were found to remain viable and able to rapidly modulate their respective hosts after being stored in purified water at ambient temperatures for periods of 1 year and longer. three fast-growing rhizobium species did not remain viable under the same water storage conditions. after dilution of slow-growing rhizobium strains with water to 10(3) to 10(5) cells ml-1, the bacteria multiplied until the viable cell coun ... | 1984 | 6378090 |
| some properties of the nickel-containing hydrogenase of chemolithotrophically grown rhizobium japonicum. | the uptake hydrogenase of chemolithotrophically grown rhizobium japonicum was purified to apparent homogeneity with a final specific activity of 69 mumol of h2 oxidized per min per mg of protein. the procedure included triton extraction of broken membranes and deae-cellulose and sephacryl s-200 chromatographies. the purified protein contained two polypeptides separable only by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. they comigrated on native polyacrylamide gels and sucrose den ... | 1984 | 6384183 |
| coordinate expression of hydrogenase and ribulose bisphosphate carboxylase in rhizobium japonicum hupc mutants. | in contrast to the wild type, h2 uptake-constitutive mutants of rhizobium japonicum expressed both hydrogenase and ribulose bisphosphate carboxylase activities when grown heterotrophically. however, as bacteroids from soybean root nodules, the h2 uptake-constitutive mutants, like the wild type, did not express ribulose bisphosphate carboxylase activity. | 1984 | 6384199 |
| mobilization of a sym plasmid from a fast-growing cowpea rhizobium strain. | a large sym plasmid from a fast-growing cowpea rhizobium species was made mobilizable by cointegration with plasmid psup1011, which carries the orit region of rp4. this mobilizable sym plasmid was transferred to a number of rhizobium strains, in which nodulation and nitrogen fixation functions for symbiosis with plants of the cowpea group were expressed. | 1984 | 6384201 |
| [degradation and utilization of 2,4-dioxohexahydro-1,3,5-triazine (dht) by soil microorganisms]. | the biodegradation and utilization of the antiphytoviral substance 2,4-dioxohexahydro-1,3,5-triazine (dht) by soil microorganisms was investigated. mixed cultures of microorganisms deriving from different soils diminish in nutrient broth the content of dht with increasing duration of culture. microorganisms from an egyptian garden soil fully degrade 10(-3) mol/1 dht in a culture without additional aeration within 28 days. also in deficient media the mixed microorganisms reduce the amount of dht, ... | 1984 | 6388190 |
| specific phases of root hair attachment in the rhizobium trifolii-clover symbiosis. | the time course and orientation of attachment of rhizobium trifolii 0403 to white clover root hairs was examined in slide cultures by light and electron microscopy. inocula were grown for 5 days on defined biii agar medium and represented the large subpopulation of fully encapsulated single cells which uniformly bind the clover lectin trifoliin a. when 10(7) cells or more were added per seedling, bacteria attached within minutes, forming randomly oriented clumps at the root hair tips. several ho ... | 1984 | 6393874 |
| reduction of nad+ by uptake hydrogenase from groundnut bacteroids. | | 1984 | 6394471 |
| natural variation in symbiotic nitrogen-fixing rhizobium and frankia spp. | a description is given of the natural variation in nitrogen-fixing rhizobium and frankia spp. strains and the ability to form root nodules on compatible host plants. arguments are given for the hypothesis that co-evolution has taken place through mutual interaction of host plants and indigenous rhizobium and frankia populations in the soil leading to most efficient symbiotic associations. the significance of root nodules as selective enrichment cultures of particular strains in natural and culti ... | 1984 | 6397130 |
| hydrogen oxidation and nitrogen fixation in rhizobia, with special attention focused on strain ors 571. | in this survey we describe the influence of hydrogen oxidation on the physiology of rhizobium ors 571. the presence of hydrogen is required for the synthesis of hydrogenase. carbon substrates do not repress the synthesis of hydrogenase. the respiratory system contains cytrochromes of the b- and c-type. cytochrome alpha 600 is present after growth at high oxygen tensions. the nature of the terminal oxidases functioning at low oxygen tensions has not been established yet----h+/o values with endoge ... | 1984 | 6397131 |
| special bacterial polysaccharides and polysaccharases. | alcaligenes faecalis var. myxogenes 10c3, which we isolated from soil, produces a water-soluble and an insoluble extracellular polysaccharide. the former (succinoglycan) is composed of glucose, galactose, pyruvic acid and succinic acid (molar proportions 7:1:1:1) with (beta 1-3)-, (beta 1-4)- and (beta 1-6)-glucosidic linkages. the latter (curdlan) is composed entirely of (beta 1-3)-linked d-glucose and forms a resilient firm gel when heated in suspension. the organism also produces extracellula ... | 1983 | 6400487 |
| succinate transport by free-living forms of rhizobium japonicum. | we have demonstrated that the transport of succinate into the cells of rhizobium japonicum strains usda 110 and usda 217 is severely inhibited by cyanide, azide, and 2,4-dinitrophenol, but not by arsenate. these results suggest an active mechanism of transport that is dependent on an energized membrane, but does not directly utilize atp. the apparent km for succinate was 3.8 microm for strain usda 110 and 1.8 microm for strain usda 217; maximal transport velocities were 1.5 and 3.3 nmol of succi ... | 1983 | 6402487 |
| transfer of nitrate reductase genes of the cyanobacterium nostoc muscorum into rhizobium japonicum. | transformation of rhizobium japonicum cb1809 was studied using dna from the cyanobacterium nostoc muscorum atcc 27893. a spontaneous nitrate reductase deficient (nar-) mutant (nr-6) of r. japonicum cb1809 was isolated with a frequency of 8.4 x 10(-7). streptomycin (sm) and neomycin (neo) resistance markers were introduced into strain nr-6, and the resulting strain was designated nr-6 smr neor. experiments with cyanobacterial dna and live cells of strain nr-6 smr neor indicated transformation of ... | 1983 | 6415231 |
| a rhizobium meliloti symbiotic regulatory gene. | we have characterized a rhizobium meliloti regulatory gene required for the expression of two closely linked symbiotic operons, the nitrogenase operon (nifhdk genes) and the "p2" operon. this regulatory gene maps to a 1.8 kb region located 5.5 kb upstream of the nifhdk operon. the regulatory gene is required for the accumulation of nifhdk and p2 mrna and for the derepression of an r. meliloti nifh-lacz fusion plasmid during symbiotic growth. the nifh and p2 promoters can be activated in free-liv ... | 1984 | 6423287 |
| mannityl opine analogs allow isolation of catabolic pathway regulatory mutants. | five virulent agrobacterium spp. strains that can catabolize the mannityl opines mannopine (mop), mannopinic acid ( moa ), and agropinic acid (aga) were tested for their ability to grow on analogs of these compounds. analogs containing alternative amino acids replacing glutamic acid or glutamine were generally refused by these bacteria, but mutants were obtained that catabolized the entire family of analogs. in the case of strain c58c1 (pri 8196), we demonstrated that typical mutants were consti ... | 1984 | 6427182 |
| lactose inhibits the growth of rhizobium meliloti cells that contain an actively expressed escherichia coli lactose operon. | expression of the escherichia coli lactose operon in rhizobium meliloti 104a14 made the cells sensitive to the addition of the beta-galactosides lactose, phenyl-beta-d-galactoside, and lactobionic acid. growth stopped when the beta-galactoside was added and viability decreased modestly during the next few hours, but little cell lysis was observed and the cells appeared normal. protein synthesis was not inhibited. growth was inhibited only when beta-galactosidase expression was greater than 160 u ... | 1984 | 6427192 |
| comparative study of the dna-binding hu-type proteins from slow growing and fast growing strains of rhizobiaceae. | the dna-binding hu-type proteins have been isolated from two very different strains of rhizobiaceae : agrobacterium tumefaciens and rhizobium japonicum. these proteins have been called hat and hrj respectively. their electrophoretic mobility on polyacrylamide gel, amino acid composition and crossed immunoreactivity have been compared to that of the homologous protein isolated from rhizobium meliloti: the protein hrm . the proteins hat and hrm show close similarities whereas the protein hrj diffe ... | 1984 | 6428409 |
| nickel is a component of hydrogenase in rhizobium japonicum. | the derepression of h2-oxidizing activity in free-living rhizobium japonicum does not require the addition of exogenous metal to the derepression media. however, the addition of edta (6 microm) inhibited derepression of h2 uptake activity by 80%. the addition of 5 microm nickel to the derepression medium overcame the edta inhibition. the addition of 5 microm cu or zn also relieved edta inhibition, but to a much lesser extent; 5 microm fe, co, mg, or mn did not. the kinetics of induction and magn ... | 1984 | 6429119 |
| application of immunodiffusion to the identification of rhizobium meliloti strains competing for nodulation on medicago sativa. | the immunodiffusion technique was successfully used to unambiguously recognize four strains of rhizobium meliloti in a study of competition for nodulation with medicago sativa cv. apollo inoculated with two-, three- and four-strain mixtures. the serological reactions of all r. meliloti strains revealed no significant changes following plant passage indicating that the antigens involved in immunodiffusion were stable. r. meliloti 102f70 formed 50% or more of the nodules on m. sativa inoculated wi ... | 1984 | 6431903 |
| role of resistance to starvation in bacterial survival in sewage and lake water. | a study was conducted to determine the significance of starvation resistance to the ability of a species to survive in sewage and lake water. tests were conducted for periods of up to 14 days. rhizobium meliloti and one fluorescent and one nonfluorescent strain of pseudomonas were resistant to starvation because their population sizes did not fall appreciably in buffer and sterile lake water, and the first two maintained high numbers after being added to sterile sewage. cell densities of these b ... | 1984 | 6435525 |
| nature and location of amide-bound (r)-3-acyloxyacyl groups in lipid a of lipopolysaccharides from various gram-negative bacteria. | it has previously been demonstrated [eur. j. biochem. 124, 191-198 (1982) and 137, 15-22 (1983)] that the lipid a component of salmonella and proteus lipopolysaccharides contains amide-linked (r)-3-acyloxyacyl residues. in the present study lipid a of other gram-negative bacteria was analysed for the presence of amide-bound 3-acyloxyacyl residues. it was found that such residues are constituents of all lipid a tested (agrobacterium tumefaciens, chromobacterium violaceum, pseudomonas aeruginosa, ... | 1984 | 6437812 |
| agrocins and the biological control of crown gall. | agrocin 84 is a plasmid-encoded, fraudulent adenine nucleotide antibiotic responsible for the preventative biological control of the plant cancer, crown gall. it has bacteriocin-like selectivity which is dependent on a ti-plasmid-encoded permease in pathogenic agrobacteria. other nucleotide agrocins have been described and partially characterized; more may be confidently predicted. | 1984 | 6444087 |
| [harmfulness of bacterial gall of grape and the species makeup of its causative agent in moldavia]. | | 1980 | 6445036 |
| lipid-bound sugars in rhizobium meliloti. | | 1980 | 6447479 |
| heterozygosis of phage 16-3 of rhizobium meliloti: moderate level of mismatch repair or gene conversion. | analysis of clear/turbid mottled (heterozygotic plaques) of rhizobium meliloti temperate phage 16-3 indicates that the efficiency of repair at three sites (ti3, ti4, and ti5) in the c cistron is 2 to 20-fold less than that observed in e. coli phage lambda. in agreement with this conclusion, heterozygotic plaques were observed at similar frequency in crosses where point and small deletion mutants were combined, suggesting that in rhizobium, dna molecules with short single-stranded loops can escap ... | 1980 | 6450309 |
| introduction of bacteriophage mu into bacteria of various genera and intergeneric gene transfer by rp4::mu. | the host range of coliphage mu was greatly expanded to various genera of gram-negative bacteria by using the hybrid plasmic rp4::mu cts, which is temperature sensitive and which confers resistance to ampicillin, kanamycin, and tetracycline. these drug resistance genes were transferred from escherichia coli to members of the general klebsiella, enterobacter, citrobacter, salmonella, proteus, erwinia, serratia, alcaligenes, agrobacterium, rhizobium, pseudomonas, acetobacter, and bacillus. mu phage ... | 1981 | 6450749 |
| relationship of siderophore-mediated iron assimilation to virulence in crown gall disease. | three classes of mutants defective in the biosynthesis of the siderophore agrobactin were isolated from agrobacterium tumefaciens a217 after n-methyl-n'-nitro-n-nitrosoguanidine mutagenesis. class i mutants produced uniquely the catechol 2,3-dihydroxybenzoic acid, whereas classes ii and iii produced no detectable catechol. class ii differed from class iii mutants in that exogenous 2,3-dihydroxybenzoic acid was utilized only by the former to synthesize agrobactin. growth of strains b6 and a217, u ... | 1981 | 6455414 |
| structure and synthesis of histopine, a histidine derivative produced by crown gall tumors. | histopine, an unusual amino acid derivative of histidine isolated from crown gall tumors of sunflowers (helianthus annus) inoculated with agrobacterium tumefaciens strain b6, was previously assigned the gross structure n-(1-carboxyethyl) histidine (2). a diastereomeric mixture containing histopine (2a and 2b) was readily prepared by reductive alkylation of (s)-histidine (1) with pyruvic acid and sodium cyanoborohydride. the individual diastereomers were prepared by reaction of (s)-histidine with ... | 1984 | 6466642 |
| right 25 bp terminus sequence of the nopaline t-dna is essential for and determines direction of dna transfer from agrobacterium to the plant genome. | we have determined which sequences at the right border of the t-dna region of the nopaline c58 ti plasmid are required for transfer and/or integration of the t-dna into the plant cell genome. the results indicate that the 25 bp t-dna terminus repeat sequence, tgacaggatatattggcgggtaaac, is directly responsible for t-dna transfer; furthermore, this sequence is directional in its mode of action. a transfer-negative nononcogenic ti plasmid derivative, pgv3852, was constructed, in which 3 kb covering ... | 1984 | 6467373 |
| mapping of promoter-proximal regions by in vitro transcription of two agrobacterium tumefaciens ti-plasmids. | transcription initiation sites were mapped on both the octopine pti ach5 and the nopaline pti c58 plasmids of agrobacterium tumefaciens. transcription ternary complexes were subjected to electrophoresis on agarose gels, prior and/or subsequent to restriction endonuclease digestion of the dna template, evidenced by autoradiography and located on the restriction maps of the two tumor-inducing plasmids. a. tumefaciens rna polymerase promptly recognizes and starts transcription on a few sequences wh ... | 1984 | 6472259 |
| rhizobia are attracted to localized sites on legume roots. | clouds of rhizobium meliloti were attracted to localized sites on the surface of the infectible region of alfalfa roots. this behavior, which required active motility and chemotaxis, was not species specific. correlation between the behavior of various mutants and their competitiveness for nodulation suggests that cloud formation has a role in the infection of host legume roots by rhizobia. | 1984 | 6476827 |
| bacteriophage that can distinguish between wild-type rhizobium japonicum and a non-nodulating mutant. | a bacteriophage (phage tn1) that lyses rhizobium japonicum 3i1b110 was isolated from tennessee soil. structurally, this phage resembles the escherichia coli phage t4, having an icosahedral head (47 by 60 nm) and a contractile tail (17 by 80 nm). an interesting feature of this phage is that it lyses all of the symbiotic defective mutants derived from r. japonicum 3i1b110 that were tested, except one, mutant strain hs123. mutant strain hs123 is a non-nodulating mutant that is defective in attachme ... | 1984 | 6476831 |
| enhanced 3-methoxytyramine levels in crown gall tumours and other undifferentiated plant tissues. | an amine, after dansylation, has been isolated from nicotiana tabacum crown gall tumours for the first time and characterized as 4-hydroxy-3-methoxy-beta-phenylethylamine (3-methoxytyramine). the compound cannot be detected in differentiated n. tabacum tissues but appears in the corresponding callus controls. its concentration is further increased 5-42-fold when n. tabacum is transformed with all strains of agrobacterium tumefaciens so far tested. | 1984 | 6477503 |
| monoclonal antibodies to rhizobium meliloti and surface mutants insensitive to them. | monoclonal antibodies were produced to the surface of the symbiotic nitrogen-fixing bacterium rhizobium meliloti. bacterial lysis in the presence of complement or cycles of agglutination and growth were used to select mutants no longer recognized by the antibodies. the mutants were used to produce new antibodies with different specificities. several mutants had altered sensitivity to one or more bacteriophages. r. meliloti strains from different sources had distinct patterns of sensitivity to mo ... | 1984 | 6480561 |
| crown gall transformation of tobacco callus cells by cocultivation with agrobacterium tumefaciens. | incubation of cells from squashed tobacco callus tissue with virulent agrobacterium tumefaciens leads to the production of cells displaying a crown gall phenotype. | 1984 | 6487297 |
| phosphorylation of chromosomal proteins during the transition of a normal plant cell to a crown gall tumor cell. | the transition of a wounded plant cell to a crown gall tumor cell, which is induced by infection with virulent agrobacterium tumefaciens cells, is accompanied by enhancement of chromatin-bound protein phosphokinase activity. various protein kinases with different substrate specificity (viz. histone, phosvitin, casein phosphokinases) are distinctly more active in tumor cells. the phosphate is introduced into seryl and threonyl residues of proteins and is stable under standard assay conditions, th ... | 1984 | 6489456 |
| division of peribacteroid membranes in root nodules of white clover. | division of peribacteroid membranes in the cytoplasm of root nodules of white clover was found, from a study of serial thin sections prepared for electron microscopy, to accompany division of the bacteroids. it was also observed that the peribacteroid membranes appeared to have adhered to various sites on the surface of the bacteroid envelope outer membranes. wherever peribacteroid membranes were constricted as though undergoing division in the region of the cleft formed by partial division of t ... | 1984 | 6490745 |
| a functional map of the nopaline synthase promoter. | this paper describes the first functional map of a promoter expressed from the plant chromosome. we have constructed a series of overlapping deletion mutants within the region upstream of the ti-plasmid encoded nopaline synthase (nos) gene. by monitoring nos expression in tumour tissue we have inferred a functional map of the nos promoter. the maximum length of sequence upstream of the transcription initiation point required to express wild type levels of nopaline synthase is 88 bp. within this ... | 1984 | 6493982 |
| adsorption of tumorigenic agrobacterium tumefaciens cells to susceptible potato tuber tissues. | cells of tumorigenic agrobacterium tumefaciens strain b6 were labeled with [35s]methionine and used to estimate bacterial adsorption to potato tuber discs. after 10 min at ph 7.2, about 5 x 10(5) bacteria adsorb to each 9.0-mm disc. lengthening the incubation period to 90 min increases adsorption to about 11 x 10(5) bacteria per disc. bacterial adsorption is reduced under both alkaline and acid ph conditions and increases 2.3-fold if the number of bacterial cells in the inoculum is doubled. adso ... | 1984 | 6498639 |
| bacteriophage-induced acidic heteropolysaccharide lyases that convert the acidic heteropolysaccharides of rhizobium trifolii into oligosaccharide units. | acidic heteropolysaccharide lyases from lysates of phages 4s and by15 grown on rhizobium trifolii 4s and r. trifolii 0403, respectively, were used to analyze the capsular and excreted extracellular acidic polysaccharides of r. trifolii 0403. the activities of the enzymes as measured by viscometry were enhanced by the addition of calcium. the oligosaccharide products obtained by depolymerase digestion of the polysaccharides isolated from cells grown on agar plates for 5 days were isolated by gel ... | 1984 | 6501212 |
| stimulation of clover root hair infection by lectin-binding oligosaccharides from the capsular and extracellular polysaccharides of rhizobium trifolii. | a polysaccharide depolymerase isolated from the phage lysate of rhizobium trifolii 4s was used to fragment capsular polysaccharides (cps) and extracellular polysaccharides (eps) of r. trifolii 0403 into oligosaccharides. these products were analyzed for clover lectin (trifoliin a)-binding ability, effect on infection of white clover root hairs, and changes in glycosyl and noncarbohydrate composition with culture age. the oligosaccharides from cps of cultures grown on agar plates for 3, 5, and 7 ... | 1984 | 6501213 |
| glucose-6-phosphate dehydrogenase deficiency in pleiotropic carbohydrate-negative mutant strains of rhizobium meliloti. | several mutant strains of rhizobium meliloti isolated after nitrosoguanidine mutagenesis were selected as unable to grow on mannose. some of them also failed to grow on glucose, fructose, ribose, and xylose but grew on l-arabinose, galactose, and many other carbon sources. biochemical analysis demonstrated that the mutants lacked nad- and nadp-linked glucose-6-phosphate dehydrogenase activities that reside on a single enzyme species. one such mutant was found to accumulate glucose-6-phosphate, a ... | 1984 | 6501224 |
| plant-inducible virulence promoter of the agrobacterium tumefaciens ti plasmid. | agrobacterium tumefaciens is the causative agent of crown gall, a plant tumour that can arise on most species of dicotyledonous plants. the tumour-inducing capacity of the bacterium requires the presence of a large plasmid, designated the ti plasmid, which itself contains two regions essential for tumour formation-the t(umour)-region and the vir(ulence)-region. the t-region is transferred to plant cells by an unknown mechanism, and becomes stably integrated into the plant genome. the vir-region ... | 1984 | 6504164 |
| [optimization of liquid scintillation counting by using multichannel pulse-height analyzer]. | the method for determining optimum conditions of a liquid scintillation counter (lsc) for low-level counting of tritium was studied. to compare the lower limit of detection, the figure of merit em/square root b was used. th measurement system is a lsc connected with a multichannel pulse-height analyzer (mca). both of tritium spectra and background spectra were searched for the condition that maximizes the figure of merit. the optimum condition obtained by using the mca was fitted for a single ch ... | 1984 | 6505306 |
| detection of tumor-inducing plasmid dna sequence in agrobacterium tumefaciens by dna-dna hybridization. | absence of plasmid dna sequences in non-tumorigenic (crown gall tumor) strains of agrobacterium tumefaciens was confirmed by dna-dna hybridization between purified tumor-inducing (ti) plasmid dnas isolated from the progenitor tumorigenic strains and 3h-labeled whole cell dnas from tumorigenic strains and their non-tumorigenic derivatives. the genes controlling tumorigenicity in plant and utilizability of nopaline as their sole nitrogen source were confirmed to locate on ti-plasmids. | 1984 | 6505307 |
| dna sequence of the rhizobium leguminosarum nodulation genes nodab and c required for root hair curling. | a 3.2kb fragment of dna cloned from rhizobium leguminosarum has been shown to contain the genes necessary for the induction of root hair curling, the first observed step in the infection of leguminous plants by r. leguminosarum. the dna sequence of this region has been determined and three open reading frames were identified: genes corresponding to these open reading frames have been called noda, nodb and nodc and are transcribed in that order. mutations within the nodc gene completely blocked r ... | 1984 | 6514582 |
| opportunistic peritonitis in continuous ambulatory peritoneal dialysis. | | 1984 | 6518678 |
| antioxidant defence system of erythrocytes in relation to agrobacterium tumefaciens lipopolysaccharide administration in mice. | | 1984 | 6519684 |
| [growth rate of antibiotic-producing gram-negative bacteria on liquid nutrient media]. | glycerol-yeast medium no. 3 may be used as a seed medium in screening of antibiotic-producing strains among acetobacter, gluconobacter, chromobacterium, agrobacterium, and other genera. the medium is transparent. it provides visual instrumental control of the growth rate of the seed material and estimation of biomass augmentation. the period of the exponential phase growth of the strains tested on medium no. 3 was 2-8 hours. when no growth on medium no. 3 is observed media nos. 1 and 2 can be us ... | 1984 | 6524878 |
| role of rhizobitoxine in protecting soybean roots from macrophomina phaseolina infection. | bacterization of soybean seeds or roots with rhizobium japonicum significantly reduced charcoal rot disease caused by macrophomina phaseolina . rhizobium japonicum inhibited the growth of m. phaseolina on both liquid and solid media. replacement of nutrient medium with culture filtrate of r. japonicum significantly reduced mycelial growth of m. phaseolina . whole culture extracts of r. japonicum yielded a toxic substance which was identified as rhizobitoxine after chromatographic, ultraviolet, a ... | 1984 | 6539157 |
| mode of infection, nodulation specificity, and indigenous plasmids of 11 fast-growing rhizobium japonicum strains. | eleven fast-growing strains of rhizobium japonicum were characterized with respect to indigenous plasmids and abilities to infect (inf+) and nodulate (nod+) cowpea, siratro, wild soybean, and three commercial cultivars of soybean. all strains caused infection via infection threads in root hairs and consistently nodulated cowpea, siratro, and wild soybean in growth pouches. interactions with commercial cultivars of soybean were strikingly strain specific. some combinations were nod-, and infectio ... | 1984 | 6542099 |
| studies on the inhibition of pancreatic and microbial lipases by soybean proteins. | a protein, molecular weight 70,000 that inhibits pancreatic lipase has been isolated from soybean seeds. inhibition is not reversed by colipase unless bile salts are added to the assay system. inhibitory properties of the purified protein are very similar to those of serum albumin or alpha-lactoglobulin. it has been confirmed that, during intestinal lipolysis of dietary fats, bile salts play an essential role for the activation of the lipase-colipase system in the presence of inhibitory proteins ... | 1984 | 6542933 |
| heat curing of a sym plasmid in a fast-growing rhizobium sp. that is able to nodulate legumes and the nonlegume parasponia sp. | genes involved in nodulation of both legumes and the nonlegume parasponia sp., as well as nitrogenase genes, reside on a large plasmid in a fast-growing rhizobium sp. from lablab purpureus. this plasmid can be cured by incubation at elevated temperatures and can be mobilized by the p1 group plasmid rp1::tn501. | 1983 | 6571729 |
| ultrastructural analysis of ineffective alfalfa nodules formed by nif::tn5 mutants of rhizobium meliloti. | ineffective alfalfa nodules formed by rhizobium meliloti nif::tn5 mutants were examined by light and electron microscopy. r. meliloti nifh::tn5 mutants formed nodules that were similar in structure to wild-type nodules except that nifh- bacteroids accumulated a compact, electron-dense body. in contrast to nodules induced by wild type and nifh mutants, nifdk- r. meliloti mutants induced nodules which contained numerous starch grains and prematurely senescent bacteroids. in addition, meristematic ... | 1983 | 6575011 |
| in vitro expression of nitrogenase activity in parasponia-rhizobium strain anu 289. | rhizobium strain anu 289 derepressed nitrogenase activity under defined in vitro conditions. acetylene reduction was detected both in agar and liquid stationary culture. the strain is capable of nitrogen-fixing nodulation of legumes [such as siratro (macroptilium atropurpureum urb] as well as the non-legumes parasponia andersonii and p. rugosa. nitrogenase activity as high as 40-70 nmol c2h4 per mg protein after 7 days of incubation was detected. strain anu 289 was similar to rhizobium strains 3 ... | 1983 | 6575732 |
| a functional map of the nopaline catabolism genes on the ti plasmid of agrobacterium tumefaciens c58. | the nopaline catabolism (noc) genes are located in a 14.4 kb region on the ptic58 plasmid of a. tumefaciens c58. these genes permit the bacterium to grow on nopaline n2-(1,3-dicarboxylpropyl) arginine, a substrate produced in plant tumors initiated by strain c58. the functions of the noc genes include the use of nopaline and l-ornithine as sole carbon and nitrogen sources. using tn5 insertional mutants, we have identified and mapped the positions of the genes that are responsible for nopaline ca ... | 1983 | 6577260 |
| nucleotide sequence of the tms genes of the ptia6nc octopine ti plasmid: two gene products involved in plant tumorigenesis. | the nucleotide sequence of the tumor morphology locus, tms, from ptia6nc has been determined. the sequence analysis indicates that each of two polyadenylylated transcripts encoded by this locus contains an open reading frame; the predicted transcript 1 gene product has a molecular size of 83,769 daltons, and the predicted transcript 2 gene product, of 49,588 daltons. the precise start and stop positions of the transcript 2 rna have been mapped with s1 nuclease. several insertion mutations have b ... | 1984 | 6584906 |
| extracellular polysaccharide composition, ex planta nitrogenase activity, and dna homology in rhizobium japonicum. | the composition of the major acidic extracellular polysaccharide (eps) of 25 strains of rhizobium japonicum was determined. eight strains synthesized an acidic eps containing rhamnose and 4-o- methylglucuronic acid and were closely related according to dna homology. these same strains also expressed high levels of ex planta nitrogenase activity. sixteen strains produced an acidic eps containing glucose, mannose, galacturonic acid, and galactose and were also related by dna homology. these strain ... | 1984 | 6586714 |
| the nifh and nifdk promoter regions from rhizobium japonicum share structural homologies with each other and with nitrogen-regulated promoters from other organisms. | in several species of rhizobium the three genes which encode the nitrogenase complex are separated into two operons, nifh and nifdk. we have mapped the transcriptional promoter sites for these two operons from r. japonicum usda strain 110 by s1 protection analyses using bacterial rna isolated from soybean nodules. transcription of the nifdk operon is initiated at a site located 46 nucleotides upstream of the proposed translation initiation codon. nifh transcription initiates predominantly at a s ... | 1984 | 6588133 |
| electron allocation to h+ and n2 by nitrogenase in rhizobium leguminosarum bacteroids. | electron allocation to h+ and n2 by nitrogenase in intact rhizobium leguminosarum bacteroids has been studied. nitrogenase activity was measured in intact cells with succinate and oxygen substrates. when whole cell nitrogenase activity was inhibited by oxygen-limitation or by the addition of the h+-conducting ionophore carbonylcyanide m-chlorophenylhydrazone, both inducing a low intracellular atp/adp ratio, the electron allocation to h+ was favoured over that to n2. when whole cell nitrogenase a ... | 1984 | 6589160 |
| a general method for the transfer of cloned genes to plant cells. | this paper describes a method for the transfer to plant cells of any cloned gene, regardless of its termini or internal restriction enzyme cleavage sites. a broad host-range intermediate vector, pgv1117, was constructed containing hindiii-23, a right-end t-region fragment of the nopaline plasmid ptic58. using in vivo protection by ecori methylase and ecori linker ligation, a fragment of rabbit chromosomal dna, carrying the beta-globin gene, was inserted into plasmid pgv1117. following transmissi ... | 1983 | 6628995 |
| polysaccharide production by certain antibiotic resistant mutants of rhizobium sp (cowpea miscellany). | | 1983 | 6629842 |
| identification of a rhizobium trifolii plasmid coding for nitrogen fixation and nodulation genes and its interaction with pjb5ji, a rhizobium leguminosarum plasmid. | rhizobium trifolii t37 contains at least three plasmids with sizes of greater than 250 megadaltons. southern blots of agarose gels of these plasmids probed with rhizobium meliloti nif dna indicated that the smallest plasmid, prtt37a, contains the nif genes. transfer of the rhizobium leguminosarum plasmid pjb5ji, which codes for pea nodulation and the nif genes and is genetically marked with tn5, into r. trifolii t37 generated transconjugants containing a variety of plasmid profiles. the plasmid ... | 1983 | 6630147 |
| initial stages in the morphogenesis of nitrogen-fixing stem nodules of sesbania rostrata. | morphogenesis of stem nodules in sesbania rostrata was studied over a period of 6 days after inoculation with an appropriate species of rhizobium. nodulation sites were initially slightly raised, circular areas 0.3 to 0.6 mm in diameter and 4 to 5 mm apart in vertical rows along the length of the stem. each site was underlaid by an adventitious root primordium. a site became susceptible to infection by a specific rhizobium sp. when the root primordium broke through the epidermis, leaving a fissu ... | 1983 | 6630154 |
| high-frequency induction of nodulation and nitrogen fixation mutants of rhizobium japonicum. | more than 50 symbiotic mutants of rhizobium japonicum were isolated by purported plasmid-curing techniques. wild-type r. japonicum strains were grown in liquid culture at 28 or 36 degrees c in different concentrations of acridine orange, ethidium bromide, or sodium dodecyl sulfate for selection of mutants. the symbiotic traits of 133 isolates from nine treatment groups were determined. forty-two isolates were nod- nif+, seven were nod+ nif-, and two were nod- nif-. the nifdh genes were deleted i ... | 1983 | 6630155 |
| rna polymerase from rhizobium japonicum. | dna-dependent rna polymerase (ec 2.7.7.6) from rhizobium japonicum was purified. the subunit structure was found to be beta beta' alpha 2 alpha, with the following apparent molecular weights determined by electrophoresis: mr (beta and beta') 150,000 each, mr (sigma) 96,000, mr (alpha) 40,000, mr (holoenzyme) 490,000, mr (core enzyme) 380,000. the recovery of sigma was 28%. rna polymerase from aerobically grown r. japonicum cells and from nitrogen-fixing cells have the same electrophoretic proper ... | 1983 | 6639271 |
| compatibility of rhizobium japonicum with commercial pesticides in vitro. | | 1983 | 6640140 |
| tryptophan auxotrophs of rhizobium japonicum. | eleven tryptophan-requiring mutants of rhizobium japonicum i-110 ars were isolated after nitrous acid mutagenesis and fell into five groups based on characterization by supplementation with intermediates and enzyme assays. | 1983 | 6643394 |
| presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria. | several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. this pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or nadh. previous studies with one denitrifying and nondenitrifying species of the genus pseudomonas, in paracoccu ... | 1983 | 6652580 |
| purification and electron microscopy of a large plasmid of rhizobium meliloti 41. | a large plasmid dna molecule was purified from rhizobium meliloti 41 by cscl-ethidium bromide density gradient centrifugation. electron microscopic and agarose gel electrophoretic data suggest that addition of alkali effectively removes the chromosomal dna, the plasmid dna can be precipitated from the cleared lysate and no gradient centrifugation is needed for plasmid purification. | 1983 | 6659858 |
| relationship between adenylate cytokinin production and ti plasmid of agrobacterium tumefaciens. | to know whether the tumor-inducing plasmid of agrobacterium tumefaciens carries genetic information of the biosynthesis of cytokinins, the levels of 6-(3-methyl-2-butenyl-amino)purine (ipade) and its 4-hydroxy derivative trans-zeatin (trans-z) and its p-beta-d-ribofuranoside (trans-zr) produced in media by wild-type virulent strain, plasmid-cured avirulent strain and the deletion mutant were compared. the highest levels of ipade and trans-z were found in the culture filtrate of late-log phase gr ... | 1983 | 6664842 |
| physical & chemical studies on lipopolysaccharide of agrobacterium tumefaciens. | | 1983 | 6671675 |
| trifoliin a: a rhizobium-recognition lectin in white clover roots. | | 1983 | 6675017 |
| soybean lectin: does it have an essential role in the rhizobium-soybean symbiosis? | | 1983 | 6675019 |
| [comparative evaluation of the use of glucose and fructose by the oxidative pathway in a strain of rhizobium meliloti]. | the oxidation rate in resting cells of rhizobium meliloti was investigated with either glucose or fructose as substrate. fructose uptake was found to be complete, whereas glucose uptake did not fully occur, yielding 2-kitogluconic acid in the medium. at the end of fructose oxidation, significant levels of this substrate and its derivatives had accumulated in the bacteria. | 1983 | 6681255 |
| effects of culture age on symbiotic infectivity of rhizobium japonicum. | the infectivity of the soybean symbiont rhizobium japonicum changed two- to fivefold with culture age for strains 110 ars, 138 str spc, and 123 spc, whereas culture age had relatively little effect on the infectivity of strains 83 str and 61a76 str. infectivity was measured by determining the number of nodules which developed on soybean primary roots in the zone which contained developing and preemergent root hairs at the time of inoculation. root cells in this region of the host root are suscep ... | 1983 | 6681538 |
| transfer of rhizobium meliloti psym genes into agrobacterium tumefaciens: host-specific nodulation by atypical infection. | the psym megaplasmid of rhizobium meliloti 2011 mobilized by plasmid rp4, or plasmid pgmi42, an rp4-prime derivative which carries a 290-kilobase psym fragment including nitrogenase and nod genes, was introduced into agrobacterium tumefaciens. the resulting transconjugants induced root deformations specifically on the homologous hosts medicago sativa and melilotus alba and not on the heterologous hosts trifolium pratense and trifolium repens. the root deformations were shown to be genuine nodule ... | 1984 | 6690420 |
| hairy-root-inducing plasmid: physical map and homology to tumor-inducing plasmids. | a physical map was constructed for the 250-kilobase plasmid pria4b, which confers the virulence properties of a strain of agrobacterium rhizogenes for hairy root disease in plants. the complete hindiii and kpni restriction map was determined from a collection of overlapping hindiii partial digest clones. homologous regions with two well-characterized plasmids that confer virulence for crown gall disease, plasmids ptia6 and ptit37, were mapped on pria4b. as much as 160 kilobases of pria4b had det ... | 1984 | 6690423 |
| rhizobium meliloti competitiveness and the alfalfa agglutinin. | we have isolated two types of isolates having identical colony morphologies from stock cultures of two different rhizobium meliloti strains. one isolate was agglutinated at a high-dilution titer (ha, highly agglutinable) of the alfalfa agglutinin and was sensitive to phage f20, and the other was agglutinated at a lower agglutinin titer (la) and was sensitive to phage 16b. all la isolates from the original slant produced nodules on alfalfa earlier than did ha strains from the original slant. when ... | 1984 | 6698937 |
| d-glucosaminate dehydratase: spectrometric properties of the enzyme-bound pyridoxal 5'-phosphate. | the holoenzyme of d-glucosaminate dehydratase [ec 4.2.1.26] from agrobacterium radiobacter showed absorption peaks at 280 and 415 nm with a shoulder in the region of 320 to 330 nm. the treatment of the enzyme with hydroxylamine followed by dialysis led to disappearance of both the absorption peak at 415 nm and the shoulder, giving the apoenzyme. the fluorescence excitation maximum of the holoenzyme was at 320 nm with a shoulder at 420 nm (emission at 510 nm), and the emission maxima were at 420 ... | 1984 | 6706902 |
| large scale preparation of rhizobium meliloti bacteriophages by fermenter culture. | a simple method for preparation of rhizobium meliloti bacteriophages was established employing fermenter culture. this technique allowed phage production to be checked by dissolved oxygen measure. phage suspensions ranging from 5.10(12) to 1.2.10(13) pfu/ml were found after polyethylene glycol precipitation and centrifugation in cscl. | 1984 | 6707183 |
| transfer of the octopine t-dna segment to plant cells mediated by different types of agrobacterium tumor- or root-inducing plasmids: generality of virulence systems. | genetic complementation studies demonstrated that the transfer to plant cells of the octopine t-dna, entirely present as the only part of the tumor-inducing (ti) plasmid on the plasmid pal1050, was effected by the virulence systems from related plasmids, viz. the nopaline ti plasmid ptic58, the limited host range plasmid ptiag57, and the root-inducing (ri) plasmid pri1855. rhizobium symbiosis plasmids were not capable of effecting the introduction of pal1050 into plant cells. | 1984 | 6715283 |
| light-regulated expression of a pea ribulose-1,5-bisphosphate carboxylase small subunit gene in transformed plant cells. | | 1984 | 6719112 |
| heterogeneity of rhizobium lipopolysaccharides. | the lipopolysaccharides ( lpss ) from strains of rhizobium leguminosarum, rhizobium trifolii, and rhizobium phaseoli were isolated and partially characterized by mild acid hydrolysis and by polyacrylamide gel electrophoresis. mild acid hydrolysis results in a precipitate which can be removed by centrifugation or extraction with chloroform. the supernatant contains polysaccharides which, in general, are separated into two fractions ( lps1 and lps2 ) by sephadex g-50 gel filtration chromatography. ... | 1984 | 6725208 |
| visualization and exact molecular weight determination of a rhizobium meliloti megaplasmid. | the entire dna of rhizobium meliloti mvii /1 cells was isolated preparatively by gentle lysis and sucrose gradient centrifugation. fractions of the sucrose gradient were investigated by electron microscopy. we found intact megaplasmids in supercoiled and relaxed form and total chromosomes. the length of the megaplasmid could be measured, which allowed an exact determination of the molecular weight. we found a length of 0.48 +/- 0.019 mm equivalent to a molecular weight of about 1000 x 10(6). | 1984 | 6726810 |
| flagella-specific bacteriophages of agrobacterium tumefaciens: demonstration of virulence of nonmotile mutants. | bacteriophages gs2 and gs6 for agrobacterium tumefaciens were shown by electron microscopy to adsorb to flagella. this specificity was confirmed by the finding that phage-resistant mutants were nonmotile. such mutants retained tumor-inducing virulence and ability to attach to plant cells, indicating that motility was not required for these properties. both phages had contractile tails and appeared similar in the electron microscope. | 1984 | 6744126 |
| transformation of several species of higher plants by agrobacterium rhizogenes: sexual transmission of the transformed genotype and phenotype. | the t-dna of the ri plasmid from agrobacterium rhizogenes is compatible with the regeneration of whole plants from genetically transformed roots and is transmitted through meiosis to the progeny of genetically transformed plants in carrot, tobacco, and morning glory (convolvulus arvensis). the presence of ri t-dna is correlated with a phenotype that in some respects is invariable from species to species and in other respects varies as a function of species, organ clone within species, or individ ... | 1984 | 6744417 |
| transcription of a zein gene introduced into sunflower using a ti plasmid vector. | a maize genomic clone containing a zein gene (z4) was inserted into the t-region of the t37 ti plasmid. agrobacterium tumefaciens cells carrying this modified ti plasmid were used to inoculate sunflower stemlets. callus tissue active in nopaline synthesis was grown from a single transformed cell. dna analysis of this tissue showed that the zein gene plus t-dna was present in approximately 12 copies per diploid sunflower genome. a 1000 +/- 100 base rna homologous to a zein probe could be isolated ... | 1984 | 6745240 |
| possible adverse effects of antibiotic therapy in plants. | | 1982 | 6750754 |
| expression of ti-plasmid dna in e. coli: comparison of homologous fragments cloned from ti plasmids of agrobacterium strains c58 and ach5. | fragments of two ti plasmids from agrobacterium tumefaciens were cloned and studied for cross-hybridization. homologous fragments were further investigated for areas of strong homology and mapped with various restriction enzymes. the fragments were inserted in two directions and the recombinant plasmid was brought into e. coli strains producing minicells. about five proteins were found to be coded by those fragments of the ti plasmids. | 1980 | 6765583 |
| chemoautotrophic growth of hydrogen-uptake-positive strains of rhizobium japonicum. | recently reported research from this laboratory has demonstrated the autotrophic growth of certain hydrogen-uptake-positive strains of rhizobium japonicum and defined minimal conditions for such growth. ribulose 1,5-bisphosphate carboxylase has been detected in autotrophically growing cells, but at low specific activity. moreover, growth rates were low, and growth ceased at low cell densities. we report here improved autotrophic growth rates of r. japonicum sr through the use of a modified miner ... | 1980 | 6767687 |
| polyol metabolism by rhizobium trifolii. | in rhizobium trifolii 7000, the polyols myo-inositol, xylitol, ribitol, d-arabitol, d-mannitol, d-sorbital, and dulcitol are metabolized by inducible nicotinamide adenine dinucleotide-dependent polyol dehydrogenases. five different polyol dehydrogenases were recognized: inositol dehydrogenase, specific for inositil; ribitol dehydrogenase, specific for ribitol; d-arabitol dehydrogenase, which oxidized d-arabitol, d-mannitol, and d-sorbitol; xylitol dehydrogenase, which oxidized xylitol and d-sorb ... | 1980 | 6767702 |
| [preparation and properties of new catabolic substrates for two types of oncogenic plasmids of agrobacterium tumefaciens]. | reduction of the schiff bases formed between glucose, mannose or galactose with glutamic acid yields products related both structurally and biologically to agropine and to a derivative of agropine present in crown gall tumours. the catabolism of these compounds is coded for by octopine and agropine ti-plasmids of agrobacterium tumefaciens. | 1980 | 6772324 |
| comparative studies on the regulation of tryptophan synthesis. | in vitro dna recombination techniques have revolutionized the study of genetic control of biosynthetic pathways. using examples drawn from the pathway of tryptophan synthesis, approaches to the deciphering of regulatory signals and response mechanisms through transposition of dna segments and dna sequence analysis will be presented. after reviewing the known chromosomal arrangements and regulatory patterns of trp genes in the bacterial groups studied so far, and describing the results of transfe ... | 1980 | 6772375 |
| polarographic measurement of h2 in aqueous solutions. | | 1980 | 6776845 |
| rhizosphere microflora and colonization of wheat roots by gaeumannomyces graminis var. tritici after foliar application of urea and benomyl. | the effect of foliar application of 2% urea and 0.6% benomyl on changes in colonization of the rhizosphere by microorganisms and of roots by the fungus gaeumannomyces graminis (sacc.) arx et olivier var. tritici walker was followed in vegetation glass-house experiments. treatment with a urea solution resulted in increased counts of bacteria (82%), pseudomonas fluorescens (46%), agrobacterium sp. (31%) and antagonistic bacteria with respect to the used fungus isolate and in a decreased occurrence ... | 1980 | 6777280 |
| homologous serological analysis of rhizobium meliloti strains by immunodiffusion. | the homologous titers of antisera prepared against 24 rhizobium meliloti strains ranged from 8 to 64 in immunodiffusion tests when intact cells were used as test antigens. the antisera titers against a number of strains were higher when heated or ultrasonicated cell preparations were used as sources of antigens. the minimum concentration of intact cells required to produce a positive reaction varied between strains and the heat treatment of the cells of some strains increased the detectability o ... | 1980 | 6780176 |
| [genetic analysis of rhizobium japonicum]. | | 1981 | 6780290 |
| rhizobium japonicum mutant strains unable to grow chemoautotrophically with h2. | rhizobium japonicum strain sr grows chemoautotrophically on a mineral salts medium when incubated in an h2- and co2-containing atmosphere. mutant strains unable to grow or that grow very poorly chemoautotrophically with h2 have been isolated from strain sr. the mutant isolation procedure involved mutagenesis with ethyl methane sulfonate, penicillin selection under chemoautotrophic growth conditions, and plating of the survivors onto medium containing carbon. the resulting colonies were replica p ... | 1981 | 6780521 |
| revertible hydrogen uptake-deficient mutants of rhizobium japonicum. | we have developed mutants of rhizobium japonicum which are deficient in h2 uptake capacity (hup-) and which spontaneously revert to the parent type at a frequency consistent with that of a single-point mutation (ca. 1.0 x 10(-09)). the mutagenesis by nitrous acid and the selection of the hup- phenotype by using penicillin and chemolithotrophy as enrichment for chemolithotrophy-deficient strains are described. two mutants retain low but reproducible levels of ribulose bisphosphate-dependent co2 f ... | 1981 | 6783623 |