| [isolation of bordetella pertussis from patients with pertussis-like symptoms and estimation of vaccine efficacy]. | in order to investigate the distribution of bordetella pertussis in nagoya city and estimate efficacy of the vaccine, we tried to isolate b. pertussis from patients with pertussis-like symptoms who went to the department of pediatric general hospitals in nagoya city from 1989 to 1992. b. pertussis were isolated from 43 patients among 164 patients with pertussis-like symptoms. all of these isolates were classified into 1, 3, 6 serotype. it was impossible to isolate any b. pertussis in 1992 becaus ... | 1994 | 7876665 |
| [the effect of the components of bordetella pertussis lipopolysaccharides on rauscher virus-induced leukosis in mice]. | | 1994 | 7879511 |
| [the interrelation of the composition of the nutrient media with the growth and biological properties of bordetella pertussis]. | | 1994 | 7879517 |
| [the determination of antibodies to bordetella pertussis exotoxin in donor sera and in the raw material for obtaining normal human immunoglobulin]. | | 1994 | 7879557 |
| expression of the bordetella pertussis p.69 pertactin adhesin in escherichia coli: fate of the carboxy-terminal domain. | the mature pertactin protein (p.69) of bordetella pertussis can be isolated from the bacterial cell surface as a polypeptide with an apparent molecular mass of 69,000 da as determined by sodium dodecyl sulphate gel electrophoresis. however the open reading frame of prn, the pertactin gene, encodes a polypeptide with a predicted molecular mass of 93,478 da, referred to as p.93. expression of the prn gene in escherichia coli leads to the synthesis of the full-length p.93 polypeptide, which is rapi ... | 1994 | 7881548 |
| negative staining can cause clumping of bordetella pertussis fimbriae. | the state of fimbriae type 2 (fim 2) and fimbriae type 3 (fim 3) preparations from bordetella pertussis were examined by negative stain electron microscopy. uranyl acetate induced clumping of fim 3 regardless of ph and was unsuitable as a stain for establishing the state of fimbriae. both ammonium molybdate and sodium phosphotungstate were able to show the differences in fim 3 stored at ph 7.2 and ph 9.5. | 1994 | 7881899 |
| inhibition of leukocyte-endothelial cell interactions and inflammation by peptides from a bacterial adhesin which mimic coagulation factor x. | factor x (factor ten) of the coagulation cascade binds to the integrin cd11b/cd18 during inflammation, initiating procoagulant activity on the surface of leukocytes (altieri, d.c., o.r. etingin, d.s. fair, t.k. brunk, j.e. geltosky, d.p. hajjar, and t. s. edgington. 1991. science [wash.dc]. 254:1200-1202). filamentous hemagglutinin (fha), an adhesin of bordetella pertussis also binds to the cd11b/cd18 integrin (relman d., e. tuomanen, s. falkow, d.t. golenbock, k. saukkonen, and s.d. wright. 199 ... | 1995 | 7883955 |
| translocation of a hybrid yope-adenylate cyclase from yersinia enterocolitica into hela cells. | pathogenic bacteria of the genus yersinia release in vitro a set of antihost proteins called yops. upon infection of cultured epithelial cells, extracellular yersinia pseudotuberculosis transfers yope across the host cell plasma membrane. to facilitate the study of this translocation process, we constructed a recombinant yersinia enterocolitica strain producing yope fused to a reporter enzyme. as a reporter, we selected the calmodulin-dependent adenylate cyclase of bordetella pertussis and we mo ... | 1994 | 7885236 |
| obtention of ovine ige from heterohybridoma. | mesenteric and bronchial lymph node cells from sheep immunized with ascaris suum antigens in combination with bordetella pertussis vaccine were fused with mouse myeloma cell lines, p3-x63-ag8.653, nso.u and ns1.1.ag1.1. one heterohybridoma cell line (ns1.1.ag1.1 x sheep) producing ovine immunoglobulin e was detected by the passive cutaneous anaphylaxis test. | 1994 | 7889039 |
| adjuvanticity and protective immunity elicited by bordetella pertussis antigens encapsulated in poly(dl-lactide-co-glycolide) microspheres. | purified bordetella pertussis antigens, encapsulated in biodegradable poly(dl-lactide-co-glycolide) (dl-plg) microspheres, were evaluated for their immunogenicity and ability to elicit a protective immune response against b. pertussis respiratory infection. microencapsulated pertussis toxoid, filamentous hemagglutinin, and pertactin all retained their immunogenicity when administered parenterally. intranasal immunization with a low dose (1 micrograms) of encapsulated filamentous hemagglutinin, p ... | 1995 | 7890372 |
| the kappa opioid receptor expressed on the mouse r1.1 thymoma cell line down-regulates without desensitizing during chronic opioid exposure. | the r1.1 mouse thymoma cell line expresses a single class of kappa opioid receptors that is negatively coupled to adenylyl cyclase through a bordetella pertussis toxin-sensitive inhibitory guanine nucleotide-binding protein. the aim of the present study was to determine whether chronic opioid treatment of r1.1 cells altered either the binding properties or the functional response associated with the kappa opioid receptor. culturing of r1.1 cells with the kappa-selective agonist (trans)-3,4-dichl ... | 1995 | 7891351 |
| common ancestry between incn conjugal transfer genes and macromolecular export systems of plant and animal pathogens. | the dna sequence of a cluster of pkm101 conjugal transfer genes was determined and aligned with the genetic map of the plasmid. eighteen genes were identified, at least eight and probably 11 of which are required for efficient conjugation. these tra genes are homologous to and colinear with genes found in the virb operon of agrobacterium tumefaciens ti plasmids. seven pkm101 tra genes are also homologous to ptl genes of bordetella pertussis, which direct the export of pertussis toxin. we used tn ... | 1994 | 7891554 |
| pertussis infection in adults with persistent cough. | to determine the prevalence of bordetella pertussis infection in adult patients with persistent cough. | 1995 | 7897789 |
| a comparison of the dna fragment patterns of the mouse-virulent challenge strains and clinical isolates of bordetella pertussis. | the dna fragment patterns of two mouse-virulent strains of bordetella pertussis, commonly used in animal protection tests, were compared to those of clinical isolates. strain w.18-323 and six variants were examined together with strain 353/z and two variants. chromosomal dna was digested with the rare-cutting enzyme xba i in order to produce relatively large fragments resolved by pulsed-field gel electrophoresis. the resulting dna fragment patterns of strain 353/z and those of its variants were ... | 1993 | 7901284 |
| localization of the binding site of an antibody affecting atpase activity of chaperonin cpn60 from bordetella pertussis. | image processing has revealed the attachment site of antibody 54g8 on chaperonin 60 (cpn60) from bordetella pertussis. this antibody, previously shown to affect the ability of chaperonin 10 (cpn10) to inhibit the atpase activity of cpn60, is attached at the ends of the cpn60 and links the molecules into long chains. when only fab fragments, which also affect atpase activity, are used for labeling, these attach to both ends of the cpn60 molecule, but the long chains are not seen. some perturbatio ... | 1993 | 7902725 |
| thymus changes in experimentally induced myasthenia gravis. | experimental myasthenia gravis (emg) was elicited in female ao rats, 8-12 weeks of age, by injection of 100 micrograms/rat torpedo marmorata acetylcholine receptor (achr)-protein incorporated in cfa. bordetella pertussis, 24 x 10(9) microorganisms, rat, was injected simultaneously as additional adjuvant. rats were sacrificed on the day of appearance of the clinical signs of emg, and thymuses were used for histological analysis using stereologic method, and thymocyte subsets were estimated by flo ... | 1993 | 7903560 |
| identification of a gene essential for piliation in haemophilus influenzae type b with homology to the pilus assembly platform genes of gram-negative bacteria. | haemophilus influenzae type b (hib) pili are complex filamentous surface structures consisting predominantly of pilin protein subunits. the gene encoding the major pilin protein subunit of hib adherence pili has been cloned and its nucleotide sequence has been determined. in order to identify specific accessory genes involved in pilus expression and assembly, we constructed isogenic hib mutants containing insertional chromosomal mutations in the dna flanking the pilin structural gene. these muta ... | 1994 | 7905461 |
| recommendations for use of the polymerase chain reaction in the diagnosis of bordetella pertussis infections. | | 1994 | 7911841 |
| lewis antigen expression on human monocytes and binding of pyrogenic toxins. | toxigenic bacteria such as bordetella pertussis and staphylococcus aureus have been implicated in some cases of sudden infant death syndrome (sids). we have previously demonstrated that the lewis(a) antigen is an epithelial cell receptor for s. aureus, and this study demonstrated that lewis(a) on human monocytes is also a receptor for staphylococcal enterotoxin b (seb). values obtained in assays for production of tnf-alpha and nitric oxide were greater for monocytes treated with seb compared wit ... | 1994 | 7915870 |
| [nucleotide sequence and properties of a transposon-like structure cloned from a bordetella pertussis chromosome]. | the 2.3 kb bamhi-ecori subclone has been isolated and sequenced from the 15 kb bamhi chromosomal fragment of bordetella pertussis comprising also the vir gene. the sequence contained one copy of a transposon-like structure, very similar to the rss of b. pertussis recently characterized, the unique sequence of b. pertussis chromosomal dna and an inverted sequence complementary to 402 bp of 3' end of the b. pertussis rs element. the fragment of plasmid puc4k containing the gene for kanamycin resis ... | 1993 | 7916732 |
| d2 inhibition of stimulated fos immunoreactivity in cultured tyrosine hydroxylase-ir hypothalamic neurons. | we have previously demonstrated that fos immunoreactivity can be stimulated by kcl, forskolin or glutamate in cultured tyrosine hydroxylase-immunoreactive (th-ir) hypothalamic neurons. the present study was performed to determine whether agents that regulate dopaminergic activity, particularly d1 and d2 receptor agonists, modulate the intracellular cascade leading to fos expression. dissociated hypothalamic cultures were prepared from neonatal rats. the cultures were treated with d1- or d2-speci ... | 1994 | 7922580 |
| monocyte chemotactic proteins mcp-1, mcp-2, and mcp-3 are major attractants for human cd4+ and cd8+ t lymphocytes. | the responses of lymphocytes to six cc chemokines--mcp-1, mcp-2, mcp-3, mip-1 alpha, mip-1 beta, and rantes--were studied using cloned human cd4+ and cd8+ t cells. all cc chemokines tested induced migration of both types of lymphocytes, whereas two cxc chemokines used as controls, il-8 and ip-10, were inactive. the monocyte chemotactic proteins (mcp-1, mcp-2, and mcp-3) showed a typically bimodal concentration dependence, and were considerably more effective than mip-1 alpha, mip-1 beta, or rant ... | 1994 | 7926371 |
| [enhanced antibody production by lung lymphocytes after oral immunization with bordetella pertussis surface antigens]. | the purpose of our study was to evaluate the effect of oral vaccination with bordetella pertussis surface antigens on the immune response at the site of antigen application. we orally immunized female balb/c mice on five consecutive days and repeated this procedure after a free interval of 10 days. lymphocytes of the lung (ll), peyer's patches (ppl) and lamina propria of the gut (lpl) were isolated and the immunoglobulin secretion rate was measured with time-resolved immunofluorescence. oral imm ... | 1994 | 7927468 |
| surface-associated filamentous hemagglutinin induces autoagglutination of bordetella pertussis. | filamentous hemagglutinin (fha) is a major adhesin produced by bordetella pertussis, the etiologic agent of whooping cough. fha has been shown to be surface associated but is also secreted by virulent bacteria. microscopic observations of lungs of mice infected with b. pertussis showed that the bacteria grow as clusters within the alveolar lumen. when b. pertussis was cultivated in vitro with chemically defined medium, bacteria grew as aggregates, mimicking growth observed in vivo. this aggregat ... | 1994 | 7927683 |
| localization of high-molecular-weight adhesion proteins of nontypeable haemophilus influenzae by immunoelectron microscopy. | a family of high-molecular-weight (hmw) surface-exposed proteins important in the attachment of nontypeable haemophilus influenzae (nthi) to human epithelial cells was previously identified (j. w. st. geme iii, s. falkow, and s. j. barenkamp, proc. natl. acad. sci. usa 90:2875-2879, 1993). in the present investigation, indirect immunogold labeling and electron microscopy were used to localize these proteins on three clinical isolates of nthi, mutants deficient in expression of one or both hmw pr ... | 1994 | 7927710 |
| cloning and sequencing of a bordetella pertussis serum resistance locus. | we have characterized a new virulence factor in bordetella pertussis: serum resistance. compared with escherichia coli hb101, wild-type b. pertussis was relatively resistant to classical-pathway, complement-dependent killing by normal human serum. however, a mutant of b. pertussis (bpm2041) which is less virulent in mice and which has tn5 lac inserted in a previously uncharacterized bvg-regulated gene was found to be at least 10-fold more susceptible to serum killing than the wild type. we have ... | 1994 | 7927748 |
| virulence factors determine attachment and ingestion of nonopsonized and opsonized bordetella pertussis by human monocytes. | in the present study, the role of virulence factors in and the effect of opsonization on the interactions between bordetella pertussis and human monocytes were investigated. the methods used facilitated the distinction between attachment and ingestion of bacteria by monocytes. nonopsonized virulent b. pertussis cells attached to monocytes. nonopsonized b. pertussis mutant strains deficient in filamentous hemagglutinin, fimbriae, or pertactin exhibited a reduced adherence to monocytes compared wi ... | 1994 | 7927760 |
| sulfated glycoconjugate receptors for the bordetella pertussis adhesin filamentous hemagglutinin (fha) and mapping of the heparin-binding domain on fha. | filamentous hemagglutinin (fha) is a major adhesin present on the surface of the gram-negative respiratory pathogen bordetella pertussis. a number of binding mechanisms have been described for the interaction of fha with eukaryotic cells. we have focused on its function as a sulfated polysaccharide-binding protein and on identifying potential receptors for fha on the epithelial cell surface. using a thin-layer overlay technique, we found that fha binds specifically to sulfated glycolipids but no ... | 1994 | 7927782 |
| outcomes of bordetella pertussis infection in different age groups of an immunized population. | outcomes of bordetella pertussis infection were studied in 3 age groups (1-3, 4-6, and 7-15 years) during outbreaks in one day care center (n = 29) and in two elementary schools (n = 210). a total of 76 children were confirmed as having b. pertussis infection; 74 were confirmed by polymerase chain reaction (pcr) and 18 by culture. a positive pcr result was less common in children 1-3 years old than in those 4-6 (p = .006). asymptomatic b. pertussis infection was more common in preschool children ... | 1994 | 7930729 |
| bordetella pertussis filamentous hemagglutinin interacts with a leukocyte signal transduction complex and stimulates bacterial adherence to monocyte cr3 (cd11b/cd18). | bordetella pertussis, the causative agent of whooping cough, adheres to human monocytes/macrophages by means of a bacterial surface-associated protein, filamentous hemagglutinin (fha) and the leukocyte integrin, complement receptor 3 (cr3, alpha m beta 2, cd11b/cd18). we show that an fha arg-gly-asp site induces enhanced b. pertussis binding to monocytes, and that this enhancement is blocked by antibodies directed against cr3. enhancement requires a monocyte signal transduction complex, composed ... | 1994 | 7931059 |
| [bacteriological and clinical studies of biapenem (l-627) in pediatrics]. | bacteriological and clinical studies in the pediatric field have been performed on biapenem (l-627), a newly-developed carbapenem antibiotic, and the following results were obtained. 1. in the pharmacokinetic study, the plasma concentration of l-627 showed dose-dependant change: cmax was 14.6 micrograms/ml and auc was 15.4 micrograms.hr/ml with the administration of 6 mg/kg, while cmax was 49.2 micrograms/ml and auc was 60.1 micrograms.hr/ml with the administration of 12 mg/kg. after the adminis ... | 1994 | 7933527 |
| repeat sequences in the bordetella pertussis adenylate cyclase toxin can be recognized as alternative carboxy-proximal secretion signals by the escherichia coli alpha-haemolysin translocator. | the 1706-residue adenylate cyclase toxin (cyaa) of bordetella pertussis is an rtx protein with extensive carboxy-proximal glycine and aspartate-rich repeats. cyaa does not have a cleavable amino-terminal signal peptide and can be secreted across both bacterial membranes of the escherichia coli cell envelope by the alpha-haemolysin (hlya) translocator (hlybd/tolc). we performed deletion mapping of secretion signals recognized in cyaa by this heterologous translocator. truncated proteins with n-te ... | 1993 | 7934926 |
| effects of thermocyclers and primers on the reproducibility of banding patterns in randomly amplified polymorphic dna analysis. | the effects of thermocyclers and primers on the reproducibility of banding patterns in randomly amplified polymorphic dna analysis were tested. purified bordetella pertussis dna was analysed with four primers (12-mer), which did not differ from each other in their gc-content. three different thermocycler models from two manufacturers were tested. three of the primers produced consistent banding patterns in separate wells of the reaction plates of individual thermocyclers, and in different thermo ... | 1994 | 7935514 |
| internal lysine palmitoylation in adenylate cyclase toxin from bordetella pertussis. | a number of bacterial protein toxins, including adenylate cyclase (ac) toxin from bordetella pertussis, require the product of an accessory gene in order to express their biological activities. in this study, mass spectrometry was used to demonstrate that activated, wild-type ac toxin was modified by amide-linked palmitoylation on the epsilon-amino group of lysine 983. this modification was absent from a mutant in which the accessory gene had been disrupted. a synthetic palmitoylated peptide cor ... | 1994 | 7939682 |
| [an investigation of factors in the pathogenesis of experimental autoimmune uveoretinitis (eau) in congenic mice]. | s-antigen or interphotoreceptor retinoid-binding protein (irbp), when injected with freund's complete adjuvant into mice, does not easily cause experimental autoimmune uveoretinitis (eau). in this report, we describe the results of injecting irbp with freund's complete adjuvant, together with the intraperitoneal administration of bordetella pertussis, into several types of congenic mice (b10, b10a, b10br, b10d2). these congenic mice, of c57bl/10 (b10) origin, differ at the h-2 locus on chromosom ... | 1994 | 7942337 |
| yersinia-specific antibodies in serum and synovial fluid in patients with yersinia triggered reactive arthritis. | to further evaluate the role of bacterial antigens in triggering inflammation in the joint in patients with reactive arthritis by studying local antibody synthesis in the joint. | 1994 | 7944640 |
| immunoelectron microscopy of antigens of bordetella pertussis using monoclonal antibodies to agglutinogens 2 and 3, filamentous haemagglutinin, pertussis toxin, pertactin and adenylate cyclase toxin. | immunogold electron microscopy and monoclonal antibodies (mabs) were used to localize surface-related antigens of bordetella pertussis. unfixed organisms of b. pertussis strains which are included in the danish whole-cell pertussis vaccine and fixed cells from a vial of vaccine were examined. mabs to agglutinogens 2 and 3 labelled fimbria-like structures on both live and fixed cells in a serotype-specific manner. mab against pertactin, a 69 kda outer membrane protein, produced intense labelling ... | 1994 | 7946271 |
| primers are decisive for sensitivity of pcr. | a sufficient sensitivity of pcr is a prerequisite for its use in the diagnosis of infectious diseases. we have used pcr for detecting gene elements of borrelia burgdorferi, mycobacteria and bordetella pertussis. with all these microbe groups, difficulties were encountered in achieving the demanded sensitivity with the primer pairs primarily selected. an extensive testing of various reaction parameters did not improve the sensitivity. subsequently, we synthesized more primers derived from slightl ... | 1994 | 7946322 |
| activation of phospholipase d by interleukin-8 in human neutrophils. | interleukin 8 (il-8), a member of the c-x-c branch of the chemokine superfamily, stimulated the breakdown of 1-o-[3h]alkyl-2-acyl-sn-glycero-3-phosphocholine ([3h]eapc) and the formation of 1-o-[3h]alkyl-2-acyl-phosphatidic acid ([3h]-eapa) in human polymorphonuclear leukocytes (pmn) in the presence of cytochalasin b. in addition, the mass of diradyl-pa was increased with similar kinetics. in the presence of ethanol, 1-o-[3h]alkyl-2-acyl-phosphatidylethanol ([3h]eapet) was formed at the expense ... | 1994 | 7949145 |
| recombinant thyrotropin receptor and the induction of autoimmune thyroid disease in balb/c mice: a new animal model. | in a preliminary study, we observed the production of tsh binding-inhibiting (tbii) and thyroid-blocking (tbab) antibodies accompanied by lymphocytic infiltration of the thyroid in a pool of male balb/c mice immunized with the extracellular domain (ecd) of the human tsh receptor (tshr) expressed as a maltose-binding protein (mbp) fusion in bacteria. in the present study we evaluated the humoral response to the same antigenic preparation in a new series of individual male and female balb/c mice i ... | 1994 | 7956939 |
| role of pertussis toxin in causing symptoms of bordetella parapertussis infection. | whooping cough can be caused by either bordetella pertussis or bordetella parapertussis. although the two species share an almost complete dna identity, bordetella parapertussis does not produce pertussis toxin, which is thought to be the main virulence factor of bordetella pertussis. in order to elucidate the role of pertussis toxin in causing the typical symptoms of whooping cough, clinical information from 33 patients with culture-positive bordetella parapertussis infection was collected and ... | 1994 | 7957264 |
| mutations in the linker region of bvgs abolish response to environmental signals for the regulation of the virulence factors in bordetella pertussis. | expression of virulence factors of bordetella pertussis is coordinately regulated by the products of the bvg locus, which codes for a sensory protein (bvgs) and a positive regulator of transcription (bvga), a pair in the family of bacterial 'two-component' regulators. transcription of the bvg-regulated promoters is repressed by modulating environmental factors such as 50 mm mgso4, 10 mm nicotinic acid (na) or low temperature (25 degrees c). we have isolated a spontaneous mutant (sk170) which exp ... | 1994 | 7959037 |
| invasion and intracellular survival of bordetella bronchiseptica in mouse dendritic cells. | we have studied the interaction between the respiratory pathogen bordetella bronchiseptica and murine spleen dendritic cells, important antigen-presenting cells that are found in the airway epithelium. wild-type b. bronchiseptica 5376 attached very efficiently to dendritic cells, whereas the bvg mutant atcc 10580, wild-type strain bb7865, and its spontaneous delta bvgs mutant bb7866 bound less efficiently. however, all tested b. bronchiseptica strains were able to invade dendritic cells and surv ... | 1994 | 7960135 |
| hfr mapping of mutations in bordetella pertussis that define a genetic locus involved in virulence gene regulation. | we report the development of techniques for the genetic mapping of point mutations in the bacterial pathogen bordetella pertussis. a plasmid vector which is self-transmissible by conjugation and which, by insertion into the b. pertussis chromosome, can mobilize chromosomal sequences during conjugation with a recipient b. pertussis bacterium has been constructed. this vector is used in conjunction with a set of strains containing kanamycin resistance gene insertions at defined physical locations ... | 1994 | 7961497 |
| effect of mutations causing overexpression of rna polymerase alpha subunit on regulation of virulence factors in bordetella pertussis. | in bordetella pertussis, expression of virulence factors is controlled by the bvg proteins, which comprise a sensor-regulator two-component signal transduction system. previously, we described a mutant strain of b. pertussis that had reduced transcription of pertussis toxin and adenylate cyclase toxin genes, while other virulence factors were relatively unaffected. we obtained a b. pertussis clone that repaired the defect in both this strain and an independent mutant strain with a similar phenot ... | 1994 | 7961498 |
| circulating fibronectin and fibronectin receptor in children with pertussis. | to determine concentrations of fibronectin and fibronectin receptor in children with pertussis. | 1994 | 7962645 |
| erythromycin-resistant bordetella pertussis--yuma county, arizona, may-october 1994. | in 1993, a total of 6586 cases of pertussis was reported in the united states, including 70 in arizona. on june 27, 1994, a case of bordetella pertussis disease caused by a strain resistant to erythromycin was reported to the arizona department of health services (adhs) from yuma county (1990 population: 106,895). susceptibility testing at cdc confirmed that the isolate was highly resistant to erythromycin with a minimum inhibitory concentration (mic) > 64 micrograms/ml. the mic of erythromycin ... | 1994 | 7968996 |
| inhibition of anaphylactic shock by gadolinium chloride-induced kupffer cell blockade. | data in the literature concerning the role of macrophages in anaphylaxis are contradictory. in the present study, the effect of macrophage blockade induced by gadolinium chloride (gdcl3) on anaphylactic shock is investigated. our observations show that gdcl3 prevents lethal anaphylactic shock in mice sensitized to ovalbumin. gadolinium chloride given i.v. in a dose of 1 mg/100 g body weight 24 or 48 h before the elicitation of anaphylactic shock resulted in 80% survival, compared with the 43% su ... | 1994 | 7976819 |
| pertussis toxin stimulates hypersensitivity and enhances nerve-mediated antigen uptake in rat intestine. | we previously reported that intestine from rats sensitized to ovalbumin (ova), using bordetella pertussis vaccine as adjuvant, demonstrated a rapid secretory response [increase in short-circuit current (isc)] to ova upon secondary challenge. here, we examined the role of pertussis toxin, the active component of the vaccine, in the response. sensitization of sprague-dawley rats by intraperitoneal injection of recombinant wild-type pertussis toxin (wpt) plus ova enhanced intestinal responses (at d ... | 1994 | 7977735 |
| effect of erythromycin treatment on antibody responses in pertussis. | the effect of erythromycin treatment on antibody responses to bordetella pertussis filamentous haemagglutinin (fha) and pertussis toxin (pt) was investigated in convalescent blood samples from 105 children with pertussis. erythromycin had been given to 59 children, median age 3.2 years (range 0.3-9.9) on median day 7 (range 11-14) after onset of disease while the remaining 46 children, age 3.45 (0.6-8.1) were untreated. no significant differences in igg antibody concentration were noted to fha b ... | 1994 | 7984978 |
| from the centers for disease control and prevention. erythromycin-resistant bordetella pertussis--yuma county, arizona, may-october 1994. | | 1995 | 7996637 |
| update of the rapid diagnosis of infectious diseases. i: bacteria, fungi and parasites. | the application of monoclonal antibodies and dna probes in the clinical microbiology laboratory has resulted in an array of rapid diagnostic tests. the immunofluorescent assay or enzyme-linked immunoassay is widely used in the rapid diagnosis of bacteria eg group a streptococcus, legionella pneumophila, mycoplasma pneumoniae, bordetella pertussis; parasites eg chlamydia tachomatis, cryptosporidium species; and fungi eg pneumocystis carinii. the bactec system was first introduced to detect bacter ... | 1994 | 7997914 |
| analysis of immunogenic properties of nonapeptide tvgrgdphq from bordetella pertussis filamentous hemagglutinin. | immunogenic properties of tvgrgdphq nonapeptide which is correspondent to the region 1094-1102 of b. pertussis filamentous hemagglutinin (fha) were studied. the conjugate of bovine serum albumin with nonapeptide was used for immunization of balb/c and cba mice. antisera of the both lines of mice cross-reacted with a number of antigens, but using affinity chromatography peptide and fha specific antibodies were extracted. affinity purified rabbit antibodies to tvgrgphq which recognize fha were als ... | 1994 | 7998347 |
| characterization of murine lung inflammation after infection with parental bordetella pertussis and mutants deficient in adhesins or toxins. | bordetella pertussis expresses factors such as filamentous hemagglutinin, agglutinogens, pertactin, and pertussis toxin, which participate in bacterial adhesion; pertussis toxin, dermonecrotic toxin, lipopolysaccharide, and tracheal cytotoxin, which are responsible for toxic effects; and adenylate cyclase-hemolysin, which is required to initiate infection. by using a murine respiratory model, we showed that the rgd sequences of filamentous hemagglutinin and pertactin are important for bacterial ... | 1994 | 7999145 |
| epithelial cell invasion and survival of bordetella bronchiseptica. | wild-type bordetella bronchiseptica and a bvg mutant strain were used for invasion and survival experiments in human caco-2 and a549 epithelial cells. both bacterial strains were able to enter and persist within the host cells for at least a week. a significant proportion of the bacteria from both b. bronchiseptica strains but not from bordetella pertussis were found free in the cytoplasm, suggesting different invasion and survival strategies of the two species in epithelial cells. | 1994 | 8005690 |
| bordetella pertussis diagnosed by polymerase chain reaction. | the object of this work was to test the polymerase chain reaction (pcr) for demonstration of bordetella pertussis (bp) in nasopharyngeal secretions. the method was applied to patients with recently diagnosed pertussis, as verified by bp culture. in order to test the sensitivity and specificity of pcr for the diagnosis of bp, we used known concentrations of bp, bordetella parapertussis and bordetella bronchiseptica in aqueous solutions. pcr was furthermore carried out on species of bacteria that ... | 1994 | 8011307 |
| inhibition of pcr-based assay for bordetella pertussis by using calcium alginate fiber and aluminum shaft components of a nasopharyngeal swab. | a pcr-based assay for bordetella pertussis was inhibited by using a calcium alginate fiber-tipped swab with an aluminum shaft but not by using a dacron fiber-tipped swab with a plastic shaft. the calcium alginate fiber component inhibited the assay following storage for less than 1 min in a suspension of 10(3) cfu of b. pertussis per ml, whereas the aluminum shaft component required storage for at least 48 h in order to cause inhibition. we recommend the dacron swab over the calcium alginate swa ... | 1994 | 8027309 |
| identification of bordetella pertussis in nasopharyngeal swabs using the polymerase chain reaction: evaluation of detection methods. | a 183 base pairs or 153 base pairs dna fragment from a repetitive region of the bordetella pertussis genome was amplified in a polymerase chain reaction. the sensitivities of three different detection methods (enzymun test, silver stained polyacrylamide gel, ethidium bromide stained agarose gel) after amplification by polymerase chain reaction showed that both a one-time polymerase chain reaction (35 cycles) with enzymun testing as well as a nested polymerase chain reaction with either of the el ... | 1994 | 8031967 |
| clinical characteristics of illness caused by bordetella parapertussis compared with illness caused by bordetella pertussis. | in conjunction with a pertussis vaccine efficacy trial in germany, nasopharyngeal specimens were collected from may, 1992, to march, 1993, from patients with cough illnesses. clinical data were obtained by initial and follow-up questionnaires. bordetella parapertussis was isolated from 38 patients (mean age, 3.5 years; 68% girls). clinical characteristics in these cases were compared with those of 76 patients (matched by age and sex) with illness caused by bordetella pertussis during the same pe ... | 1994 | 8036048 |
| genes encoding high-molecular-weight adhesion proteins of nontypeable haemophilus influenzae are part of gene clusters. | we previously reported the cloning and sequencing of genes designated hmw1 and hmw2 from a prototype nontypeable haemophilus influenzae strain. the genes encode proteins which are related to filamentous hemagglutinin of bordetella pertussis and promote attachment of the nontypeable h. influenzae strain to human epithelial cells (j. w. st. geme iii, s. falkow, and s. j. barenkamp, proc. natl. acad. sci. usa 90:2875-2879, 1993). subcloning studies suggested that correct processing of these high-mo ... | 1994 | 8039903 |
| bvgas-mediated signal transduction: analysis of phase-locked regulatory mutants of bordetella bronchiseptica in a rabbit model. | members of the bordetella genus alternate between two distinct phenotypic phases in response to changes in their environment. this switch, termed phenotypic modulation, is mediated by the bvgas sensory transduction system. we developed an animal model based on the interaction of bordetella bronchiseptica with one of its natural hosts, the rabbit. to investigate the importance of bvgas signal transduction, we constructed constitutive (rb53) and bvg- (rb54) phase-locked derivatives of a wild-type ... | 1994 | 8039908 |
| structure of a hexasaccharide proximal to the hydrophobic region of lipopolysaccharides present in bordetella pertussis endotoxin preparations. | a branched-chain hexasaccharide containing 3-deoxy-d-manno-oct-2-ulosonic acid was released by detergent-promoted hydrolysis from bordetella pertussis endotoxin preparations that were first dephosphorylated with aqueous hf and then treated with nitrous acid. its structure (2) [formula: see text] was determined by chemical and physical methods. this hexasaccharide is present in all four lipopolysaccharides that make up the b. pertussis strain 1414 (phase 1) endotoxin preparations analysed, and is ... | 1994 | 8050099 |
| activation of gi protein by peptide structures of the muscarinic m2 receptor second intracellular loop. | the muscarinic m2 receptor that normally couples via gi to inhibit adenylyl cyclase was made to couple to gs by exchange of its third intracellular loop for the comparable domain of the beta 2-adrenoceptor. in hela cells transfected with the recombinant m2 beta i-3 cdna, the chimaeric receptor showed carbachol-mediated activation of adenylyl cyclase (ec50 = 73 nm) that was blocked by atropine, but not by propranolol. the chimaeric receptor was shown to mediate a carbachol-stimulated, bordetella ... | 1994 | 8050479 |
| structural characterization of the lipid a of bordetella pertussis 1414 endotoxin. | the structure of bordetella pertussis 1414 lipid a was investigated by classical methods of chemical analysis as well as plasma desorption mass spectrometry and fast atom bombardment mass spectrometry. previous analysis showed that it contained a bisphosphorylated beta-(1-->6)-linked d-glucosamine disaccharide with hydroxytetradecanoic acid in amide linkage. the presence of two main molecular species as seen by thin-layer chromatography was confirmed by plasma desorption mass spectrometry, in wh ... | 1994 | 8051033 |
| mutations in the bordetella pertussis bvgs gene that confer altered expression of the fhab gene in escherichia coli. | the bvg locus of bordetella pertussis, required for coordinate regulation of virulence genes in response to environmental signals, encodes two proteins, bvgs and bvga, that belong to the bacterial two-component signal transduction systems. we have isolated spontaneous mutations of the bvg locus in escherichia coli and analyzed their effects on the expression of fhab::laczy transcriptional fusions. the mutations, localized in the linker and transmitter domain of bvgs, result in increased activati ... | 1994 | 8051035 |
| characterization of the dermonecrotic toxin in members of the genus bordetella. | all members of the genus bordetella and pasteurella multocida (a gram-negative bacillus genetically unrelated to bordetella spp., yet often sharing the same ecological niche) produce a dermonecrotic toxin (dnt). the amount of toxin produced and the time required for appearance of the lesions are identical for bordetella pertussis, b. parapertussis, and b. bronchiseptica but different for p. multocida and b. avium. dnt has been reported to act by promoting vasoconstriction; however, vasoactive co ... | 1994 | 8063398 |
| shuttle mutagenesis of legionella pneumophila: identification of a gene associated with host cell cytopathicity. | we performed shuttle mutagenesis of legionella pneumophila. mutants were screened for reduced cellular infectivity. approximately 10% of the mutants had decreased cytopathicity. the dna sequence of one locus was determined; the inferred amino acid sequence revealed homology with transport proteins including escherichia coli tolc, bordetella pertussis cyae, and alcaligenes eutrophus czcc and cnrc. | 1994 | 8063428 |
| the modular architecture of bacterial response regulators. insights into the activation mechanism of the bvga transactivator of bordetella pertussis. | control of virulence factor expression in bordetella pertussis is mediated by the products of the bvg operon. the bvgs membrane protein responds to certain environmental cues by activating the bvga protein, which in turn modulates the expression of the target virulence factor genes. the bvga and bvgs proteins are members of a large family of sensory transduction proteins called the two-component systems. we show that bvga fusion proteins can activate transcription of a reporter gene containing t ... | 1994 | 8064853 |
| surveillance for bordetella pertussis infection in victoria. | our aims were to describe the epidemiology of bordetella pertussis infection in victoria during the last decade and to evaluate surveillance of b. pertussis by comparing notifications with laboratory isolations and hospital diagnoses. whooping cough was once a leading cause of childhood morbidity and mortality but there was a dramatic reduction in the 1940s because of immunisation. during the last two decades, controversy about the vaccine's toxicity has resulted in waning immunisation rates and ... | 1994 | 8068787 |
| bordetella pertussis as a cause of chronic respiratory infection in an aids patient. | a 60-year-old heterosexual man with aids was admitted to hospital with dyspnea, a severe paroxysmal non-productive cough of two months' duration, low-grade fever and exhaustion. bordetella pertussis was cultured from a bronchoalveolar lavage specimen. after erythromycin therapy (500 mg q.i.d. for two weeks) all respiratory symptoms resolved progressively over a four-week period. bordetella pertussis should be added to the long list of pathogens that may cause respiratory disease in persons with ... | 1994 | 8070437 |
| the product of the virb4 gene of agrobacterium tumefaciens promotes accumulation of virb3 protein. | the process of t-dna transfer from agrobacterium tumefaciens to plant cells is thought to involve passage of a dna-protein complex through a specialized structure in the bacterial membrane. the virb operon of a. tumefaciens encodes 11 proteins, of which 9 are known to be located in the membranes and 10 have been shown to be essential for virulence. sequence comparisons between proteins encoded by the virb operon and those encoded by operons from conjugative plasmids indicated that virb proteins ... | 1994 | 8071199 |
| detection and subcellular localization of three ptl proteins involved in the secretion of pertussis toxin from bordetella pertussis. | the ptl locus of bordetella pertussis contains eight open reading frames which are predicted to encode proteins (ptla to ptlh) that are essential for secretion of pertussis toxin from the bacterium and which are members of a family of transport proteins found in other types of bacteria. we have detected ptle, ptlf, and ptlg in immunoblots of extracts of b. pertussis by using antibodies raised to fusion proteins consisting of maltose-binding protein and the individual ptl proteins. these proteins ... | 1994 | 8071211 |
| the crystal structure of pertussis toxin. | pertussis toxin is an exotoxin of the a-b class produced by bordetella pertussis. the holotoxin comprises 952 residues forming six subunits (five different sequences, s1-s5). it plays an important role in the development of protective immunity to whooping cough, and is an essential component of new acellular vaccines. it is also widely used as a biochemical tool to adp-ribosylate gtp-binding proteins in the study of signal transduction. | 1994 | 8075982 |
| adenylate cyclase toxin from bordetella pertussis produces ion conductance across artificial lipid bilayers in a calcium- and polarity-dependent manner. | adenylate cyclase toxin (ac toxin) from bordetella pertussis enters target cells to produce supraphysiologic levels of camp and, by a camp-independent process, is hemolytic. in the present study, we show for the first time that this toxin also produces ion-permeable, cation-selective pores in phospholipid bilayers. the resulting membrane conductance is absolutely calcium-dependent, as are the intoxication and hemolytic activities. it is strongly affected by the polarity and magnitude of the memb ... | 1994 | 8077197 |
| viability of bordetella pertussis in four suspending solutions at three temperatures. | we studied the survival of bordetella pertussis in four suspending solutions (casamino acids broth, deionized water, phosphate-buffered saline, and serum inositol), subjected to three storage temperatures (4, -20, and -70 degrees c) and two freezing methods (direct freezing and fast-freezing in an ethanol-dry-ice bath). recovery rates were higher for longer periods for suspensions stored at -70 degrees c than those stored at -20 or 4 degrees c. serum inositol showed the highest recovery rates fo ... | 1994 | 8077402 |
| antibodies to filamentous hemagglutinin of bordetella pertussis and protection against whooping cough in schoolchildren. | a pertussis outbreak was studied prospectively in an elementary school with 39 pupils. all had been immunized with at least three doses of finnish diphtheria-tetanus toxoid-pertussis vaccine. diagnosis of pertussis was based on culture, polymerase chain reaction results, and eia serology using filamentous hemagglutinin (fha), pertussis toxin, and 69-kda outer membrane protein as antigens. at the first sampling, 21 children had symptoms suggestive of pertussis, and 18 were healthy. of the latter, ... | 1994 | 8077734 |
| [the effect of the oxidation-reduction potential of the nutrient medium on the dynamic process of bordetella pertussis cultivation]. | | 1993 | 8079526 |
| mutations in the bvga gene of bordetella pertussis that differentially affect regulation of virulence determinants. | by using chemical mutagenesis and genetic mapping, a search was undertaken for previously undescribed genes which may be involved in different regulatory mechanisms governing different virulence factors of bordetella pertussis. previous studies have shown that the fha locus encoding filamentous hemagglutinin is regulated directly by the bvgas two component system, while regulation of ptx encoding pertussis toxin is less direct or occurs by a different mechanism. with a strain containing gene fus ... | 1994 | 8083156 |
| correlation between the capacity to activate macrophages in vitro and the antitumor activity in vivo of lipopolysaccharides from different bacterial species. | the correlation between the activation of macrophages by lipopolysaccharides (lps) from four different bacterial species and their antitumor effect in a rat model of colon cancer was investigated. the efficacy of lps from neisseria meningitidis (nm), salmonella minnesota (sm), escherichia coli (ec) and bordetella pertussis (bp) was evaluated as the smallest concentration inducing rat peritoneal macrophages (pm psi) to produce tumor necrosis factor (tnf), interleukin-1 (il-1), il-6 and nitric oxi ... | 1994 | 8088853 |
| studies on the lymphocytosis induced by pertussis toxin. | pertussis toxin (pt), from bordetella pertussis, causes lymphocytosis and increased il-4 and ige secretion. the lymphocytosis is associated with impaired entry of lymphocytes into lymph nodes. the dose response of pt on il-4 secretion was found to be similar to those for lymphocytosis and ige production. these findings are consistent with the possibility that increased il-4 production by pt may be related to its effect on lymphocyte circulation. the possibility that pt may selectively influence ... | 1994 | 8088866 |
| protection against autoimmune disease by bacterial agents. ii. ppd and pertussis toxin as proteins active in protecting mice against experimental autoimmune encephalomyelitis. | bordetella pertussis and mycobacterium tuberculosis, routinely used to promote the development of autoimmune disease, were recently reported to also be effective in inducing protection against an autoimmune disease. thus, we previously demonstrated that sjl/j and (sjl/j x balb/c)f1 mice that are genetically susceptible to experimental autoimmune encephalomyelitis (eae) become highly refractory to the induction of the disease following their exposure to b. pertussis and m. tuberculosis. in the pr ... | 1993 | 8095458 |
| the clpe protein involved in biogenesis of the cs31a capsule-like antigen is a member of a periplasmic chaperone family in gram-negative bacteria. | the putative chaperone-like protein clpe, required for biogenesis of the escherichia coli capsule-like antigen cs31a, was compared with ten known periplasmic chaperones from e. coli, klebsiella pneumoniae, bordetella pertussis, haemophilus influenzae and yersinia pestis. the amino acid sequence alignment was superimposed onto the three-dimensional structure of the papd chaperone of uropathogenic e. coli, and amino acid residues involved in maintaining the structure integrity of the suggested bin ... | 1993 | 8097176 |
| transfected go1 alpha inhibits the calcium dependence of beta-adrenergic stimulated camp accumulation in c6 glioma cells. | increasing evidence indicates that heterotrimeric g proteins, and in particular go, regulate ionic channel activities. in order to investigate the role of go proteins in the modulation of the ca2+ influx, c6 glioma cells were stably transfected with alpha o1 cdna. expression of the go1 alpha protein was checked by bordetella pertussis toxin-catalyzed adp-ribosylation and western blots using one- and two-dimensional gel analyses. three clones were selected based on their degree of go1 alpha expre ... | 1993 | 8097196 |
| invasion of hela cells by bordetella bronchiseptica. | invasion, defined as adhesion to, followed by entrance into hela cells by bordetella bronchiseptica was determined by (i) specific staining of intracellular bacteria and (ii) counting of viable intracellular bacteria after killing extracellular bacteria with colistin. it was demonstrated for the first time that b. bronchiseptica, like bordetella pertussis and bordetella parapertussis, is able to invade hela cells. comparison of the invasiveness of bvg+ and bvg- b. bronchiseptica showed that b. b ... | 1993 | 8099193 |
| antibody response to accelerated immunisation with diphtheria, tetanus, pertussis vaccine. | from may, 1990, a new schedule of immunisation against diphtheria, tetanus, and pertussis (at 2, 3, and 4 months) replaced the previous more widely spaced schedule. a report that children had lower concentrations of diphtheria and tetanus antibodies a month after an accelerated schedule led us to undertake a controlled study to assess antibody response and the persistence of antibodies a year after immunisation in children receiving vaccine according to widely spaced and accelerated schedules. c ... | 1993 | 8100929 |
| a novel adherence assay for bordetella pertussis using tracheal organ cultures. | in a novel adherence model using tracheal rings removed from papio anubis, we have demonstrated a functional role for the fimbriae of bordetella pertussis. when compared to wild-type strains, b. pertussis mutants specifically deficient in fimbriae adhered less well to the tracheal rings but better to vero (green monkey kidney) cells. in contrast, mutants deficient in filamentous haemagglutinin (fha) production had reduced adherence to both vero cells and the tracheal rings. these observations in ... | 1993 | 8102339 |
| fimbriae and determination of host species specificity of bordetella bronchiseptica. | a monoclonal antibody, designated cf8 and prepared against fimbrial protein enrichments of bordetella bronchiseptica 110h, was determined by immunogold electron microscopy to bind to some but not all fimbrial filaments on intact bacterial cells. comparison of the reactivity of this antibody with that of monoclonal antibody bpf2, which is specific for bordetella pertussis serotype 2 fimbriae, indicated that cf8 recognizes an epitope similar to that recognized by bpf2. by western blot (immunoblot) ... | 1993 | 8102377 |
| reversible opening of the blood-brain barrier by anti-bacterial antibodies. | the leukocyte adhesion molecule cr3 (cd11b/cd18, mac-1) promotes leukocyte transmigration into tissues by engaging an unknown cognate ligand on the surface of vascular endothelial cells. filamentous hemagglutinin (fha), an adhesin of the bacterium bordetella pertussis, binds to cr3. we hypothesized that fha mimics the native ligand for the cr3 integrin on endothelial cells and predicted that anti-fha antibodies should bind to endothelial cells, interfere with leukocyte recruitment, and induce en ... | 1993 | 8102802 |
| the kappa opioid receptor expressed on the mouse r1.1 thymoma cell line is coupled to adenylyl cyclase through a pertussis toxin-sensitive guanine nucleotide-binding regulatory protein. | the r1.1 mouse thymoma cell line expresses a high-affinity kappa opioid binding site. opioid binding to this site is inhibited by guanine nucleotides, suggesting that the receptor is coupled to a guanine nucleotide-binding protein. here, we present evidence that the kappa opioid binding site on r1.1 cell membranes is negatively coupled to adenylyl cyclase. the kappa-selective agonists (trans)-3,4-dichloro-n-methyl-n-[2-(1-pyrrolidinyl)- cyclohexyl]benzeneacetamide methane-sulfonate hydrate [(-)- ... | 1993 | 8103800 |
| isolation of a putative fimbrial adhesin from bordetella pertussis and the identification of its gene. | we report the purification of a minor bordetella pertussis fimbrial subunit, designated fimd, and the identification of its gene (fimd). fimd could be purified from the bulk of major fimbrial subunits by exploiting the fact that major subunit-subunit interactions are more stable in the presence of sds than minor-major subunit interactions. to locate the gene for fimd, internal peptides of fimd were generated, purified and sequenced. subsequently, an oligonucleotide probe, based on the primary se ... | 1993 | 8105363 |
| chick embryo, a model to study the lethal activity of pertussis toxin, infectivity of bordetella pertussis, and their neutralization by immune sera. | the toxin activity of bordetella strains and acellular pertussis components was evaluated in chick embryos. eleven-day-old embryos were found to be most suitable for determination of ld50 values. eight of eight bordetella pertussis strains possessed ld50 values of 10(4) to 10(6) colony-forming units per dose of 100 microl. embryos were resistant to bordetella parapertussis and bordetella bronchiseptica at doses of 10(10) colony-forming units. bacterial growth did not occur in the bloodstream or ... | 1993 | 8106134 |
| rapid induction of arachidonic acid release by monocyte chemotactic protein-1 and related chemokines. role of ca2+ influx, synergism with platelet-activating factor and significance for chemotaxis. | monocyte chemotactic protein-1 (mcp-1), a member of the cys-cys branch of the chemokine superfamily, induced a mepacrine- and manoalide-sensitive increase in the release of [3h]arachidonic acid from prelabeled human monocytes and monocytic thp-1 leukemic cells. the effect was rapid (<30 s), reached maximum at optimal chemotactic concentrations, and was completely blocked by pretreatment of monocytes with bordetella pertussis toxin. a specific antiserum and heat inactivation blocked the induction ... | 1994 | 8106442 |
| high-molecular-weight surface-exposed proteins of haemophilus influenzae mediate binding to macrophages. | the molecular basis for direct bacteria-macrophage interactions that distinguishes nontypeable (nt) haemophilus influenzae from type b organisms is not known. because of similarities between filamentous hemagglutinin (fha) adhesin of bordetella pertussis and high-molecular-weight (hmw) proteins commonly expressed by nt h. influenzae, the role that hmw proteins play in determining nt h. influenzae-macrophage interactions was assessed. in tests with genetically engineered organisms, hmw protein-ex ... | 1994 | 8106776 |
| diagnostic evaluation of polymerase chain reaction discriminative for bordetella pertussis, b. parapertussis, and b. bronchiseptica. | a polymerase chain reaction (pcr) procedure for simultaneous detection and identification of bordetella pertussis, b. parapertussis, and b. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. a 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers bouni 1: 5'gcaccatcccgcatacgtgttg3', and bouni 2: 5'gtgcaacgcatcccgtcttcc ... | 1993 | 8112026 |
| heparin-inhibitable lectin activity of the filamentous hemagglutinin adhesin of bordetella pertussis. | bordetella pertussis, the etiologic agent of whooping cough, produces an outer membrane-associated filamentous hemagglutinin (fha) which is the major adhesin of this organism. fha exhibits a lectin-like activity for heparin and dextran sulfate. by using in vitro adherence assays to cultured epithelial cells, the attachment of b. pertussis was reduced in the presence of sulfated polysaccharides such as heparin and dextran sulfate but not in the presence of dextran, indicating the crucial role of ... | 1994 | 8112848 |
| cough production, leucocytosis and serology of rats infected intrabronchially with bordetella pertussis. | adult sprague-dawley rats infected intrabronchially with bordetella pertussis strain 18-323 encased in agarose beads (bp-beads), developed a paroxysmal cough and leucocytosis, both of which peaked at around day 10. when animals were exposed to ether for 2 min after delivery of the beads, there was an enhancement of the number of subsequent coughing episodes. inclusion of carrageenan in the beads also enhanced coughing. control rats, given sterile beads or left untreated, showed only a low level ... | 1994 | 8114072 |
| outbreak of pertussis in a fully immunized adolescent and adult population. | to evaluate the spread of pertussis in a fully immunized eighth-grade class and the household contacts of two coindex cases of pertussis. | 1994 | 8118532 |
| sensitive and specific polymerase chain reaction assays for detection of bordetella pertussis in nasopharyngeal specimens. | polymerase chain reaction (pcr) assays that amplify segments of a repeated gene element and a toxin promoter gene of bordetella pertussis were compared with a culture established for the diagnosis of pertussis. of 44 nasopharyngeal (np) aspirates collected during a pertussis outbreak, repeated gene element pcr showed a positive result in 21 (48%), including all three patients with positive culture results. results of toxin promoter gene pcr were positive in eight (18%) cases, and the pathogen wa ... | 1994 | 8120712 |
| newly identified genes involved in the signal transduction of escherichia coli k-12. | we cloned and sequenced two escherichia coli genes which are members of a family of an environmentally responsive two-component system. the nucleotide (nt) and deduced amino-acid sequences of these two genes were found to be homologous to those of the bordetella pertussis bvga and bvgs genes. they were mapped at 51 min (clones 6b9 to 7g9 of the kohara miniset library of the e. coli chromosome). both proteins, deduced from their nt sequences, were identified in the coupled in vitro transcription- ... | 1994 | 8125343 |
| calmodulin-activated bacterial adenylate cyclases as virulence factors. | bordetella pertussis and bacillus anthracis each produce a virulence-associated, calmodulin-dependent adenylate cyclase toxin, which generates increased levels of cyclic amp in eukaryotic cells. the two proteins share sequence similarities in their catalytic domains. the remaining regions display different structural and functional organizations that account for the differences both in interaction of the two toxins with target cells and in the resulting disease symptoms. | 1993 | 8143137 |