| perinatally acquired neonatal tuberculosis: report of two cases. | perinatally acquired neonatal tuberculosis occurs rarely, is difficult to diagnose, may be the indicator of untreated tuberculosis in the mother, and could result in nosocomial transmission to neonatal patients, visitors to neonatal intensive care units, and health care workers. the disease may be more common in certain ethnic and social groups. neonatal mortality approaches 30%. we report two cases with different outcomes. a neonate was treated for clinical miliary tuberculosis and survived; my ... | 1992 | 1437883 |
| pulmonary mycobacterial infections associated with neoplasia. | patients with cancer are at increased risk for disease caused by mycobacteria when there is immunosuppression resulting from the underlying disease or its treatment. pulmonary disease is usual with mycobacterium tuberculosis or with mycobacteria other than m tuberculosis (mott) and atypical presentations with extrapulmonary dissemination occur frequently. no clinical features reliably distinguish between disease caused by m tuberculosis or mott. the incidence of m tuberculosis infection depends ... | 1992 | 1439320 |
| comparison of polymerase chain reaction amplification of two mycobacterial dna sequences, is6110 and the 65kda antigen gene, in the diagnosis of tuberculosis. | knowledge of the sequences of mycobacterial genes and the availability of dna amplification techniques have raised the possibility that identification of mycobacterial dna may offer a rapid and specific diagnostic test for tuberculosis. the correlation between the presence of mycobacterium tuberculosis dna and clinical tuberculosis, however, is not known. this study compared the results of polymerase chain reaction amplification of two m tuberculosis dna sequences, is6110 and the gene encoding t ... | 1992 | 1440462 |
| generation of cytolytic t cells in individuals infected by mycobacterium tuberculosis and vaccinated with bcg. | macrophage activation by cytokines provides only a partial explanation of antimycobacterial immunity in man. because cytolytic t lymphocytes have been shown to contribute to immunity in animal models of intracellular infection, the generation of mycobacterial antigen specific cytotoxic t cells was examined in the peripheral blood of patients with tuberculosis. | 1992 | 1440463 |
| mycobacterium avium complex and mycobacterium tuberculosis in patients infected with the human immunodeficiency virus. | primary care physicians play an important role in identifying and treating bacterial infections in adults infected with the human immunodeficiency virus (hiv). mycobacterium avium complex and mycobacterium tuberculosis are pathogens that can cause systemic or local infection in these patients. we review the epidemiology, pathogenesis, clinical presentation, and principles of treatment for these two mycobacterial pathogens. because m tuberculosis disease is preventable and curable and yet communi ... | 1992 | 1441463 |
| [the use of immunoenzyme analysis and immunoblotting for the serological characterization of mycobacterial antigens]. | the enzyme immunoassay and immunoblotting were used for the study of the serological activity of different mycobacterial antigens and the spectrum of antibodies to them in patients with different forms of tuberculosis and healthy persons. antibodies in patients' sera were shown to bind antigens with different molecular weight. the level and spectrum of antibodies to purified protein fraction i made it possible to differentiate between patients with various forms of tuberculosis and healthy perso ... | 1992 | 1441819 |
| tuberculous meningitis in patients with and without human immunodeficiency virus infection. | to characterize the symptoms, signs, laboratory findings, and outcome of culture-proven meningitis due to mycobacterium tuberculosis in patients with and without human immunodeficiency virus (hiv) infection. | 1992 | 1442854 |
| tuberculous peritonitis in egypt: the value of laparoscopy in diagnosis. | abdominal laparoscopy was performed on 200 patients with undiagnosed ascites. it was unsuccessful in one patient with tuberculous peritonitis because of extensive adhesions. a presumptive diagnosis of tuberculous peritonitis based on clinical findings and peritoneal tubercles or adhesions visualized during laparoscopy was made in 90 of these patients. the diagnosis was confirmed in 88 by histopathology, bacteriology, or therapeutic response. two of the 109 remaining patients who had other presum ... | 1992 | 1443345 |
| pulmonary tuberculosis in patients treated with inhaled beclomethasone. | inhaled beclomethasone dipropionate (bdp) has been used with few side-effects in the treatment of bronchial asthma for 2 decades. until now the manifestation of tuberculosis (tb) in patients on inhaled bdp has not been reported. eight patients with allergic asthma, of a total of 548 asthmatics (1.46%) seen over a 2-year period, developed active tb following the use of inhaled bdp. all were sputum-positive for acid-fast bacilli (afb) on smear and/or culture, all responded well to a combination of ... | 1992 | 1443454 |
| nucleotide sequence analysis and serologic characterization of the mycobacterium intracellulare homologue of the mycobacterium tuberculosis 19 kda antigen. | disseminated mycobacterium avium/mycobacterium intracellulare complex (mac) disease is a frequent complication in patients with the acquired immune deficiency syndrome (aids). in this report, we present the nucleotide sequence of the m. intracellulare mi22 gene. computer sequence comparisons reveal that the mi22 gene, which encodes a serologically active protein, has 78% dna sequence identity and 77% protein sequence identity with the seroreactive 19 kda mycobacterium tuberculosis lipoprotein an ... | 1992 | 1445568 |
| synthesis and antimycobacterial activity of some 2-pyridinecarboxyamidrazone derivatives. | a series of n1-aryliden-2-pyridincarboxyamidrazone derivatives was prepared. some of the synthesized compounds showed interesting in vitro antimycobacterial activity against some strains of mycobacterium and clinical isolates of mycobacterium tuberculosis. | 1992 | 1445613 |
| prospective comparative study of ofloxacin or ethambutol for the treatment of pulmonary tuberculosis. | the efficacy of ofloxacin, rifampicin and isoniazid was prospectively compared with the regimen of ethambutol, rifampicin and isoniazid for the primary treatment of pulmonary tuberculosis in 124 patients. all drugs were given orally daily for nine months. culture conversion rates three months after starting treatment were 98 percent in the ofloxacin group and 94 percent in the ethambutol group; by six months all patients in both groups were culture-negative. significant radiological improvement ... | 1992 | 1446494 |
| tuberculosis transmission in a state correctional institution--california, 1990-1991. | during september and october 1991, active tuberculosis (tb) was diagnosed in two inmates and one employee of a california state correctional institution (1991 average annual inmate population, 5421; employees, 1500). this report presents findings from an investigation by the california department of health services (cdhs), the california department of corrections (cdoc), and cdc to determine whether ongoing transmission of mycobacterium tuberculosis was occurring in the institution. | 1992 | 1448041 |
| gastric lavage is better than bronchoalveolar lavage for isolation of mycobacterium tuberculosis in childhood pulmonary tuberculosis. | we compared the sensitivity of gastric lavage (gl) with bronchoalveolar lavage (bal) for isolating mycobacterium tuberculosis (mtb) from 20 children with a presumptive diagnosis of primary pulmonary tuberculosis. gl was performed on three consecutive mornings after an overnight fast. bal was performed on the same day as the last gl. specimens were submitted for smears and culture for mtb. none of the acid-fast stained smears was positive. cultures of bal fluid on 2 patients (2 of 20 or 10%) were ... | 1992 | 1448314 |
| miliary tuberculosis presenting with thyrotoxicosis. | a male patient is described who presented with thyrotoxicosis, and a large painful neck mass. from the excised mass and stomach aspiration mycobacterium tuberculosis was cultured and a diagnosis of miliary tuberculosis was made. the thyrotoxicosis was attributed to tuberculous thyroiditis. | 1992 | 1448412 |
| dot-elisa for detection of phenolic glycolipid pgl-tb1 and diacyl-trehalose antigens of mycobacterium tuberculosis. | a dot-elisa method for detection of 2,3-diacyl-trehalose (dat, previously referred to as sl-iv antigen) and triglycosyl phenol phthiocerol di-mycocerosate (pgl-tb1) antigens from mycobacterium tuberculosis is described. the method enabled the detection of both antigens in 14 clinical isolates of m. tuberculosis from different geographic origins; the presence of the glycolipids was confirmed by chemical analysis. it was therefore concluded that the synthesis of both of these compounds is characte ... | 1992 | 1448617 |
| thin-layer chromatography systems for the identification of mycobacterium tuberculosis, m. bovis bcg, m. kansasii, m. gastri and m. marinum. | knowledge of mycobacterial glycolipid antigens and the study of their specificity have resulted in their utilization as species markers. we describe a thin-layer chromatography method which could serve as a useful adjunct for the identification of mycobacterium tuberculosis, m. bovis bcg, m. kansasii, m. gastri and m. marinum. | 1992 | 1448628 |
| [isolation of mycobacterium tuberculosis with primary resistance to chemotherapeutic agents in patients with hiv infection]. | to evaluate the resistance of mycobacterium tuberculosis in subjects with simultaneous infection by the human immunodeficiency virus. | 1992 | 1450261 |
| differential identification of mycobacterium tuberculosis from various clinical specimens from sassoon general hospital, pune. | a total of 619 clinical specimens from cases of pulmonary and extrapulmonary tuberculosis were processed by smear, culture and biochemical tests. acid fast bacilli could be demonstrated in 93 samples (15.02%) by z.n. staining method. culture yielded positive growth in 95 samples (15.35%) m. tuberculosis human type was the most predominient pathogen obtained from 82 cultures (13.40%) m tuberculosis bovine type was isolated from 2 cases of ascitic fluids (0.32%). atypical mycobacteria were isolate ... | 1992 | 1452229 |
| whole-cell protein electrophoresis for typing mycobacterium tuberculosis. | a method of discriminating between strains of mycobacterium tuberculosis by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins combined with a sensitive silver stain is described. thirty-five isolates of m. tuberculosis and five isolates from other species of mycobacterium were examined, including serial isolates from the same patients and isolates from a small cluster of hospital cases. different species of mycobacterium were clearly distinguished, and within ... | 1992 | 1452646 |
| production of monoclonal antibody to a phenolic glycolipid of mycobacterium tuberculosis and its use in detection of the antigen in clinical isolates. | a monoclonal antibody (mabiii604) specific to phenolic glycolipid tb (pgl-tb), a mycobacterium tuberculosis-specific antigen, was produced and used in the detection of the antigen. mabiii604 reacted with the pgl-tb antigen but not with other phenolic glycolipids from mycobacterium leprae, m. bovis, and m. kansasii, thus indicating the specificity of the monoclonal antibody to pgl-tb. a dot enzyme-linked immunosorbent assay with mabiii604 was employed to detect the pgl-tb antigen in lipids purifi ... | 1992 | 1452686 |
| aids and multidrug-resistant tuberculosis: an epidemic transforms an old disease. | since 1985, tuberculosis case counts in the united states have increased, primarily because of the influence of the hiv epidemic. in addition, during this time outbreaks of multidrug-resistant tuberculosis among patients with aids or hiv infection have been reported in new york city and florida. these outbreaks have occurred in hospitals and prisons and have been characterized by high case fatality rates, disease transmission within the institutions, and high infection rates in health care worke ... | 1992 | 1453093 |
| current concepts in the management and prevention of tuberculosis in adults. | after a steady decline in incidence during most of this century, tuberculosis case rates stabilized in the mid-1980s, and since then have steadily increased. several factors may have been responsible for the increase, including the influx of immigrants from endemic areas and the appearance of aids. this review outlines the current recommendations for treatment of tuberculosis in the otherwise normal patient, then discusses special problems which may affect treatment, including primary drug failu ... | 1992 | 1453094 |
| attacking today's tuberculosis problem: a multifaceted, coordinated effort. | tuberculosis is making a comeback in communities across the nation. increased rates of the disease, particularly with those having hiv/aids, have sounded the alarm that quick and decisive action is needed to halt the spread of tb. multidrug-resistant tb is becoming a primary concern with public health officials. specific plans and efforts, instigated by the centers for disease control, have outlined the appropriate steps local public health workers, the medical community, and civic and community ... | 1992 | 1453095 |
| new developments in mycobacteria identification: public health laboratory modernization. | clinical laboratory mycobacteriology has traditionally involved long delays for results, primarily due to the slow growth rate of most members of the genus mycobacterium. several new methodologies are now available that enable dramatic reductions in turn-around times. these methodologies include the bactec tb system for isolation and drug susceptibility testing of mycobacterium tuberculosis, the use of dna probes, and high performance liquid chromatography (hplc) for the identification of mycoba ... | 1992 | 1453097 |
| [active tuberculosis in children who received inh chemoprophylaxis]. | twelve children who developed active tuberculosis even after receiving isoniazid (inh) chemoprophylaxis were seen at tokyo metropolitan children's hospital from 1982 through 1991. all cases received inh more than 9 mg/kg/day, except for one case in which the amount of inh administered at the referring hospital was unknown and streptomycin was administered together with inh. the age of starting inh prophylaxis ranged from 2 months to 13 years, and the age at which clinical symptoms and/or laborat ... | 1992 | 1453566 |
| [evaluation of new antitubercular agents--new quinolones]. | | 1992 | 1453572 |
| [evaluation of new antitubercular agents--new rifamycin derivatives]. | | 1992 | 1453573 |
| [adoptive immunotherapy of refractory pulmonary tuberculosis using sensitized autologous lymphocytes]. | | 1992 | 1453574 |
| mycobacterium tuberculosis in children with human immunodeficiency virus type 1 infection. | a retrospective study was conducted at the childrens hospital center at jackson memorial hospital in miami, fl, to evaluate the natural history of mycobacterium tuberculosis infection in nine children with vertically acquired human immunodeficiency virus type 1 infection. the patients' ages ranged from 6 months to 7 years (median age, 42 months). common presenting symptoms included prolonged fever, cough and anorexia. only one patient had a positive tuberculin test. five patients evidenced only ... | 1992 | 1454438 |
| macrophages, mycobacteria and hiv: the role of cytokines in determining mycobacterial virulence and regulating viral replication. | the marriage of two scourges, one old (mycobacterial disease) and one new (hiv), has presented an enormous challenge to the medical and public health communities, and has stirred renewed interest in mechanisms for immune control of mycobacterial infection. virulence of both m. avium and m. tuberculosis appears to be inversely related to the capacity of the microorganisms to induce production of protective cytokines in infected hosts. tnf alpha and ifn gamma are central to this process, and mycob ... | 1992 | 1455067 |
| two-year incidence of tuberculosis in cohorts of hiv-infected and uninfected urban rwandan women. | to determine the prevalence of mycobacterium tuberculosis infection and the incidence of tuberculosis in hiv-infected and uninfected urban rwandan women, 460 hiv-positive and 998 hiv-negative childbearing women were recruited from pediatric and prenatal care clinics and were enrolled in a prospective study in 1988 and followed for 2 yr. tuberculin testing was administered 12 to 18 months after enrollment. fifty-three percent of hiv-negative women had positive tuberculin tests (induration > or = ... | 1992 | 1456559 |
| the combined effect of rifampin and pyrazinamide within the human macrophage. | a recent study in the murine model suggested that a combination of rifampin and pyrazinamide used as preventive therapy might shorten the duration of treatment time. clinical trials using this combination have been initiated, but significant results will not be available for many years. the ex vivo human macrophage model has been instructive in expanding our knowledge of the activity of chemotherapeutic agents against intracellular virulent tubercle bacilli. prior studies have shown rifampin to ... | 1992 | 1456560 |
| nonspecificity of the anda a60-tb elisa test for serodiagnosis of mycobacterial disease. | the conventional methods for the laboratory diagnosis of tuberculosis and other mycobacterial diseases are time consuming and beyond the scope of most of the small and medium-sized hospital facilities. therefore, there has been considerable interest in the development of a serological method for the detection of antibodies against mycobacteria. we recently evaluated a commercially available elisa test (anda biologicals, strasbourg, france) that measures antibody levels to a60 antigen, a membrane ... | 1992 | 1458372 |
| induction of adjuvant arthritis in mice. | adjuvant arthritis, induced by injections of freund's complete adjuvant into the footpads of some rat strains, has been recognized as a useful animal model for many years. there has, however, been notable lack of success in reproducing this model in other species. we now describe the development of adjuvant arthritis in healthy strain mice approximately 2 months after injection of freund's complete adjuvant. although the clinical appearance of the mice and the joint histopathology closely resemb ... | 1992 | 1458683 |
| [diagnosis of pulmonary tuberculosis]. | | 1992 | 1459016 |
| pulsed field gel electrophoresis of representatives of mycobacterium tuberculosis and mycobacterium bovis bcg strains. | using field inversion gel electrophoresis (fige), different mycobacterium tuberculosis strains, such as phage prototypes, exhibit different dna restriction patterns which are easy to compare. virulent and avirulent variants of m. tuberculosis h37, as well as daughter strains of m. bovis bcg, display characteristic dna profiles. bcg strains isolated from suppurative adenitis following vaccination of french patients showed patterns identical to the bcg pasteur strain used for vaccination. these re ... | 1992 | 1459403 |
| identification of immunodominant antigens during infection with mycobacterium tuberculosis. | t lymphocytes isolated from mice infected with mycobacterium tuberculosis response vigorously to proteins secreted by the bacilli and these antigens may be of importance in the generation of protective immunity against the disease. in this study, short-term culture filtrate (st-cf), which constitutes a complex mixture of secreted proteins, was fractionated by a modified preparative sds-page technique. the ability of each fraction to be recognized by t cells isolated from infected mice was evalua ... | 1992 | 1462121 |
| [clinical picture of tuberculous peritonitis]. | the clinical picture of tuberculous peritonitis in productive form with formation of an abdominal tumour 18 x 20 cm in dimensions is described. the patient was a boy aged 19 years from rural environment. the diagnosis was based on bacteriological investigations, histological examination and clinical manifestations. attention is called to diagnostic difficulties in cases of tuberculous peritonitis without positive tuberculin tests and with pulmonary fibronodular tuberculosis. | 1992 | 1462594 |
| synthesis and biological activity of 5'-aminobenzoxazinorifamycin derivatives. | benzoxazinorifamycin reacted with various secondary amines to yield various 5'-substituted aminobenzoxazinorifamycin derivatives. the derivatives exhibited potent activities against gram-positive bacteria and mycobacteria. the antimicrobial activities of these compounds against mycobacterium tuberculosis and mycobacterium intracellulare were superior to those of rifampicin. some of these compounds showed good plasma levels after oral administration in rats. | 1992 | 1464100 |
| major histocompatibility complex class i-restricted t cells are required for resistance to mycobacterium tuberculosis infection. | mice with a targeted disruption in the beta 2-microglobulin (beta 2m) gene, which lack major histocompatibility complex class i molecules and consequently fail to develop functional cd8 t cells, provided a useful model for assessing the role of class i-restricted t cells in resistance to infection with virulent mycobacterium tuberculosis. of mutant beta 2m-/-mice infected with virulent 10(6) m. tuberculosis, 70% were dead or moribund after 6 weeks, while all control mice expressing the beta 2m g ... | 1992 | 1465432 |
| a strategy to improve the efficacy of vaccination against tuberculosis and leprosy. | the pathogens responsible for leprosy, tuberculosis and the leishmaniases can induce different classes of immunity, but protection is provided only by a cell-mediated response. here, peter bretscher proposes a strategy to achieve an immunological imprint that ensures a stable cell-mediated response upon natural infection. | 1992 | 1466750 |
| tuberculosis incidence in developing countries with high prevalence of hiv infection. | to study the impact of the hiv epidemic on tuberculosis (tb) incidence in developing countries. | 1992 | 1466853 |
| rapid detection of tuberculous and non-tuberculous mycobacteria by polymerase chain reaction amplification of a 162 bp dna fragment from antigen 85. | a polymerase chain reaction (pcr) assay was developed for detection of mycobacteria using amplification of a 162 bp region of the genes coding for the mycobacterial antigen 85 complex. strains belonging to the mycobacterium tuberculosis complex were further differentiated from non-tuberculous mycobacteria by hybridization of the pcr derived southern blot with an internal oligonucleotide probe and washing under stringent conditions. the method allowed rapid and sensitive detection of mycobacteria ... | 1992 | 1468418 |
| papulonecrotic tuberculid. identification of mycobacterium tuberculosis dna by polymerase chain reaction. | sections from 22 formalin-fixed, paraffin-embedded skin biopsies from 12 patients with papulonecrotic tuberculid (pnt) were examined for the presence of mycobacterium tuberculosis dna with use of the polymerase chain reaction. all patients had a positive tuberculin skin test and a compatible clinical picture and responded to antituberculous therapy. histological examination showed the typical morphology of pnt lesions with dermal necrosis surrounded by an ill-formed granulomatous infiltrate. myc ... | 1992 | 1471746 |
| lymphocyte responses to dr4/1-restricted peptides in rheumatoid arthritis. the immunodominant t cell epitope on the 19-kd mycobacterium tuberculosis protein. | peptides presented by dr4/1 may be involved in the pathogenesis of rheumatoid arthritis (ra). t cell responses to dr4/1-restricted peptides unrelated to the causative antigen may be altered in ra. thus, dr4/1-restricted lymphocyte responses in healthy volunteers and patients with ra were determined. | 1992 | 1472121 |
| the significance of proteins actively secreted by mycobacterium tuberculosis in relation to immunity and complications of mycobacterial diseases. | | 1992 | 1474286 |
| aspects of tuberculosis in africa. 2. the value of microbiology in the management of tuberculosis in nairobi, kenya. | a group of african patients with tuberculosis were followed over the first month of treatment to assess the bactericidal response to 2 treatment regimens (streptomycin/thiacetazone/isoniazid and streptomycin/rifampicin/isoniazid/pyrazinamide). patients also infected with human immunodeficiency virus (hiv) had lower pre-treatment counts of viable mycobacterium tuberculosis and a greater proportion became culture-negative by 28 d. the response to therapy in hiv positive and hiv negative patients w ... | 1992 | 1475805 |
| aspects of tuberculosis in africa. 3. genetic 'fingerprinting' for clues to the pathogenesis of tuberculosis. | the recent discovery of a repetitive element within the dna of mycobacterium tuberculosis, which is present in variable numbers at different locations in separate strains of the organism, has led to the development of genetic 'fingerprinting' to distinguish between different isolates. clusters of cases of tuberculosis have been identified in europe and the usa in which the organisms cultured had identical 'fingerprints' confirming that transmission was occurring. unrelated isolates generally hav ... | 1992 | 1475806 |
| failure of therapy for tuberculosis in human immunodeficiency virus infection. | optimum treatment of tuberculosis in persons with human immunodeficiency virus (hiv) infection is still being defined. tuberculosis treatment failure in an hiv-infected patient is described and 10 similar cases from the medical literature are reviewed to search for common patterns associated with an adverse outcome of therapy in this setting. six patients were poorly compliant. in nine patients, the subsequent episode of tuberculosis was disseminated or extrapulmonary; in four the central nervou ... | 1992 | 1476156 |
| humoral response to mycobacterium tuberculosis in patients with human immunodeficiency virus infection. | the effect of the human immunodeficiency virus (hiv) on mycobacterial antibody production was investigated. using an enzyme-linked immunosorbent assay (elisa) for detecting igg against mycobacterium tuberculosis ppd, it was observed that individuals at risk of hiv infection show a pattern of humoral response to the tubercle bacillus similar to that previously found in the immunocompetent population not exposed to risk factors: 6 of 12 (50.0%) tuberculosis cases had elevated levels of antibodies ... | 1992 | 1477383 |
| cohort study of hiv-positive and hiv-negative tuberculosis, nairobi, kenya: comparison of bacteriological results. | we have set up a cohort of human immunodeficiency virus (hiv) positive and negative patients with tuberculosis in order to address the problems associated with hiv-related tuberculosis. we present here the results of sputum smear microscopy, culture, mycobacterial identification tests and drug susceptibility assays from specimens taken at presentation. in this selected population of largely pulmonary tuberculosis cases, hiv infection is not associated with significant differences in sputum smear ... | 1992 | 1477386 |
| drug resistance of mycobacterium tuberculosis in korea. | drug resistance of mycobacterium tuberculosis has been investigated with isolates from patients screened from a sample population of the nationwide tuberculosis prevalence surveys or from routine cultures. the results showed a close inverse relationship between the prevalence of drug resistance and the efficiency of the past or current national tuberculosis control program (ntp) treatment regimens. individual drug resistance also showed a close relationship with the extent of use of the relevant ... | 1992 | 1477389 |
| the spectrum of immune response to m. tuberculosis in healthy individuals. | | 1992 | 1477393 |
| clinical application of the polymerase chain reaction for a rapid diagnosis of mycobacterium tuberculosis infection. | a gene amplification method of mycobacterium tuberculosis dna by the polymerase chain reaction (pcr) has been devised. a primer pair used in this study is 5'gttgccgtggcgg tatcgg3' and 5'gcgacattacggggcaggtgg3', which brackets a 152-base region encoding the 65kd antigen, and a specific probe is 5'tttggggtcatctttggagcg3'. the procedure could be completed within 2 days. the specificity and the sensitivity of the pcr for m. tuberculosis complex in identifying m. tuberculosis complex did not conflict ... | 1992 | 1477460 |
| evaluation of syngene dna-dna probe assays for the identification of the mycobacterium tuberculosis complex and the mycobacterium avium complex. | two hundred mycobacterial cultures were used to evaluate two alkaline-phosphatase-labeled dna probe (snap) kits developed by syngene (san diego, ca) for identification of mycobacterium tuberculosis complex and m. avium complex. the m. tuberculosis complex snap probe, when compared with standard biochemical identification tests, gave results that were in agreement at 100% sensitivity and 98.7% specificity. ninety-nine m. avium complex strains that were previously tested by the gen-probe m. avium ... | 1992 | 1478047 |
| particulate respirators and tuberculosis transmission. | | 1992 | 1478548 |
| a histopathological study of endometrial tuberculosis in infertility. | | 1992 | 1479639 |
| the antigen 85 complex: a major secretion product of mycobacterium tuberculosis. | the large number of different proteins synthesized by the mycobacterial cell are currently classified and studied in terms of groups of proteins with certain common properties such as physical and chemical characteristics, function, and localization in the mycobacterial cell. proteins that are actively secreted during culture on synthetic media represent a particular group of great current interest. at least eight proteins secreted by mycobacterium tuberculosis have been isolated and characteriz ... | 1992 | 1480113 |
| national survey of notifications of tuberculosis in england and wales in 1988. medical research council cardiothoracic epidemiology group. | a survey was undertaken to determine the distribution of tuberculosis in england and wales and, by comparison with the findings of similar surveys in 1978-9 and 1983, to study trends in the incidence of the disease by ethnic group over the decade. | 1992 | 1481174 |
| [detection of mycobacterium tuberculosis in sputum specimens of pulmonary tuberculosis by dna amplification]. | the pcr was used to detect m. tuberculosis dna sequences in uncultured clinical specimens. two oligonucleotide primers with 20 bp each amplified target template dna of m. tuberculosis. amplified dna product was 245 bp which was identified by agarose gel electrophoresis. the sensitivity of detection of m. tuberculosis genomic dna and bacteria suspension by pcr was lpg and 13 viable bacteria cell/ml, respectively. in specificity experiments, only m. tuberculosis, m. bovis and bcg were positive by ... | 1992 | 1481532 |
| [primary intestinal tuberculosis in aids]. | more than 50% of all hiv-infected patients have gastrointestinal symptoms like dysphagia, abdominal pain, diarrhea or intestinal bleeding. we describe an emergency situation with gross gastrointestinal bleeding in a twenty-seven year old drug addicted female. colonoscopy and histological examination of the biopsies were the main diagnostic procedure to locate an extrapulmonary manifestation of a mycobacterium-tuberculosis-infection. | 1992 | 1481554 |
| a case of pulmonary tuberculosis with bilateral hilar lymphadenopathy diagnosed by sputum culture subsequent to open thoracic biopsy. | we report a case of pulmonary tuberculosis with bilateral hilar lymphadenopathy. open thoracic lymph nodes and lung biopsy revealed findings consistent with sarcoidosis. culture and special staining of the biopsied specimen for mycobacteria were negative. culture of the postoperative sputum grew mycobacterium tuberculosis and antituberculous therapy resulted in a decrease in sizes of the lymphadenopathy. a review of the literature, with emphasis on the differential diagnosis between tuberculosis ... | 1992 | 1485011 |
| evaluation of the septi-chek afb system in the recovery of mycobacteria. | the performance of the septi-chek afb system (roche) in the isolation of mycobacteria was compared to that of culture on lowenstein-jensen (lj) medium and the bactec radiometric system. the septi-chek afb system detected a significantly higher number of positive specimens (62/66 versus 47/66 for bactec and 39/56 for lj medium) and was more often the only medium in which an isolate was recovered. the average time for detection of isolates was very similar for the septi-chek afb and bactec systems ... | 1992 | 1486886 |
| counts of viable tubercle bacilli in sputum related to smear and culture gradings. | pairs of sputum specimens obtained pre-treatment from 166 smear-positive patients with pulmonary tuberculosis were examined by direct smear, culture on löwenstein-jensen medium after decontamination by the petroff method, and by quantitative colony counting on selective 7h11 medium after digestion with dithiothreitol. the selective medium counts ranged from no growth to 8.3 log10 cfu/ml with the largest numbers in the range 3.5-7.0 log10 cfu/ml. although there was overlap in counts between speci ... | 1992 | 1487984 |
| [characteristics of tuberculosis among children (data from a specialized hospital]. | the results of analysis of 3076 case histories of patients who were studied in a specialized hospital of leningrad in the period of 1984-1989 made it possible to give the present-day characteristic of tuberculosis infection in children aged up to 14 years. study was conducted according to the accepted scheme and comprised analysis of a general composition of patients, clinical diagnosis structure, specific features of the different forms of tuberculosis, registration of complications, age, sex a ... | 1992 | 1488428 |
| [current principles of diagnosis of cavitary formations in the lungs]. | tuberculosis, cancer or abscessed pneumonia were diagnosed in 141 (84%) of the 168 patients who had solitary cavities in the lungs in the absence of m. tuberculosis or cancer cells isolation. the most informative diagnostic signs in these cases are provided by sex, age, special features of the onset and course of the disease in the period between diagnosis establishment and patients' hospitalization, data obtained when fluorograms taken from archives were compared with the x-ray picture at the m ... | 1992 | 1488429 |
| [determining dehydrogenase activity as a method of accelerated indication of the viability of mycobacterium tuberculosis]. | a comparative effectiveness of mycobacterial dehydrogenase activity (dha) determination was studied with the help of the following stains: methylene blue, malachite green and tetrazole derivative--triphenyl tetrazole chloride (ttc). best result were obtained with ttc tests which allowed a reliable registration of m. tuberculosis culture viability. on the basis of indication of m. tuberculosis viability by dha, accelerated techniques were developed to determine mycobacterial drug resistance to th ... | 1992 | 1488441 |
| [optimal methods for the detection of tuberculosis in not easily accessible regions of the extreme north by bacteriological screening]. | the results of bacteriological study of 2210 residents of the extreme north are presented. the author's complex many factorial system of bacteriological screening is discussed, whose use will enable one to raise the detection parameter of bacilli excretors up to 2.93% in the preliminary detected population groups. | 1992 | 1488450 |
| drug-resistant tuberculosis in an urban population including patients at risk for human immunodeficiency virus infection. | in the past 5 yr, an increased incidence of tuberculosis has been noted in the united states. simultaneously, the population infected with human immunodeficiency virus-type i (hiv-i) and the number of cases of acquired immunodeficiency syndrome (aids) have increased. selected areas of the united states have also reported increases in the frequency of drug-resistant isolates of mycobacterium tuberculosis. because our institution serves a population in which tuberculosis, aids, and drug resistant ... | 1992 | 1489113 |
| stability of antimycobacterial drugs in susceptibility testing. | aqueous solutions of 0.02% isoniazid, 0.2% streptomycin, 0.2% para-aminosalicylate, and 0.5% ethambutol and ethylene glycol solutions of 0.5% ethionamide stored at 3 to 7 degrees c remained stable for 1 year, as did aqueous solutions of 0.05% ethionamide hydrochloride, 0.05% kanamycin, 0.05% viomycin, and 0.1% capreomycin stored at -20 degrees c. the ethambutol and capreomycin solutions were tested by microbiologic methods; the other solutions were tested by both spectrophotometric and microbiol ... | 1992 | 1489183 |
| tuberculoma of the nasopharynx. | a 67-year-old female patient with tuberculosis of the nasopharynx is reported. the diagnosis was confirmed on histological and bacteriological examination of a biopsy from her postnasal space. there was no evidence of any other active foci of tuberculosis but she had had a right nephrectomy 45 years previously for renal tuberculosis. a review of the literature on nasopharyngeal tuberculosis shows this to be a very rare disease in the absence of active pulmonary involvement. | 1992 | 1489284 |
| bacterial agents protect against autoimmune disease. i. mice pre-exposed to bordetella pertussis or mycobacterium tuberculosis are highly refractory to induction of experimental autoimmune encephalomyelitis. | infectious agents have often been implicated in the etiology of autoimmune diseases. here we show that bacteria may also play a role in resistance to autoimmune diseases. sjl/j and (sjl/j x balb/c)f1 mice are genetically susceptible to induction of experimental autoimmune encephalomyelitis (eae), a murine model for human demyelinating autoimmune diseases such as multiple sclerosis. we studied the effect of several bacteria on the development of eae and found that exposure of sjl/j or (sjl/j x ba ... | 1992 | 1489483 |
| t-lymphocyte reactivity to the recombinant mycobacterial 65- and 70-kda heat shock proteins in multiple sclerosis. | owing to their conservation and immunogenicity, heat shock proteins (hsps) represent a class of potential autoantigens. moreover, they could be targets for gamma delta t lymphocytes, which are prominent in various immune disorders. we studied the t cell proliferative primary responses to recombinant m. bovis 65 kda hsp (hsp65) and m. tuberculosis 70 kda hsp (hsp70) in 31 patients with multiple sclerosis (ms), 19 patients with other neurological diseases (ond) and 19 healthy individuals. positive ... | 1992 | 1489484 |
| [igg against a60 antigen and the tuberculin test in healthy individuals and tubercular patients]. | study of the relation between the antibodies against the a60 antigen and the tuberculin test. | 1992 | 1489777 |
| degenerate pcr primers for the amplification of fragments from genes encoding response regulators from a range of pathogenic bacteria. | many bacterial responses to environmental stimuli are mediated by response regulators which coordinately regulate genes involved in particular adaptive responses. degenerate oligonucleotide primers were used to amplify by the polymerase chain reaction (pcr), fragments from genes encoding eleven novel response regulators. sequence and phylogenetic analysis revealed that phob, phop and creb gene fragments had been amplified from yersinia enterocolitica and yersinia pseudotuberculosis, and that a c ... | 1992 | 1490612 |
| the mystery of the mycobacterial 'persistor'. | | 1992 | 1493231 |
| a comparative study of the polymerase chain reaction and conventional procedures for the diagnosis of tuberculous pleural effusion. | preliminary reports by ourselves and others suggest that amplification of mycobacterial dna by the polymerase chain reaction (pcr) is a sensitive and rapid diagnostic test for tuberculosis. we recently described a pcr assay with a 336 bp repetitive sequence specific for mycobacterium tuberculosis as the dna target, which gave encouraging results in culture-positive smear-negative clinical specimens. in the present prospective study of patients with pleural effusions we compared pcr of the pleura ... | 1992 | 1493233 |
| virulence of mycobacterium tuberculosis for guinea pigs: a quantitative modification of the assay developed by mitchison. | one of the more accepted methods of assay of virulence of tubercle bacilli is one developed by mitchison in which guinea pigs were infected by the intramuscular route with 1.0 mg of tubercle bacilli freshly harvested from lowenstein jensen medium and in which virulence was based on a subjective score of the extent of gross disease in the animal 6 weeks after infection. due to the practical difficulties involved in such an assay when routinely performed, the following modifications were made: fro ... | 1992 | 1493234 |
| studies on cell-wall deficient non-acid fast variants of mycobacterium tuberculosis. | while the host-parasite relationship in tuberculosis still remains incompletely understood, there has been recent renewed interest in indications that tubercle bacilli are converted into metabolically inactive, non-acid fast (naf) granular forms in the presence of host defence mechanisms and antituberculosis drugs. the present study investigates the mechanism of induction of these naf variants in vitro and in vivo, and their ultimate pathogenicity. evidence is provided that appears to clearly in ... | 1992 | 1493235 |
| mycobacteria as a cause of infective exacerbation in bronchiectasis. | in 91 patients with bronchiectasis seen over 6 years, a positive mycobacterial culture was obtained in 12 cases (13%). the organisms isolated were mycobacterium tuberculosis in nine cases, mycobacterium avium in two cases and mycobacterium tuberculosis and chelonei were obtained on separate occasions in one case. computed tomography and/or bronchography showed that the bronchiectatic changes commonly involved the lower lobes and to a lesser extent, the middle and lingula lobes. in none of these ... | 1992 | 1494510 |
| recognizing and managing mycobacterial diseases in clients with aids. | mycobacterial diseases are common in people infected with human immunodeficiency virus. mycobacterium tuberculosis (mtb) and mycobacterium avium intracellulare (mai), the specific pathogens most frequently involved, cause pulmonary tuberculosis and disseminated mai infections. pulmonary tuberculosis incidence was on the decline from 1950 to 1985, but since 1985 has been on the rise worldwide. prior to the onset of aids, mai infections were rare in humans. however, disseminated mai seems to be as ... | 1992 | 1495596 |
| [the formation of host-parasite relationships in an experimental mixed pathology of opisthorchiasis-tuberculosis as dependent on the phase of the opisthorchis infestation]. | superinfection of animals having opisthorchis invasion with mycobacterium tuberculosis leads to destabilization of host-parasite relationships in opisthorchiasis and formation of new host-parasitocenotic interrelations whose manifestation depends on the phase of the invasive process. at the acute invasive phase of mixed pathology (2 weeks) the activity of the host's immune system increases, while the biological activity of helminths and the number of m. tuberculosis colonies decrease. and on the ... | 1992 | 1496873 |
| adjuvant arthritis and immunity to the mycobacterial 65 kda heat shock protein. | the mycobacterial 65 kda heat shock protein (hsp65) is of critical significance in the model of adjuvant arthritis (aa). arthritogenic and protective t cell clones obtained from arthritic rats recognized the 180-188 sequence of hsp65. previous reports have shown that administration of hsp65 prior to disease induction led to resistance to arthritis in the aa model and in several other models of experimental arthritis. here, we report the development of immunity to hsp65 and the critical 180-188 e ... | 1992 | 1498083 |
| [serological diagnosis of pulmonary tuberculosis using elisa and the a60 antigen]. | study of the utility of a serologic technic in the clinic diagnostic of the pulmonary tuberculosis. | 1992 | 1498168 |
| results of the third immunology of leprosy/immunology of tuberculosis antimycobacterial monoclonal antibody workshop. | an international workshop was sponsored by the world health organization to screen new antimycobacterial monoclonal antibodies and to identify antibodies which could be recommended as standard reagents giving consistent results under differing assay conditions. fifty-eight antibodies were submitted to the workshop by eight independent laboratories. nineteen of the antibodies recognized antigens distinct from those identified in earlier workshops, defining at least 10 new protein antigens. monocl ... | 1992 | 1500202 |
| immunoglobulin a (iga) and igg serum antibodies to mycobacterial antigens in crohn's disease patients and their relatives. | sera from patients with crohn's disease, their relatives, their spouses, and unrelated healthy controls were assayed by enzyme-linked immunosorbent assay for immunoglobulin g (igg) and iga antibodies to mycobacterium tuberculosis, m. avium, and m. gordonae. the patients had significantly higher iga responses to mycobacterial antigens than did either their relatives or the controls. on the other hand, both the patients and their relatives had significantly higher igg responses against these antig ... | 1992 | 1500507 |
| detection and identification of mycobacteria by amplification of a segment of the gene coding for the 32-kilodalton protein. | a polymerase chain reaction (pcr) assay for the rapid detection of mycobacterial dna is described. oligonucleotide primers, derived from the sequence of a gene coding for the 32-kda antigen of mycobacterium tuberculosis, amplified dna from all 28 species of mycobacteria tested. all nonmycobacterial species tested were negative. an oligonucleotide probe hybridized to the pcr products of the strains belonging to the m. tuberculosis complex. this method could detect as little as 50 fg, as tested wi ... | 1992 | 1500509 |
| characterization of a dna probe for detection of mycobacterium tuberculosis complex in clinical samples by polymerase chain reaction. | we cloned and sequenced a dna fragment from mycobacterium tuberculosis for use in the identification of members of the m. tuberculosis complex. the dna probe for culture confirmation had a sensitivity and a specificity of 100%. by using primers developed from this probe, the polymerase chain reaction detected 20 mycobacteria by ethidium bromide staining. this polymerase chain reaction system demonstrated 98% sensitivity and 100% specificity for detection of the m. tuberculosis complex in 200 spu ... | 1992 | 1500529 |
| microplate and dot immunoassays for the serodiagnosis of tuberculosis. | a simple dot enzyme immunoassay based on the recognition of serum igg antibody to a 30,000 dalton native antigen purified from culture filtrates of mycobacterium tuberculosis was developed and compared with a standard plate enzyme-linked immunosorbent assay in the serodiagnosis of tuberculosis. the previously described favorable test characteristics of plate enzyme-linked immunoassay were confirmed; although the dot enzyme immunoassay was promising, it was less satisfactory. dot enzyme immunoass ... | 1992 | 1500829 |
| tuberculosis. back to a frightening future. | | 1992 | 1501708 |
| the catalase-peroxidase gene and isoniazid resistance of mycobacterium tuberculosis. | tuberculosis is responsible for one in four of all avoidable adult deaths in developing countries. increased frequency and accelerated fatality of the disease among individuals infected with human immunodeficiency virus has raised worldwide concern that control programmes may be inadequate, and the emergence of multidrug-resistant strains of mycobacterium tuberculosis has resulted in several recent fatal outbreaks in the united states. isonicotinic acid hydrazide (isoniazid, inh) forms the core ... | 1992 | 1501713 |
| induction of immunity and oral tolerance with polymorphic class ii major histocompatibility complex allopeptides in the rat. | we studied the immunogenicity and tolerogenicity of class ii major histocompatibility complex (mhc) allopeptides in the rat. inbred lew (rt1l) rats, used as responders, were immunized in the foot pad with a mixture of eight synthetic class ii mhc allopeptides emulsified in complete freund's adjuvant. these sequences represent the full-length second domain of rt1.bu and rt1.du (wf) beta chains. in vitro, responder lymphocytes harvested from popliteal and inguinal lymph nodes of immunized animals ... | 1992 | 1502196 |
| a family of cross-reacting proteins secreted by mycobacterium tuberculosis. | cross-reactions between five proteins actively secreted by mycobacterium tuberculosis were studied by crossed immunoelectrophoresis, sds-page with immunoblotting, and elisa using polyclonal rabbit antisera and mouse monoclonal antibodies to the purified proteins. the monoclonal antibody hbt4 was demonstrated to react with the mpt51 protein. the 85a, 85b and 85c constituents of the m. tuberculosis and mycobacterium bovis bcg antigen 85 complex cross-react extensively, each of the components conta ... | 1992 | 1502498 |
| tuberculosis involving the patella. | | 1992 | 1503053 |
| susceptibility of south indian strains of mycobacterium tuberculosis to tuberactinomycin. | a total of 114 strains of mycobacterium tuberculosis isolated from sputum samples of 114 patients of pulmonary tuberculosis in south india, were coded and tested for their in vitro susceptibility to tuberactinomycin (tum) incorporated in lowenstein-jensen (lj) medium. of these strains, 95 (83.3%) and 15 (13.2%) were susceptible to tum at 25 and 50 mg/l respectively. only 4 (3.5%) strains were inhibited at 100 mg/l or more. of the 37 drug sensitive strains, 2 (5.4%) were not susceptible to tum at ... | 1992 | 1506058 |
| hospital outbreak of multidrug-resistant mycobacterium tuberculosis infections. factors in transmission to staff and hiv-infected patients. | to describe transmission of multidrug-resistant (mdr) mycobacterium tuberculosis infection among patients and health care workers (hcws) in a ward and clinic for human immunodeficiency virus (hiv)-infected patients in a hospital, four studies were conducted. | 1992 | 1507374 |
| [nucleic acid probes in infectious diseases]. | dna probes are then newest diagnostic reagents now in clinical use to detect or specify infectious microorganisms. the fundamental aspects of dna probes and their clinical applications are reviewed to provide the clinician new information on the recent progress in infectious diseases. | 1992 | 1507467 |
| genetic basis found for resistance to tb drug. | | 1992 | 1509253 |
| tuberculosis: commentary on a reemergent killer. | tuberculosis remains the leading cause of death in the world from a single infectious disease, although there is little knowledge of the mechanisms of its pathogenesis and protection from it. after a century of decline in the united states, tuberculosis is increasing, and strains resistant to multiple antibiotics have emerged. this excess of cases is attributable to changes in the social structure in cities, the human immunodeficiency virus epidemic, and a failure in certain major cities to impr ... | 1992 | 1509256 |