| [esophageal tuberculosis and massive hematemesis]. | a patient with esophageal tuberculosis who died of massive hematemesis is described. the origin of the disease was probably pulmonary and the esophageal affliction could have been produced by both the ingestion of contaminated sputum or direct extension from mediastinal lymphatic nodes. the diagnosis was reached by the discovery of caseation granulomas at esophagoscopy and the isolation of mycobacterium tuberculosis in the sputum. we comment on the rareness of the disease, clinical and endoscopi ... | 1990 | 2103786 |
| stimulation of antibacterial macrophage activities by b-cell stimulatory factor 2 (interleukin-6). | mononuclear phagocytes provide the major habitat of intracellular bacteria, including mycobacterium tuberculosis and mycobacterium bovis. the capacity of b-cell stimulatory factor 2 (interleukin-6 [il-6]) to activate tuberculostatic functions was investigated by using murine bone marrow-derived macrophages (bmm phi). bmm phi stimulated with recombinant il-6 and subsequently infected with m. bovis organisms failed to inhibit mycobacterial growth. in contrast, marked tuberculostasis was induced by ... | 1990 | 2104600 |
| a mycobacterial 65-kd heat shock protein induces antigen-specific suppression of adjuvant arthritis, but is not itself arthritogenic. | a recombinant (r)65-kd protein from mycobacterium leprae, at levels far in excess of those present in whole mycobacteria, was unable to induce arthritis. even when combined with a synthetic adjuvant, cp20961, to mimic the peptidoglycan adjuvant component of the mycobacterial cell wall, the r65-kd protein failed to induce arthritis. pretreatment with as little as 1 microgram r65-kd protein protected rats against arthritis induced by m. tuberculosis, but this r65-kd protein was markedly less able ... | 1990 | 2104920 |
| is pyrazinamide bactericidal against mycobacterium tuberculosis? | bactericidal activity of pyrazinamide (pza) was tested at ph 5.6 in 7h12 broth against drug-susceptible m. tuberculosis strains. the highest tested concentrations of pza, 500 and 1,000 micrograms/ml, killed no more than 76% of the bacterial population. these concentrations are more than 32 times greater than the minimal inhibitory concentration (mic) and the achievable in vivo concentrations. despite high clinical efficacy of pza and its so-called sterilizing activity in mouse experiments, this ... | 1990 | 2105072 |
| detection of antibodies against mycobacterium tuberculosis. | | 1990 | 2105192 |
| drug-resistant tuberculosis in aids. | | 1990 | 2105193 |
| peptidoglycan-associated polypeptides of mycobacterium tuberculosis. | important protein-based immunoreactivities have long been associated with the cell wall core of mycobacteria. in order to explore the molecular basis of such activities, purified cell walls of mycobacterium tuberculosis were extracted with sodium dodecyl sulfate to produce an insoluble residue composed of the mycolylarabinogalactan-peptidoglycan complex and about 2% of unextractable protein. treatment of the product from an avirulent strain of m. tuberculosis with trifluoromethanesulfonic acid r ... | 1990 | 2105289 |
| nosocomial transmission of tuberculosis associated with a draining abscess. | nine secondary cases of tuberculosis and 59 tuberculin skin test conversions occurred after exposure to a hospitalized patient with a large tuberculous abscess of the hip and thigh. among 442 tuberculin-negative hospital employees, the relative risk of skin test conversion associated with recalled exposure to the patient was 14.0 (95% confidence limits, 6.8, 28.7). four of 5 surgical suite employees who assisted with incision and debridement of the abscess had skin test conversions, as did 85% o ... | 1990 | 2105362 |
| esophageal tuberculosis: definitive diagnosis by endoscopy. | this report describes a patient with a 2-wk history of epigastric pain and dysphagia, and a mid-esophageal ulceration resulting from infection with mycobacterium tuberculosis. this is an uncommon site of tuberculous involvement, and usually results from direct extension from adjacent mediastinal or hilar lymph nodes, reactivated lung infection, infected vertebral bodies or aortic aneurysms, or from extension from the pharynx or larynx. the endoscopic lesion is ulcerative, with shallow, smooth ed ... | 1990 | 2105633 |
| pancreatic tuberculosis: a frequently fatal but potentially curable disease. | a 40-year-old man with prolonged constitutional symptoms and clinical evidence of pancreatitis and biliary tract obstruction underwent exploratory laparotomy. intraoperative liver and pancreatic biopsies revealed acid-fast bacilli. mycobacterium tuberculosis subsequently grew from both sputum and urine cultures. the patient responded well to antituberculosis therapy, although 8 months later, he returned with acquired immunodeficiency syndrome (aids) and died of large cell lymphoma 1.5 years late ... | 1990 | 2105992 |
| antipurified-protein-derivative antibody in tuberculous pleural effusions. | using elisa, we studied anti-ppd antibody values in 31 tuberculous and 39 carcinomatous pleural effusions. mean odi values of anti-ppd igg, iga and igm antibodies in tuberculous pleural effusions were higher than those in carcinomatous pleural effusions (p less than 0.01 in igg and iga, p less than 0.05 in igm antibodies). we also analyzed the detected antigens in ppd and bcg whole cell fraction recognized by igg antibody in tuberculous pleural effusions. among heteromolecular components, the an ... | 1990 | 2106413 |
| relative permissiveness of macrophages from black and white people for virulent tubercle bacilli. | epidemiological, clinical, and histopathological evidence suggests that black people are more susceptible to tuberculosis than are white people. the cellular basis of this putative susceptibility was investigated in vitro by comparing responses of blood-derived macrophages from black and white donors to experimental infection with virulent tubercle bacilli. phagocytes from pairs of black and white donors were infected. the uptake and replication of the tubercle bacilli in these cells were measur ... | 1990 | 2106489 |
| use of gen-probe and bactec for rapid isolation and identification of mycobacteria. correlation of probe results with growth index. | gen-probe culture confirmation tests (gen-probe, san diego, ca) for mycobacterium tuberculosis complex and mycobacterium avium complex were performed on 276 mycobacterial isolates. all 138 m. tuberculosis complex isolates and 79 of 80 m. avium complex isolates were identified correctly. no falsely positive test results were obtained; 58 nontuberculous mycobacteria other than m. avium complex were negative by gen-probe. in a second phase of testing, gen-probe tests were performed using concentrat ... | 1990 | 2106779 |
| surgical intervention in the treatment of pulmonary disease caused by drug-resistant mycobacterium tuberculosis. | of 99 patients with pulmonary disease caused by multiple-drug-resistant strains of mycobacterium tuberculosis admitted to the national jewish center for immunology and respiratory medicine from 1983 to 1988, 29 were selected for resection to supplement chemotherapy. all patients had organisms with high levels of resistance to all of the first line medications, including rifampin and isoniazid. although the patients were treated preoperatively with multidrug regimens in an effort to reduce the my ... | 1990 | 2106811 |
| enzyme-linked immunosorbent assay for distinguishing serological responses of lepromatous and tuberculoid leprosies to the 29/33-kilodalton doublet and 64-kilodalton antigens of mycobacterium tuberculosis. | immunoblot assays for the antibodies to mycobacterium tuberculosis sonic extracts showed that all serum specimens of 40 lepromatous and of 28 tuberculoid leprosy patients reacted in a significant manner to 29/33-kilodalton (kda) doublet and 64-kda antigens, respectively. by using an enzyme-linked immunosorbent assay, we observed a significantly high immunoglobulin g antibody titer to the purified m. tuberculosis 29/33-kda doublet and 64-kda antigens in lepromatous and tuberculoid leprosy patient ... | 1990 | 2107205 |
| the disinfectant dilemma revisited. | | 1990 | 2107251 |
| intracranial tuberculoma. | in north america, central nervous system involvement by tuberculosis is uncommon. this patient review describes the clinical and radiological features of this unusual neurologic lesion. special emphasis is given to the methods of arriving at the correct diagnosis, to the efficacy of combination antituberculous therapy, and to the possibility of paradoxical expansion of these lesions during the course of successful treatment. | 1990 | 2107268 |
| [how to recover live mycobacteria from smear-positive and culture-negative specimens of mycobacteriosis patients]. | there are two kinds of smear-positive and culture-negative (spcn) cases. one takes place temporarily when patients are under healing process and another takes place fro a long period of time. in the latter situation, probability of detecting live mycobacteria in the spcn specimens seems to be high. to detect live mycobacteria, we examined 27 specimens which had been designated as spcn previously, and could recover colonies from 14 specimens. ten strains of m. tuberculosis and 4 strains of m. che ... | 1990 | 2107352 |
| phagocytosis of mycobacterium tuberculosis is mediated by human monocyte complement receptors and complement component c3. | we have examined the receptor-ligand interactions and the method of phagocytosis of virulent mycobacterium tuberculosis by human monocytes. mab against complement receptors (cr) inhibit adherence and phagocytosis of m. tuberculosis in fresh nonimmune serum. a mab against the type 1 cr (cr1) inhibits adherence of m. tuberculosis by 40 +/- 5%, and three different mab against the type 3 cr (cr3) each inhibit adherence by 39 +/- 5% to 47 +/- 4%. a mab against cr1 used in combination with one of the ... | 1990 | 2108212 |
| route-related variation in immunogenicity of mycobacteria. | the route of immunization was observed to play a significant role in deciding the t-cell response to immunization with killed mycobacterial vaccines. slow-growing mycobacteria were found to be immunogenic by both the intraperitoneal (i.p.) and intradermal (i.d.) routes; rapid-growing mycobacteria were immunogenic by the i.d. route only. the nonresponder state following i.p. immunization with mycobacterium vaccae could be corrected by treatment of the mice with poly i:poly c or indomethacin prior ... | 1990 | 2108226 |
| estimating hiv levels and trends among patients of tuberculosis clinics. | symptomatic tuberculosis (tb) can occur as an opportunistic disease in immunosuppressed persons who are infected with human immunodeficiency virus (hiv) and who have been previously infected with mycobacterium tuberculosis. increases in tb cases have occurred in areas which have reported large numbers of cases of the acquired immunodeficiency syndrome (aids), and a high proportion of these tb cases have been hiv seropositive. therefore, increasing numbers of hiv-infected persons may be found in ... | 1990 | 2108458 |
| ultraviolet radiation exposures in a mycobacteriology laboratory. | | 1990 | 2108936 |
| predominant structural features of the cell wall arabinogalactan of mycobacterium tuberculosis as revealed through characterization of oligoglycosyl alditol fragments by gas chromatography/mass spectrometry and by 1h and 13c nmr analyses. | the peptidoglycan-bound arabinogalactan of a virulent strain of mycobacterium tuberculosis was per-o-methylated, partially hydrolyzed with acid, and the resulting oligosaccharides reduced and o-pentadeute-rioethylated. the per-o-alkylated oligoglycosyl alditol fragments were separated by high pressure liquid chromatography and the structures of 43 of these constituents determined by 1h nmr and gas chromatography/mass spectrometry. the arabinogalactan was shown to consist of a galactan containing ... | 1990 | 2108960 |
| sequence analysis and amplification by polymerase chain reaction of a cloned dna fragment for identification of mycobacterium tuberculosis. | analysis of the 1,016-base-pair sequence of a putative probe for identification of mycobacterium tuberculosis revealed two almost identical fragments of 507 and 509 bases. from this sequence two pairs of primers were synthesized (mtbab and mtbcd), ranging from 18 to 22 nucleotides, for use in polymerase chain reactions (pcrs) with dna from six reference strains of m. tuberculosis, as well as type strains of m. bovis, m. bovis bcg, m. kansasii, m. avium, m. intracellulare, and m. scrofulaceum. al ... | 1990 | 2108994 |
| immunologic characterization of a 35-kilodalton recombinant antigen of mycobacterium tuberculosis. | a 35-kilodalton (kda) recombinant antigen (35-kda antigen) produced by escherichia coli jm107 carrying dna from mycobacterium tuberculosis was purified and immunologically examined by in vivo and in vitro methods. a monoclonal antibody (2b2) was produced against the 35-kda antigen. the protein was purified from the insoluble fraction of the recombinant e. coli strain by either affinity chromatography with the 2b2 monoclonal antibody or preparative isoelectric focusing. in enzyme-linked immunosor ... | 1990 | 2108996 |
| polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
| criteria for diagnosis in pulmonary tuberculosis. | in a retrospective study, case records of 1061 patients treated with antituberculosis drugs were examined to assess the criteria for diagnosis in each case. seventy six percent had sputum examined for a.f.b. and 45% had mantoux test done. five hundred and eighty one (55%) were diagnosed on radiology alone, while 262 (25%) had positive sputum for a.f.b. only 50 (5%) of cases had positive mantoux in addition to positive sputum and radiological changes. practical significance of this practice is di ... | 1990 | 2109125 |
| [primary resistance to antitubercular drugs]. | | 1990 | 2109161 |
| the effect of retinoids on the skin reaction and swelling seen 7 days after adjuvant injection in the rat paw. | | 1990 | 2109511 |
| quantitative and qualitative studies on the major extracellular antigen of mycobacterium tuberculosis h37rv and mycobacterium bovis bcg. | the mycobacterium tuberculosis antigen 85 is a biologically important antigen. tuberculosis patients may have strong antibodies against it, and their peripheral blood mononuclear cells respond to it with gamma-interferon production and lymphocyte proliferation. antigen 85 is actively secreted into the culture medium during culture in vitro and is known to bind human fibronectin. a double-antibody enzyme-linked immunosorbent assay (elisa) for quantification of antigen 85 is described. a mouse mon ... | 1990 | 2109556 |
| recognition of novel glycolipid antigens from smooth variants of mycobacterium tuberculosis. | a major polar and three minor slightly less polar glycolipids were identified in extracts of two smooth (canetti) strains of mycobacterium tuberculosis. immunostaining on thin-layer chromatograms and enzyme-linked immunosorbent assay (elisa) of purified lipids demonstrated that the major and the two most polar of the minor glycolipids are potent antigens, reacting with homologous antisera and also with that raised against the type strain (h37rv). | 1990 | 2109724 |
| antimycobacterial antibody levels in pleural fluid as reflection of passive diffusion from serum. | the objective of this study was the prospective evaluation of the relationship between serum and pleural fluid antibody levels to mycobacterial antigens and their role in the diagnosis of tuberculous pleuritis. the setting was a tertiary care medical center. thirteen patients with tuberculous pleuritis and 53 control subjects with pleural effusion (22 with carcinoma, 17 with cardiac failure, and 14 with empyema or parapneumonic effusion) were studied. the level of igg was measured by elisa. the ... | 1990 | 2110052 |
| enzyme immunoassay for identification of heat-killed mycobacteria belonging to the mycobacterium tuberculosis and mycobacterium avium complexes and derived from early cultures. | a simple enzyme-linked immunosorbent assay was developed for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii. six monoclonal antibodies were used: two (f23-49 and f24-2) were specific for the m. tuberculosis complex, two (f85-2 and f85-10) were specific for the identification of the m. avium complex, one (f126-22) was specific for m. kansasii, and one (f141-3) was broadly reactive and dis ... | 1990 | 2110180 |
| clinical modeling of t cell vaccination against autoimmune diseases in rats. selection of antigen-specific t cells using a mitogen. | effective t cell vaccination against experimental autoimmune diseases involves treatment with activated, autoimmune t lymphocytes. the present study was undertaken to learn whether antigen-specific t cells present in low frequency could be selected in vitro without using the specific antigen. the rat models of adjuvant arthritis and experimental autoimmune encephalomyelitis were investigated using proliferation assays and limiting dilution techniques to quantify the changes in reactivity of a he ... | 1990 | 2110191 |
| tuberculous arthritis. report of a case with multiple joint involvement and periarticular tuberculous abscesses. | we describe a 41-year-old man with an unusual presentation of tuberculous joint disease involving 3 peripheral joints: right knee, wrist and first metatarsophalangeal. periarticular "cold" tuberculous abscesses were observed in the ulnar aspect of his right hand and on the lateral aspect of his first right metatarsal bone. mycobacterium tuberculosis was isolated from his knee and both abscesses. synovial biopsies taken from these 3 joints showed typical tuberculous granulomata. m. tuberculosis w ... | 1990 | 2110254 |
| induction of interleukin 1 and tumor necrosis factor by mycobacterial proteins: the monocyte western blot. | infection with mycobacterium tuberculosis involves mononuclear phagocytic cells as hosts to intracellular parasites, accessory cells in the induction of the immune response, effector cells for mycobacterial killing, and targets of cytotoxic lymphocytes. when stimulated by whole mycobacteria or various mycobacterial preparations, monocytes and macrophages produce the cytokines interleukin 1 and tumor necrosis factor, which possess multiple functions, including immune induction, and may be respons ... | 1990 | 2110362 |
| tuberculosis in captive seals: bacteriological studies on an isolate belonging to the mycobacterium tuberculosis complex. | culture of tuberculous lesions from six of 14 captive seals yielded an organism which, on the basis of biochemical and drug sensitivity tests, was identified as mycobacterium bovis, although the organism showed a weak cording pattern and was glycerol tolerant. it was pathogenic in rabbits and guinea pigs and after passage the organism exhibited strong cord formation and was glycerol intolerant. restriction endonuclease analysis and sodium dodecyl-sulphate polyacrylamide gel electrophoresis indic ... | 1990 | 2110376 |
| [use of elisa for the detection of igg antibodies to mycobacterium tuberculosis in the diagnosis of tuberculosis]. | the presence of mycobacterial antibodies of igg type was determined in serum, cerebrospinal fluid and pleural puncture fluid by using elisa and soluble antigens of the strain mycobacterium tuberculosis h37rv. in patients suffering from tuberculosis the most frequently found titer was 1:320 and above. this titer was however found also in 30% of healthy subjects of the control group and 29% of patients with other than tuberculous disease. the sensitivity of the test was 0.7692 and its specificity ... | 1990 | 2110495 |
| congenital tuberculosis, still a problem. | | 1990 | 2110649 |
| [characteristics of mycobacteria from patients with genital tuberculosis]. | one hundred thirty six strains of mycobacteria isolated from patients with genitalia tuberculosis were analysed. out of them 92 (67.7%) strains were classified as those of human origin, 17 (12.5%) as those of bovine origin, and 27 (19.7%) were referred to as opportunistic. the study of cultural properties, virulence and drug sensibility demonstrated that the genitalia tuberculosis agent featured oligobacillary excretion, relationship between their rapid growth and the nature of material under ob ... | 1990 | 2110667 |
| [investigation of pathogens in the foci of pulmonary and osteo-articular tuberculosis]. | the tubercle bacilli detection rate was determined by direct bacterioscopy and the culture plate method immediately in the disease foci in 123 patients with pulmonary tuberculosis and 78 patients with tuberculosis of bones and joints. the culture plate method was shown to have significant advantages over bacterioscopy. however, in some cases with negative responses to the culture plate test, bacterioscopy was the only procedure that detected the pathogen in resected lung tissues. parallel use of ... | 1990 | 2110668 |
| [meningeal tuberculosis in recent years]. | | 1990 | 2110671 |
| [antitubercular agents. 49. thiohydrazides, potential antitubercular agents]. | | 1990 | 2111032 |
| smear-negative, culture-positive pulmonary tuberculosis. six-month chemotherapy with isoniazid and rifampin. | we have shown in arkansas that 9 months of therapy with isoniazid (inh) and rifampin (rif) can achieve lasting success in 95% of cases with sputum-smear-positive pulmonary tuberculosis. it seemed likely that when the tubercle bacilli were less numerous, i.e., could not be seen on microscopy, less therapy would suffice. thus, in january 1980, we began giving only 6 months of treatment to patients in whom at least one sputum culture showed m. tuberculosis but at least three sputum smears showed no ... | 1990 | 2111106 |
| outbreak of multidrug-resistant tuberculosis--texas, california, and pennsylvania. | | 1990 | 2111434 |
| case records of the massachusetts general hospital. weekly clinicopathological exercises. case 24-1990. a 53-year-old middle eastern man with uveitis, hilar lymphadenopathy, and interstitial lung disease. | | 1990 | 2111462 |
| isolation rates of different mycobacterial species from chandigarh (north india). | a total of 4958 patients, clinically suspected to have tuberculosis were screened for mycobacteria by acid fast staining and culture procedures. mycobacterial species were isolated from 462 (9.3%) patients while acid fast bacilli were demonstrated on smear examination in 83 (1.7%) patients. mycobacterium tuberculosis was the most common isolate (92%). among the nontuberculous mycobacteria, m. fortuitum was isolated in 13 (2.8%), m. avium in 2 (0.4%) and m. szulgai in 1 (0.2%). in 22 individuals ... | 1990 | 2111799 |
| evidence for the presence of a phosphatidylinositol anchor on the lipoarabinomannan and lipomannan of mycobacterium tuberculosis. | the recent availability (hunter, s.w., gaylord, h., and brennan, p.j. (1986) j. biol. chem. 261, 12345-12351) of the well known arabinomannan of mycobacterium leprae and mycobacterium tuberculosis as the pure native lipoarabinomannan has resulted in its implication in key aspects of the immunopathogenesis of leprosy and tuberculosis. we had indicated that the lipid moiety of lipoarabinomannan is probably based on a diacylglycerol unit in that glycerol and the two fatty acids, hexadecanoate and 1 ... | 1990 | 2111816 |
| [significance of scanty bacterial isolation obtained once in newly diagnosed patients with tuberculosis of the respiratory organs]. | | 1990 | 2111911 |
| [species category of mycobacteria isolated from cattle and environmental objects]. | the results of testing the slaughtered cattle material and environment objects for the presence of mycobacteria are presented. during 1984-1988 with a stable excretion of pathogenic mycobacteria, the quantity of the isolated atypical mycobacteria tended to increase. in 1984 the atypical mycobacteria made up 24.1% of the cultures isolated from cattle (pathogenic ones being 75.9%); in 1985, 29.0%; in 1986, 31.4%; in 1987, 46.0% and in 1988, 55.8%. for the above period m. bovis amounted to an avera ... | 1990 | 2111912 |
| [production and characteristics of monoclonal antibodies reacting with human-type m. tuberculosis]. | monoclonal antibodies to m. tuberculosis were produced by hybrid technology. they were described via enzyme immunoassay and immunoblotting. it was shown that these antibodies should be included into igg class. besides, they are oriented towards and antigen with a molecular weight of 20 kda, react with h37rv at a concentration of 12 ng/ml and with bcg at a concentration of 50 micrograms/ml and fail to react with m. intracellulare, m. scrofulaceum and e. coli. | 1990 | 2111913 |
| controlling tuberculosis: the pathologist's point of view. | | 1990 | 2111920 |
| the spectrum of tuberculosis and leprosy: what can be the significance of specific humoral responses? | | 1990 | 2111921 |
| in vivo vs. in vitro killing of virulent mycobacterium tuberculosis. | | 1990 | 2111922 |
| killing intracellular mycobacteria in in vitro macrophage systems: what may be the role of known host microbicidal mechanisms? | | 1990 | 2111923 |
| intracellular killing of mycobacteria. | | 1990 | 2111924 |
| sources of variability in assays of the interaction of mycobacteria with mononuclear phagocytes: of mice and men. | | 1990 | 2111925 |
| a 25-kda fraction from mycobacterium tuberculosis that inhibits leukocyte bactericidal activity: reversal by gamma interferon and clofazimine. | | 1990 | 2111927 |
| the role of activated macrophages in protection and immunopathology in tuberculosis. | | 1990 | 2111928 |
| a comparative study on the effects of ril-4, ril-2, rifn-gamma, and rtnf-alpha on specific t-cell non-responsiveness to mycobacterial antigens in lepromatous leprosy patients in vitro. | we have studied lepromatous leprosy (ll) as a human model disease for t-cell non-responsiveness to specific mycobacterial antigens and studied the effect of ril-4, ril-2, rifn-gamma and rtnf-alpha thereon. t-cell non-responsiveness to mycobacterium bovis bacillus calmette-guerin (bcg) or purified protein derivative of m. tuberculosis (ppd) antigens could be overcome in 5 out of 8 non-responder patients by ril-2 and in 2 out of 8 by ril-4. the ability of ril-4 to overcome bcg/ppd non-responsivene ... | 1990 | 2111939 |
| mycobacterial antigens stimulate rheumatoid mononuclear cells to cartilage proteoglycan depletion. | in a coculture with porcine articular cartilage explants unstimulated blood mononuclear cells (bmc) from patients with rheumatoid arthritis (ra), but not from healthy controls, induced proteoglycan depletion of dead cartilage. specific stimulation of the ra bmc with mycobacterium tuberculosis (mt), in comparison with concanavalin a (con-a), strongly enhanced the proteoglycan depletion of living cartilage; this was not found with the bmc of healthy controls. however, the mt induced proliferative ... | 1990 | 2112199 |
| the effects of exposure time, drug concentration, and temperature on the activity of ethambutol versus mycobacterium tuberculosis. | in a series of dynamic in vitro studies designed to assess the activity of ethambutol (emb) against mycobacterium tuberculosis, we made the following observations. ethambutol showed bactericidal action with 10 micrograms/ml concentration when in constant contact with m. tuberculosis. at a lower concentration, bactericidal action was evident up to 6 days; after that time, this effect was lost owing to the development of drug-resistant mutants. the bactericidal action of ethambutol in this model w ... | 1990 | 2112350 |
| susceptibility of mycobacteria to fusidic acid. | fusidic acid was shown to be effective in vitro against 30 clinical isolates of mycobacterium tuberculosis at concentrations of 32-64 mg/l, concentrations which are readily achieved in serum. all but one of 17 mycobacterium avium complex strains were resistant to fusidic acid at concentrations up to 64 mg/l. however, synergistic effects were shown for 11 of the 17 strains when fusidic acid was combined with ethambutol. five of the strains were fully susceptible to the combination of fusidic acid ... | 1990 | 2112466 |
| t-cellular immune reactions (in macrophage inhibition factor assay) against mycobacterium paratuberculosis, mycobacterium kansasii, mycobacterium tuberculosis, mycobacterium avium in patients with chronic inflammatory bowel disease. | a mycobacterial aetiology has been suggested for crohn's disease. a slow growing mycobacterium, biochemically and genetically identical to m paratuberculosis, the causative agent of enteritis in ruminants (johne's disease), has been isolated from gut specimens of patients affected by crohn's disease. if m paratuberculosis or other mycobacteria play a role in the pathogenesis of crohn's disease, then patients may have been sensitised to these mycobacteria or show an anergy immune reaction. we the ... | 1990 | 2112502 |
| pyrazinamide and pyrazinoic acid activity against tubercle bacilli in cultured human macrophages and in the bactec system. | pyrazinamide (pza) has become an essential component of current 6-month regimens for therapy of tuberculosis. susceptible strains of tubercle bacilli convert pza to pyrazinoic acid (poa) through pyrazinamidase (pzase), which resistant strains and mycobacterium bovis bacille calmette-guérin lack. pza susceptibility results obtained in cultured human macrophages were compared with those in the broth bactec system with 7h12 medium at ph 6.0 for strains known to be pzase-positive or -negative. altho ... | 1990 | 2113074 |
| from the centers for disease control. outbreak of multidrug-resistant tuberculosis--texas, california, and pennsylvania. | | 1990 | 2113107 |
| [efficacy of fluid cultures in examination for mycobacteria]. | | 1990 | 2113282 |
| endobronchial tuberculosis manifested as obstructive airway disease in a 4-month-old infant. | tuberculosis is becoming a more prominent pediatric disease, but there are few recent reports of endobronchial involvement. we have presented the case of a 4-month-old infant with symptomatic obstructive airway disease due to mycobacterium tuberculosis. endobronchial tuberculosis usually follows 2 to 3 months of antituberculous therapy. this case is especially unusual because the endobronchial disease developed before diagnosis or therapy. endobronchial tuberculosis should be considered in any p ... | 1990 | 2113316 |
| interleukin-6 serum levels correlate with footpad swelling in adjuvant-induced arthritic lewis rats treated with cyclosporin a or indomethacin. | to investigate the role of interleukin 6 (il-6) in adjuvant-induced arthritis, serum from adjuvant-immunized lewis rats treated with cyclosporin, indomethacin, or saline was evaluated for il-6 activity. inflammation was quantitated by measuring paw volume. we found that an increase in serum il-6 activity parallels the kinetics of paw edema development in adjuvant-immunized rats. daily treatment with 5 mg cyclosporin a/kg prevented the increase in paw volume and held serum il-6 activity to levels ... | 1990 | 2113443 |
| local production of tumor necrosis factor and ifn-gamma in tuberculous pleuritis. | tnf and ifn-gamma are thought to be involved in the immune response to mycobacterial infection because they exhibit antimycobacterial effects in vitro. to investigate the roles of these cytokines in vivo at the site of disease activity in human tuberculosis, we evaluated local cytokine production in patients with tuberculous pleuritis. both tnf and ifn-gamma were selectively concentrated 5- to 30-fold in pleural fluid, compared to blood of the same patients. messenger rna for both cytokines was ... | 1990 | 2113553 |
| genital tuberculosis associated with female infertility in the western cape. | infertility is a common presenting symptom in women with genital tuberculosis. a study was undertaken to determine the prevalence and characteristics of this disease among the infertile patients (a and b income group) attending the reproductive biology unit at tygerberg hospital. between june 1986 and december 1987, the menstrual fluid from 451 infertile women was cultured for mycobacterium tuberculosis using löwenstein-jensen medium. a prevalence of 7.98% (36/451) was found. laparoscopic examin ... | 1990 | 2113716 |
| the recovery of mycobacterium avium complex and mycobacterium tuberculosis from blood specimens of aids patients using the nonradiometric bactec nr 660 medium. | the ability of the nonradiometric bactec nr 660 aerobic 6a blood culture medium to support mycobacterial growth was investigated. during a 19-month period blood cultures from 140 aids patients were sent to the microbiology laboratory. after the cultures were incubated for seven days, aliquots of medium from the vials were centrifuged, sediments examined microscopically for mycobacteria, and cultured to mycobacterial media. seventy-one aids patients (51%) had at least one blood culture positive f ... | 1990 | 2113765 |
| micronutrient status and immune function in tuberculosis. | both macro- and micronutrients have been shown to affect resistance to tuberculosis, which is mediated by macrophages activated by t lymphocytes. others have demonstrated inhibition of mycobacterial replication in macrophage cultures treated with vitamin d or retinoic acid. we examined the influence of dietary zinc and vitamin d on resistance to tuberculosis. guinea pigs were fed diets containing varying levels of zinc or vitamin d, and infected 6 weeks later by the respiratory route with virule ... | 1990 | 2113788 |
| mics and mbcs of win 57273 against mycobacterium avium and m. tuberculosis. | a new quinolone, win 57273 [1-cyclopropyl-7-(2,6-dimethyl-4-pyridinyl)-6-fluoro-1,4-dihydro-4-oxo-3 - quinolonecarboxylic acid], synthesized by sterling research group, was tested in vitro against mycobacterium tuberculosis and mycobacterium avium strains. the broth-determined mics of this agent ranged from 1.0 to 4.0 micrograms/ml for m. tuberculosis strains and from 0.25 to 8.0 micrograms/ml for m. avium strains. a distinctive feature of this agent, in comparison with ofloxacin and ciprofloxac ... | 1990 | 2113793 |
| chlamydia trachomatis, tubal disease and the incidence of symptomatic and asymptomatic infection following hysterosalpingography. | the risk of causing or reactivating pelvic infection by hysterosalpingography (hsg) was assessed in 118 infertile women. serological evidence of chlamydia trachomatis infection was sought before, and 10 days and 4 weeks after hsg, using the single-antigen whole-inclusion immunofluorescence (wif) test for species-specific antibody and the complement fixation test (cft) for group antibody. chlamydia antigen was detected using an elisa. there was a close correlation between the finding of occlusive ... | 1990 | 2113932 |
| [a therapeutic trial of a combination of 3 essential drugs in a short course of chemotherapy in tuberculosis. results 6 months after the end of treatment]. | 250 patients suffering from pulmonary tuberculosis who were smear positive received a chemotherapy regime for 6 months combining rifampicin and isoniazid every day with a daily supplement of pyrazinamide for the first 8 weeks. the three drugs given in the initial phase of treatment were administered either separately or in combined preparations according to the 2 controlled randomised groups. during the maintenance phase the drugs were given in a combined form in fixed proportions in the 2 group ... | 1990 | 2114029 |
| infectivity of patients with pulmonary tuberculosis during chemotherapy. | | 1990 | 2114306 |
| the pathogenicity of mycobacterium tuberculosis during chemotherapy. | we used the guinea pig as an experimental model to investigate the pathogenicity of mycobacterium tuberculosis. sputum samples were injected subcutaneously into guinea pigs and the animals were killed and an autopsy performed after eight weeks. the likelihood of the sputum samples producing tuberculosis in the guinea pig was related to culture positivity rather than to duration of chemotherapy. this study does not support the belief that a change in pathogenicity occurs during treatment of pulmo ... | 1990 | 2114307 |
| [differentiation of m. tuberculosis and m. avium complex using various monoclonal antibodies]. | m. avium-complex (mac) is the cause of the most bacterial infections in aids patients. because of the high resistance of mac, a rapid differentiation between m. tuberculosis and mac is of great interest. in an enzyme-linked immunosorbent assay (elisa) we tested three monoclonal antibodies bs 103, bs 104, bs 113 and the combination of bs 103/bs 113, which bind selectively to the cell wall of m. tuberculosis. 98 mac isolates from aids patients and 233 m. tuberculosis isolates from patients with lu ... | 1990 | 2114629 |
| [determination of the sensitivity of tuberculosis bacteria to pyrazinamide using human macrophage culture]. | increasing interest is being shown in the antituberculous drug pyrazinamide. an in-vitro model using cultures of human blood macrophages was tested with 8 different mycobacterium tuberculosis trains. a good correlation was found between the susceptibility of the strains to pyrazinamide and the kinetics in the macrophage culture. | 1990 | 2114631 |
| [control of tuberculosis in nepal. a project. initial results, experiences]. | 2,124 persons were examined in 16 months. 328 of these were tuberculosis patients requiring treatment. when treated, 74%, 81% and 97% of the patients showed conversion of sputum after 2, 4 and 6 months, respectively. sensitivity tests (n = 223) yielded 19% monoresistances and 5% resistances against 2 drugs. 87% of the patients took their tablets regularly; 8.7% discontinued the treatment. | 1990 | 2114632 |
| [control of tuberculosis in nepal. a project. logistics, goals]. | the aims of the anti-tuberculosis project are firstly to successfully conclude chemotherapy with few discontinuations of treatment and re-activations, and, secondly, via the determination of resistance, to identify problems in the fight against tuberculosis in nepal, and to demonstrate therapeutic possibilities in problem patients. | 1990 | 2114633 |
| [in 76% of patients with active tuberculosis treated with triple therapy (isoniazid-rifampicin-pyrazinamide) cultural conversion precedes microscopic conversion]. | the time course of smear and culture conversion was studied in 50 previously untreated patients with cavitary pulmonary tuberculosis. treatment consisted of isoniazid, rifampicin and pyrazinamide for three months, followed by isoniazid and rifampicin. after eight weeks of treatment, negative smears and cultures were obtained in 46 and 84% of the patients, respectively. in 76% of patients, cultural conversion preceded smear conversion, and in 24% of the patients, cultural conversion occurred up t ... | 1990 | 2114634 |
| [clinical aspects and pathology of mycobacterial infections in aids. pulmonary and extrapulmonary manifestations]. | infections with m. tuberculosis and other mycobacteria (atypical mycobacteria) are frequently found in patients with aids. they are almost always disseminated, and are associated with a spectrum of findings that is often unhelpful for the diagnosis. in the case of tuberculosis, typical granulomas are a major finding. the histological correlate of mycobacteriosis is histiocytosis; granulomas are rarely observed, and when they do present, are incompletely developed. | 1990 | 2114635 |
| [resistance testing of m. avium-intracellulare and m. tuberculosis of aids patients with new drugs and drug combinations]. | the minimal inhibitory concentration (mic) of rifabutin for m. tuberculosis was 0.006 to 0.06 micrograms/ml, and 0.12 to 0.25 micrograms/l for clofazimine. accordingly, m. tuberculosis is inhibited by concentrations of these two medications that are far lower than the levels normally found in the serum. in the case of m. avium, the mic of the new drugs such as rifabutin and clofazimine are, in contrast to the mics for m. tuberculosis, merely of the order of the achievable serum concentrations. t ... | 1990 | 2114636 |
| [new vaccination strategies against tuberculosis]. | tuberculosis is a chronic infections disease which still causes major health problems worldwide. although the attenuated life vaccine strain bcg is available, novel vaccination strategies are currently discussed. these could be composed of recombinant proteins or synthetic polypeptides as antigens and novel adjuvants or recombinant carriers to improve immunogenicity. | 1990 | 2114641 |
| [treatment of the sputum with soviet-produced chlorhexidine bigluconicum]. | soviet chlorhexedin bigluconicum (chbg) was used for sputum treatment. 129 sputum specimens were investigated. among them 45 specimens were bacterioscopically negative. the rest contained low, moderate and high numbers of tubercle bacilli. the sputum was incubated on the löwenstein-jensen and finn-ii media. comparison of two treatment methods (with na3po4 and chbg) showed that chbg had a more sparing effect on tubercle bacilli. the most marked effect was observed with incubation of oligobacillar ... | 1990 | 2114642 |
| [the significance of l-form mycobacteria in the development of pulmonary tuberculosis]. | it was established by means of bacteriological examination that l-forms of mycobacterium tuberculosis are isolated in 42% of freshly detected cases with different clinical forms of tuberculosis of the respiratory organs. it was found that the isolated strains of microorganisms induce in guinea pigs a disease against the background of disorders of the general and specific immunological reactivity. | 1990 | 2114701 |
| tuberculous muscle abscess: an unusual presentation of tuberculosis. | | 1990 | 2114798 |
| interdigital skin test for evaluation of delayed hypersensitivity and cutaneous basophil hypersensitivity in young chickens. | a skin test to assess t-cell mediated delayed hypersensitivity (dh) and cutaneous basophil hypersensitivity (cbh) was evaluated in the interdigital skin of young chickens. three-day-old chickens were sensitized with mycobacterium tuberculosis, and the dh reaction was elicited in the interdigital skin in 10-, 17-, 24-, and 31-day-old chickens by intradermal injection of tuberculin. cutaneous basophil hypersensitivity was elicited in the interdigital skin of 10- and 14-day-old chickens by a single ... | 1990 | 2114808 |
| analysis of immunologic mechanisms of high natural killer cell activity in tuberculous pleural effusions. | we found natural killer (nk) activity to be high in tuberculous pleural effusions from which mycobacterium tuberculosis was cultured. in this study, we investigated and compared the mechanisms of this nk activity in tuberculous pleural effusions and peripheral blood. cytotoxicity was augmented in tuberculous pleural effusion mononuclear cells (pemnc) and peripheral blood mononuclear cells (pbmnc) by culture with purified protein derivative (ppd). prior to culture with ppd, there were many more i ... | 1990 | 2114810 |
| cutaneous inoculation tuberculosis in laboratory personnel. | | 1990 | 2115029 |
| abacillary pulmonary tuberculosis. | in copenhagen, a city with a low incidence of tuberculosis, 72 patients with discrete pulmonary infiltrates on the chest x-ray had a tentative diagnosis of tuberculosis. all were sputum smear negative for acid-fast bacilli. a prospective randomised study was carried out to determine whether these patients would benefit from chemotherapy. out of the 72 patients, 22 (30.6%) had positive cultures initially and were treated. of the remaining 50 patients, 22 received chemotherapy and 28 were untreate ... | 1990 | 2115215 |
| the mycobacteriology of pulmonary tuberculosis in south african gold miners. | two bacteriological surveys of gold miners with pulmonary tuberculosis diagnosed for the first time, have shown a stable level of primary drug resistance which is substantially lower than that reported for the home areas of these men. initial drug resistance was detected in 12.7% of the 205 cultures of mycobacterium tuberculosis in 1983-1984 and in 10.7% of 253 cultures in 1988-1989. resistance to isoniazid was detected in 5.4% and 5.5% of the strains tested, to streptomycin in 6.8% and 5.1% and ... | 1990 | 2115216 |
| does mycobacterium tuberculosis have plasmids? | evidence of the presence of plasmids in mycobacterium tuberculosis is lacking, whereas they are widespread in some other mycobacterial species. we examined, by agarose gel electrophoresis, a total of 197 clinical isolates of m. tuberculosis, mostly resistant to one or more antibiotics, and were able to detect bands of apparently extrachromosomal dna at a low level in some isolates. these presumptive plasmids could not be isolated by cscl/ethidium bromide gradient ultracentrifugation, and may con ... | 1990 | 2115217 |
| killing of mycobacterium tuberculosis in tissue by microwaves with simultaneous tissue fixation. | guinea-pig liver heavily infected with m. tuberculosis has been sterilised by exposure to microwaves in a standard commercially available domestic oven. subsequent histology showed good tissue preservation and organisms of normal morphology were identified by ziehl neelsen staining. the findings allow the safe use of frozen sections for diagnosis in tissue containing m. tuberculosis. | 1990 | 2115218 |
| an ordinary mortal's guide to the molecular biology of mycobacteria. | | 1990 | 2115905 |
| [tuberculosis and atypical mycobacterioses in hiv infection. results from the bonn center 1985 to 1989]. | 485 hiv-positive patients have been treated at our institution in bonn during 1985 to 1989. mycobacterial infections occurred in twelve (2.5%) hiv-positive patients. of 166 aids-manifestations according to cdc, eleven (6.6%) were mycobacterial infections. there occurred one case of miliary tuberculosis, six cases of extrapulmonary, one of disseminated tuberculosis and four cases of atypical mycobacteriosis. mycobacteriosis other than tuberculosis (mott) were caused three times by mycobacterium k ... | 1990 | 2115968 |
| [detection of serum antibody against lipoarabinomannan-b in mycobacterium tuberculosis (h37ra)]. | the serum antibody to lipoarabinomannan-b(lam-b) purified from mycobacterium tuberculosis (h37ra) was tested by elisa in 250 sera, including sera from patients as follows: tuberculosis 96, tubercular pleurisy 11, renal tuberculosis 2, bone and joint tuberculosis 33, tubercular meningitis 16, pulmonary cancer 22, leprosy 20 and normal subjects 50. the positive rate of pulmonary tuberculosis is 69.8%, which is of a similar extent in sera from patients with tuberculosis of miscellaneous organs to b ... | 1990 | 2116239 |
| passive transfer of immunity of mycobacterium avium in susceptible and resistant strains of mice. | naturally susceptible mice (c57bl/6) infected with m. avium (strain weybridge) developed a population of splenic t cells which, on transfer to syngeneic recipient mice, conferred significant protection against a subsequent challenge inoculum of m. avium. similar t cells from naturally resistant mice (a/j) did not protect syngeneic recipient mice. growth of m. avium in donor mice only occurred in the c57bl/6 strain. replication of m. avium in donor mice was necessary for the development of protec ... | 1990 | 2116245 |