Publications

TitleAbstractYear(sorted descending)
Filter
PMID
Filter
evaluation of sars-cov-2 neutralizing antibodies using a cpe-based colorimetric live virus micro-neutralization assay in human serum samples.the micro-neutralization assay is a fundamental test in virology, immunology, vaccine assessment, and epidemiology studies. since the sars-cov-2 outbreak at the end of december 2019 in china, it has become extremely important to have well-established and validated diagnostic and serological assays for this new emerging virus. here, we present a micro-neutralization assay with the use of sars-cov-2 wild type virus with two different methods of read-out. we evaluated the performance of this assay ...202032383254
high prevalence of olfactory and taste disorder during sars-cov-2 infection in outpatients. 202032383174
gene of the month: the 2019-ncov/sars-cov-2 novel coronavirus spike protein.the year 2020 has seen a major and sustained outbreak of a novel betacoronavirus (severe acute respiratory syndrome (sars)-coronavirus (cov)-2) infection that causes fever, severe respiratory illness and pneumonia, a disease called covid-19. at the time of writing, the death toll was greater than 120 000 worldwide with more than 2 million documented infections. the genome of the cov encodes a number of structural proteins that facilitate cellular entry and assembly of virions, of which the spike ...202032376714
sars unique domain (sud) of severe acute respiratory syndrome coronavirus induces nlrp3 inflammasome-dependent cxcl10-mediated pulmonary inflammation.severe acute respiratory syndrome-associated coronavirus (sars-cov) initiates the cytokine/chemokine storm-mediated lung injury. the sars-cov unique domain (sud) with three macrodomains (n, m, and c), showing the g-quadruplex binding activity, was examined the possible role in sars pathogenesis in this study. the chemokine profile analysis indicated that sars-cov sud significantly up-regulated the expression of cxcl10, ccl5 and interleukin (il)-1β in human lung epithelial cells and in the lung t ...202032365944
amantadine disrupts lysosomal gene expression: a hypothesis for covid19 treatment.sars-coronavirus 2 is the causal agent of the covid-19 outbreak. sars-cov-2 entry into a cell is dependent upon binding of the viral spike (s) protein to cellular receptor and on cleavage of the spike protein by the host cell proteases such as cathepsin l and cathepsin b. ctsl/b are crucial elements of lysosomal pathway and both enzymes are almost exclusively located in the lysosomes. ctsl disruption offers potential for covid-19 therapies. the mechanisms of disruption include: decreasing expres ...202032361028
a dynamic immune response shapes covid-19 progression.the inflammatory response to sars-coronavirus-2 (sars-cov-2) infection is thought to underpin covid-19 pathogenesis. we conducted daily transcriptomic profiling of three covid-19 cases and found that the early immune response in covid-19 patients is highly dynamic. patient throat swabs were tested daily for sars-cov-2, with the virus persisting for 3 to 4 weeks in all three patients. cytokine analyses of whole blood revealed increased cytokine expression in the single most severe case. however, ...202032359396
emergence of drift variants that may affect covid-19 vaccine development and antibody treatment.new coronavirus (sars-cov-2) treatments and vaccines are under development to combat covid-19. several approaches are being used by scientists for investigation, including (1) various small molecule approaches targeting rna polymerase, 3c-like protease, and rna endonuclease; and (2) exploration of antibodies obtained from convalescent plasma from patients who have recovered from covid-19. the coronavirus genome is highly prone to mutations that lead to genetic drift and escape from immune recogn ...202032357545
telmisartan as tentative angiotensin receptor blocker therapeutic for covid-19.in late 2019, a new coronavirus emerged in wuhan province, china, causing lung complications similar to those produced by the sars coronavirus in the 2002-2003 epidemic. this new disease was named covid-19 and the causative virus sars-cov-2. the sars-cov-2 virus enters the airway and binds, by means of the s protein on its surface to the membrane protein ace2 in type 2 alveolar cells. the s protein-ace2 complex is internalized by endocytosis leading to a partial decrease or total loss of the enz ...202032356926
web exclusive. annals on call - surge modeling for covid-19.[figure: see text].202032353107
[covid-19 : intensive care management].the sars-coronavirus 2 disease initially reported in december 2019 in china (covid-19) represents a major challenge for intensive care medicine, due to the high number of icu admission and the prolonged stay for many patients. up to 5 % of covid-19 infected patients develop severe acute hypoxemic respiratory failure requiring invasive mechanical ventilation as supportive treatment. apart from early antiviral and anti-inflammatory treatment, the management of covid-19 patients is mainly applying ...202032348055
impact of immune enhancement on covid-19 polyclonal hyperimmune globulin therapy and vaccine development.the pandemic spread of a novel coronavirus - sars coronavirus-2 (sars-cov-2) as a cause of acute respiratory illness, named covid-19, is placing the healthcare systems of many countries under unprecedented stress. global economies are also spiraling towards a recession in fear of this new life-threatening disease. vaccines that prevent sars-cov-2 infection and therapeutics that reduces the risk of severe covid-19 are thus urgently needed. a rapid method to derive antiviral treatment for covid-19 ...202032344202
managing close contacts of covid-19 confirmed cases in metropolitan areas in china.the novel coronavirus (covid-19) outbreak has rapidly spread across the world. as medical systems continue to develop vaccines and treatments, it is crucial for the public health community to establish nonpharmaceutical interventions (npis) that can effectively mitigate the rate of sars-coronavirus-2 (sars-cov-2) spread across highly populated residential areas, especially among individuals who have close contact with confirmed cases. a community-driven preparedness strategy has been implemented ...202032332481
sars-cov-2 infection in children - understanding the immune responses and controlling the pandemic.in december 2019, a cluster of patients with severe pneumonia caused by a novel coronavirus (sars-cov-2) emerged in the city of wuhan, china. the disease is now termed coronavirus disease 2019 (covid-19). in the early reports, the patients were mainly middle-aged and elderly men, and children appeared to be less susceptible to this infection. with modern and efficient transportation, the disease quickly spread to almost all corners of the world and the mortality far exceeds that caused by severe ...202032330332
drug development and medicinal chemistry efforts toward sars-coronavirus and covid-19 therapeutics.the covid-19 pandemic caused by sars-cov-2 infection is spreading at an alarming rate and has created an unprecedented health emergency around the globe. there is no effective vaccine or approved drug treatment against covid-19 and other pathogenic coronaviruses. the development of antiviral agents is an urgent priority. biochemical events critical to the coronavirus replication cycle provided a number of attractive targets for drug development. these include, spike protein for binding to host c ...202032324951
sars-cov-2 infection in pregnancy - a review of the current literature and possible impact on maternal and neonatal outcome.in december 2019, cases of pneumonia of unknown cause first started to appear in wuhan in china; subsequently, a new coronavirus was soon identified as the cause of the illness, now known as coronavirus disease 2019 (covid-19). since then, infections have been confirmed worldwide in numerous countries, with the number of cases steadily rising. the aim of the present review is to provide an overview of the new severe acute respiratory syndrome (sars) coronavirus 2 (sars-cov-2) and, in particular, ...202032322107
active constituents and mechanisms of respiratory detox shot, a traditional chinese medicine prescription, for covid-19 control and prevention: network-molecular docking-lc-mse analysis.lung-toxin dispelling formula no. 1, referred to as respiratory detox shot (rds), was developed based on a classical prescription of traditional chinese medicine (tcm) and the theoretical understanding of herbal properties within tcm. therapeutic benefits of using rds for both disease control and prevention, in the effort to contain the coronavirus disease 2019 (covid-19), have been shown. however, the biochemically active constituents of rds and their mechanisms of action are still unclear. the ...202032307268
chloroquine paradox may cause more damage than help fight covid-19.novel coronavirus disease 2019 (covid-19) pandemic is the most recent health care crisis without specific prophylactic or therapeutic drugs. antimalarial drug chloroquine (chl) and its safer derivative hydroxychloroquine (hchl) have been proposed to be repurposed to treat sars coronavirus-2 (sars-cov-2), the causative agent of covid-19. chl/hchl have anti-inflammatory activity and are used to treat rheumatoid arthritis, osteoarthritis and lupus. although, chl/hchl have an anti-viral activity aga ...202032305500
pharmacologic treatment of transplant recipients infected with sars-cov-2: considerations regarding therapeutic drug monitoring and drug-drug interactions.covid-19 is a novel infectious disease caused by the severe acute respiratory distress (sars)-coronavirus-2 (sars-cov-2). several therapeutic options are currently emerging but none with universal consensus or proven efficacy. solid organ transplant recipients are perceived to be at increased risk of severe covid-19 because of their immunosuppressed conditions due to chronic use of immunosuppressive drugs (isds). it is therefore likely that solid organ transplant recipients will be treated with ...202032304488
coinfection with covid-19 and coronavirus hku1-the critical need for repeat testing if clinically indicated. 202032293743
searching therapeutic strategy of new coronavirus pneumonia from angiotensin-converting enzyme 2: the target of covid-19 and sars-cov.since december 2019, the infection of the new coronavirus (covid-19) caused an outbreak of new coronavirus pneumonia in wuhan, china, and caused great public concern. both covid-19 and sars-cov belong to the coronavirus family and both invade target cells through ace2. an in-depth understanding of ace2 and a series of physiological and physiological changes caused by the virus invading the human body may help to discover and explain the corresponding clinical phenomena and then deal with them ti ...202032285293
limits of detection of 6 approved rt-pcr kits for the novel sars-coronavirus-2 (sars-cov-2). 202032282874
emergence of novel coronavirus and covid-19: whether to stay or die out?the last century has witnessed several assaults from rna viruses, resulting in millions of death throughout the world. the 21st century appears no longer an exception, with the trend continued with escalated fear of sars coronavirus in 2002 and further concern of influenza h5n1 in 2003. a novel influenza virus created the first pandemic of the 21st century, the pandemic flu in 2009 preceded with the emergence of another deadly virus, mers-cov in 2012. a novel coronavirus "sars-cov-2" (and the di ...202032282268
false negative of rt-pcr and prolonged nucleic acid conversion in covid-19: rather than recurrence. 202032270882
intersecting u.s. epidemics: covid-19 and lack of health insurance. 202032259195
ace2 the janus-faced protein - from cardiovascular protection to severe acute respiratory syndrome-coronavirus and covid-19.angiotensin converting enzyme 2 (ace2) is the major enzyme responsible for conversion of ang ii into ang-(1-7). it also acts as the receptor for severe acute respiratory syndrome (sars)-coronavirus (cov)-2, which causes coronavirus disease (covid)-19. in recognition of the importance of ace2 and to celebrate 20 years since its discovery, the journal will publish a focused issue on the basic science and (patho)physiological role of this multifunctional protein.202032255491
a first case of meningitis/encephalitis associated with sars-coronavirus-2.novel coronavirus (sars-coronavirus-2:sars-cov-2) which emerged in wuhan, china, has spread to multiple countries rapidly. we report the first case of meningitis associated with sars-cov-2 who was brought in by ambulance due to a convulsion accompanied by unconsciousness. he had never been to any foreign countries. he felt generalized fatigue and fever (day 1). he saw doctors nearby twice (day 2 and 5) and was prescribed laninamivir and antipyretic agents, his family visited his home and found t ...202032251791
structural and molecular modelling studies reveal a new mechanism of action of chloroquine and hydroxychloroquine against sars-cov-2 infection.the recent emergence of the novel pathogenic sars-coronavirus 2 (sars-cov-2) is responsible for a worldwide pandemic. given the global health emergency, drug repositioning is the most reliable option to design an efficient therapy for infected patients without delay. the first step of the viral replication cycle [i.e. attachment to the surface of respiratory cells, mediated by the spike (s) viral protein] offers several potential therapeutic targets. the s protein uses the angiotension-convertin ...202032251731
microneedle array delivered recombinant coronavirus vaccines: immunogenicity and rapid translational development.coronaviruses pose a serious threat to global health as evidenced by severe acute respiratory syndrome (sars), middle east respiratory syndrome (mers), and covid-19. sars coronavirus (sars-cov), mers coronavirus (mers-cov), and the novel coronavirus, previously dubbed 2019-ncov, and now officially named sars-cov-2, are the causative agents of the sars, mers, and covid-19 disease outbreaks, respectively. safe vaccines that rapidly induce potent and long-lasting virus-specific immune responses aga ...202032249203
sars-cov-2 and coronavirus disease 2019: what we know so far.in december 2019, a cluster of fatal pneumonia cases presented in wuhan, china. they were caused by a previously unknown coronavirus. all patients had been associated with the wuhan wholefood market, where seafood and live animals are sold. the virus spread rapidly and public health authorities in china initiated a containment effort. however, by that time, travelers had carried the virus to many countries, sparking memories of the previous coronavirus epidemics, severe acute respiratory syndrom ...202032245083
smoking upregulates angiotensin-converting enzyme-2 receptor: a potential adhesion site for novel coronavirus sars-cov-2 (covid-19).the epicenter of the original outbreak in china has high male smoking rates of around 50%, and early reported death rates have an emphasis on older males, therefore the likelihood of smokers being overrepresented in fatalities is high. in iran, china, italy, and south korea, female smoking rates are much lower than males. fewer females have contracted the virus. if this analysis is correct, then indonesia would be expected to begin experiencing high rates of covid-19 because its male smoking rat ...202032244852
substituting angiotensin-(1-7) to prevent lung damage in sars-cov-2 infection? 202032242749
covid-19, ace2, and the cardiovascular consequences.the novel sars coronavirus sars-cov-2 pandemic may be particularly deleterious to patients with underlying cardiovascular disease (cvd). the mechanism for sars-cov-2 infection is the requisite binding of the virus to the membrane-bound form of angiotensin-converting enzyme 2 (ace2) and internalization of the complex by the host cell. recognition that ace2 is the coreceptor for the coronavirus has prompted new therapeutic approaches to block the enzyme or reduce its expression to prevent the cell ...202032228252
could sars-coronavirus-2 trigger autoimmune and/or autoinflammatory mechanisms in genetically predisposed subjects? 202032220633
structural genomics of sars-cov-2 indicates evolutionary conserved functional regions of viral proteins.during its first two and a half months, the recently emerged 2019 novel coronavirus, sars-cov-2, has already infected over one-hundred thousand people worldwide and has taken more than four thousand lives. however, the swiftly spreading virus also caused an unprecedentedly rapid response from the research community facing the unknown health challenge of potentially enormous proportions. unfortunately, the experimental research to understand the molecular mechanisms behind the viral infection and ...202032218151
autopsy in suspected covid-19 cases.the severe acute respiratory syndrome (sars)-coronavirus-2 (cov-2) outbreak in wuhan, china has now spread to many countries across the world including the uk with an increasing death toll. this will inevitably lead to an increase in the number of suspected coronavirus disease 2019 (covid-19)-related deaths at autopsy. the royal college of pathologists has responded to this concern with the release of a briefing on autopsy practice relating to covid-19. the following article is a summary and int ...202032198191
differences and similarities between severe acute respiratory syndrome (sars)-coronavirus (cov) and sars-cov-2. would a rose by another name smell as sweet? 202032196628
sars coronavirus redux.as an atypical pneumonia began to appear in december 2019, zhou et al. worked with remarkable speed to identify the associated virus, determine its relationship to animal viruses, and evaluate factors conferring infection susceptibility and resistance. these foundational results are being advanced to control the current worldwide human coronavirus epidemic.202032173256
a high atp concentration enhances the cooperative translocation of the sars coronavirus helicase nsp13 in the unwinding of duplex rna.severe acute respiratory syndrome coronavirus nonstructural protein 13 (scv nsp13), a superfamily 1 helicase, plays a central role in viral rna replication through the unwinding of duplex rna and dna with a 5' single-stranded tail in a 5' to 3' direction. despite its putative role in viral rna replication, nsp13 readily unwinds duplex dna by cooperative translocation. herein, nsp13 exhibited different characteristics in duplex rna unwinding than that in duplex dna. nsp13 showed very poor process ...202032161317
identification of coronavirus sequences in carp cdna from wuhan, china.severe acute respiratory syndrome (sars)-like coronavirus sequences were identified in two separate complementary dna (cdna) pools. the first pool was from a carassius auratus (crusian carp) cell line and the second was from ctenopharyngodon idella (grass carp) head kidney tissue. blast analysis suggests that these sequences belong to sars-like coronaviruses, and that they are not evolutionarily conserved in other species. investigation of the submitting laboratories revealed that two laboratori ...202032159234
rapid random access detection of the novel sars-coronavirus-2 (sars-cov-2, previously 2019-ncov) using an open access protocol for the panther fusion. 202032143123
nonstructural proteins ns7b and ns8 are likely to be phylogenetically associated with evolution of 2019-ncov.the seventh novel human infecting betacoronavirus that causes pneumonia (2019 novel coronavirus, 2019-ncov) originated in wuhan, china. the evolutionary relationship between 2019-ncov and the other human respiratory illness-causing coronavirus is not closely related. we sought to characterize the relationship of the translated proteins of 2019-ncov with other species of orthocoronavirinae. a phylogenetic tree was constructed from the genome sequences. a cluster tree was developed from the profil ...202032142938
sars-cov-2 cell entry depends on ace2 and tmprss2 and is blocked by a clinically proven protease inhibitor.the recent emergence of the novel, pathogenic sars-coronavirus 2 (sars-cov-2) in china and its rapid national and international spread pose a global health emergency. cell entry of coronaviruses depends on binding of the viral spike (s) proteins to cellular receptors and on s protein priming by host cell proteases. unravelling which cellular factors are used by sars-cov-2 for entry might provide insights into viral transmission and reveal therapeutic targets. here, we demonstrate that sars-cov-2 ...202032142651
a systematic review of lopinavir therapy for sars coronavirus and mers coronavirus-a possible reference for coronavirus disease-19 treatment option.in the past few decades, coronaviruses have risen as a global threat to public health. currently, the outbreak of coronavirus disease-19 (covid-19) from wuhan caused a worldwide panic. there are no specific antiviral therapies for covid-19. however, there are agents that were used during the severe acute respiratory syndrome (sars) and middle east respiratory syndrome (mers) epidemics. we could learn from sars and mers. lopinavir (lpv) is an effective agent that inhibits the protease activity of ...202032104907
avnp2 protects against cognitive impairments induced by c6 glioma by suppressing tumour associated inflammation in rats.glioblastoma is a kind of malignant tumour and originates from the central nervous system. in the last century, some researchers and clinician have noticed that the psychosocial and neurocognitive functioning of patients with malignant gliomas can be impaired. many clinical studies have demonstrated that part of patients, adults or children, diagnosed with glioblastoma will suffer from cognitive deficiency during their clinical course, especially in long-term survivors. many nanoparticles (nps) ...202032097763
potent binding of 2019 novel coronavirus spike protein by a sars coronavirus-specific human monoclonal antibody.the newly identified 2019 novel coronavirus (2019-ncov) has caused more than 11,900 laboratory-confirmed human infections, including 259 deaths, posing a serious threat to human health. currently, however, there is no specific antiviral treatment or vaccine. considering the relatively high identity of receptor-binding domain (rbd) in 2019-ncov and sars-cov, it is urgent to assess the cross-reactivity of anti-sars cov antibodies with 2019-ncov spike protein, which could have important implication ...202032065055
novel coronavirus outbreak in wuhan, china, 2020: intense surveillance is vital for preventing sustained transmission in new locations.the outbreak of pneumonia originating in wuhan, china, has generated 24,500 confirmed cases, including 492 deaths, as of 5 february 2020. the virus (2019-ncov) has spread elsewhere in china and to 24 countries, including south korea, thailand, japan and usa. fortunately, there has only been limited human-to-human transmission outside of china. here, we assess the risk of sustained transmission whenever the coronavirus arrives in other countries. data describing the times from symptom onset to ho ...202032054124
the reproductive number of covid-19 is higher compared to sars coronavirus. 202032052846
molecular diagnosis of a novel coronavirus (2019-ncov) causing an outbreak of pneumonia.a novel coronavirus of zoonotic origin (2019-ncov) has recently been identified in patients with acute respiratory disease. this virus is genetically similar to sars coronavirus and bat sars-like coronaviruses. the outbreak was initially detected in wuhan, a major city of china, but has subsequently been detected in other provinces of china. travel-associated cases have also been reported in a few other countries. outbreaks in health care workers indicate human-to-human transmission. molecular t ...202032031583
detection of 2019 novel coronavirus (2019-ncov) by real-time rt-pcr.the ongoing outbreak of the recently emerged novel coronavirus (2019-ncov) poses a challenge for public health laboratories as virus isolates are unavailable while there is growing evidence that the outbreak is more widespread than initially thought, and international spread through travellers does already occur.202031992387
molecular mechanism for antibody-dependent enhancement of coronavirus entry.antibody-dependent enhancement (ade) of viral entry has been a major concern for epidemiology, vaccine development, and antibody-based drug therapy. however, the molecular mechanism behind ade is still elusive. coronavirus spike protein mediates viral entry into cells by first binding to a receptor on the host cell surface and then fusing viral and host membranes. in this study, we investigated how a neutralizing monoclonal antibody (mab), which targets the receptor-binding domain (rbd) of middl ...202031826992
sars-coronavirus open reading frame-8b triggers intracellular stress pathways and activates nlrp3 inflammasomes.the sars (severe acute respiratory syndrome) outbreak was caused by a coronavirus (cov) named the sars-cov. sars pathology is propagated both by direct cytotoxic effects of the virus and aberrant activation of the innate immune response. here, we identify several mechanisms by which a sars-cov open reading frame (orf) activates intracellular stress pathways and targets the innate immune response. we show that orf8b forms insoluble intracellular aggregates dependent on a valine at residue 77. agg ...201931231549
nucleoside analogues for the treatment of coronavirus infections.recent outbreaks of sars-coronavirus and mers-coronavirus (cov) have heightened awareness about the lack of vaccines or antiviral compounds approved for prevention or treatment of human or potential zoonotic covs. anti-cov drug development has long been challenged by the activity of a 3' to 5' proofreading exoribonuclease unique to covs. recently, a promising nucleoside analogue with broad-spectrum activity against covs has been identified. this review will discuss progress made in the developme ...201931125806
severe acute respiratory syndrome coronavirus orf3a protein activates the nlrp3 inflammasome by promoting traf3-dependent ubiquitination of asc.severe acute respiratory syndrome coronavirus (sars-cov) is capable of inducing a storm of proinflammatory cytokines. in this study, we show that the sars-cov open reading frame 3a (orf3a) accessory protein activates the nlrp3 inflammasome by promoting tnf receptor-associated factor 3 (traf3)-mediated ubiquitination of apoptosis-associated speck-like protein containing a caspase recruitment domain (asc). sars-cov and its orf3a protein were found to be potent activators of pro-il-1β gene transcri ...201931034780
sars coronavirus protein nsp1 disrupts localization of nup93 from the nuclear pore complex.severe acute respiratory syndrome coronavirus nonstructural protein 1 (nsp1) is a key factor in virus-induced down-regulation of host gene expression. in infected cells, nsp1 engages in a multipronged mechanism to inhibit host gene expression by binding to the 40s ribosome to block the assembly of translationally competent ribosome, and then inducing endonucleolytic cleavage and the degradation of host mrnas. here, we report a previously undetected mechanism by which nsp1 exploits the nuclear po ...201930943371
complete genome analysis of a sars-like bat coronavirus identified in the republic of korea.bats have been widely known as natural reservoir hosts of zoonotic diseases, such as severe acute respiratory syndrome (sars) and middle east respiratory syndrome (mers) caused by coronaviruses (covs). in the present study, we investigated the whole genomic sequence of a sars-like bat cov (16bo133) and found it to be 29,075 nt in length with a 40.9% g+c content. phylogenetic analysis using amino acid sequences of the orf 1ab and the spike gene showed that the bat coronavirus strain 16bo133 was g ...201931076983
molecular epidemiology, evolution and phylogeny of sars coronavirus.shortly after its emergence in southern china in 2002/2003, severe acute respiratory syndrome coronavirus (sars-cov) was confirmed to be the cause of sars. subsequently, sars-related covs (sarsr-covs) were found in palm civets from live animal markets in guangdong and in various horseshoe bat species, which were believed to be the ultimate reservoir of sarsr-cov. till november 2018, 339 sarsr-cov genomes have been sequenced, including 274 from human, 18 from civets and 47 from bats [mostly from ...201930844511
molecular epidemiology, evolution and phylogeny of sars coronavirus.shortly after its emergence in southern china in 2002/2003, severe acute respiratory syndrome coronavirus (sars-cov) was confirmed to be the cause of sars. subsequently, sars-related covs (sarsr-covs) were found in palm civets from live animal markets in guangdong and in various horseshoe bat species, which were believed to be the ultimate reservoir of sarsr-cov. till november 2018, 339 sarsr-cov genomes have been sequenced, including 274 from human, 18 from civets and 47 from bats [mostly from ...201930844511
entry of scotophilus bat coronavirus-512 and severe acute respiratory syndrome coronavirus in human and multiple animal cells.bats are natural reservoirs of severe acute respiratory syndrome coronavirus (sars-cov) and middle east respiratory syndrome cov (mers-cov). scotophilus bat cov-512 demonstrates potential for cross-species transmission because its viral rna and specific antibodies have been detected in three bat species of taiwan. understanding the cell tropism of scotophilus bat cov-512 is the first step for studying the mechanism of cross-species transmission. in this study, a lentivirus-based pseudovirus was ...201931766704
identification of diverse bat alphacoronaviruses and betacoronaviruses in china provides new insights into the evolution and origin of coronavirus-related diseases.outbreaks of severe acute respiratory syndrome (sars) in 2002, middle east respiratory syndrome in 2012 and fatal swine acute diarrhea syndrome in 2017 caused serious infectious diseases in humans and in livestock, resulting in serious public health threats and huge economic losses. all such coronaviruses (covs) were confirmed to originate from bats. to continuously monitor the epidemic-related covs in bats, virome analysis was used to classify covs from 831 bats of 15 species in yunnan, guangxi ...201931474969
global virus outbreaks: interferons as 1st responders.outbreaks of severe virus infections with the potential to cause global pandemics are increasing. in many instances these outbreaks have been newly emerging (sars coronavirus), re-emerging (ebola virus, zika virus) or zoonotic (avian influenza h5n1) virus infections. in the absence of a targeted vaccine or a pathogen-specific antiviral, broad-spectrum antivirals would function to limit virus spread. given the direct antiviral effects of type i interferons (ifns) in inhibiting the replication of ...201931771760
structural insights into coronavirus entry.coronaviruses (covs) have caused outbreaks of deadly pneumonia in humans since the beginning of the 21st century. the severe acute respiratory syndrome coronavirus (sars-cov) emerged in 2002 and was responsible for an epidemic that spread to five continents with a fatality rate of 10% before being contained in 2003 (with additional cases reported in 2004). the middle-east respiratory syndrome coronavirus (mers-cov) emerged in the arabian peninsula in 2012 and has caused recurrent outbreaks in hu ...201931522710
viruses in bats and potential spillover to animals and humans.in the last two decades, several high impact zoonotic disease outbreaks have been linked to bat-borne viruses. these include sars coronavirus, hendra virus and nipah virus. in addition, it has been suspected that ebolaviruses and mers coronavirus are also linked to bats. it is being increasingly accepted that bats are potential reservoirs of a large number of known and unknown viruses, many of which could spillover into animal and human populations. however, our knowledge into basic bat biology ...201930665189
complete genome sequence of a severe acute respiratory syndrome-related coronavirus from kenyan bats.we identified a strain of betacoronavirus btky72/rhinolophus sp./kenya/2007 (here btky72) from rectal swab samples in kenyan bats. this paper reports the complete genomic sequence of btky72, which is closely related to btcov/bm48-31/bulgaria/2008, a severe acute respiratory syndrome (sars)-related virus from rhinolophus bats in europe.201931296683
tmprss2 contributes to virus spread and immunopathology in the airways of murine models after coronavirus infection.transmembrane serine protease tmprss2 activates the spike protein of highly pathogenic human coronaviruses such as severe acute respiratory syndrome-related coronavirus (sars-cov) and middle east respiratory syndrome-related coronavirus (mers-cov). in vitro, activation induces virus-cell membrane fusion at the cell surface. however, the roles of tmprss2 during coronavirus infection in vivo are unclear. here, we used animal models of sars-cov and mers-cov infection to investigate the role of tmpr ...201930626688
severe acute respiratory syndrome coronavirus spike protein counteracts bst2-mediated restriction of virus-like particle release.bst2/tetherin, an interferon-inducible antiviral factor, can block the cellular release of various enveloped viruses. we previously reported that human coronavirus 229e (hcov-229e) infection can alleviate the bst2 tethering of hiv-1 virions by downregulating cell surface bst2, suggesting that coronaviruses are capable of encoding anti-bst2 factors. here we report our new finding that severe acute respiratory syndrome coronavirus (sars-cov) spike (s) glycoprotein, similar to vpu, is capable of an ...201931199522
structurally- and dynamically-driven allostery of the chymotrypsin-like proteases of sars, dengue and zika viruses.coronavirus 3c-like and flavivirus ns2b-ns3 proteases utilize the chymotrypsin fold to harbor their catalytic machineries but also contain additional domains/co-factors. over the past decade, we aimed to decipher how the extra domains/co-factors mediate the catalytic machineries of sars 3c-like, dengue and zika ns2b-ns3 proteases by characterizing their folding, structures, dynamics and inhibition with nmr, x-ray crystallography and md simulations, and the results revealed: 1) the chymotrypsin f ...201930217495
discovery and characterization of novel bat coronavirus lineages from kazakhstan.coronaviruses are positive-stranded rna viruses that infect a variety of hosts, resulting in a range of symptoms from gastrointestinal illness to respiratory distress. bats are reservoirs for a high diversity of coronaviruses, and focused surveillance detected several strains genetically similar to mers-coronavirus, sars-coronavirus, and the human coronaviruses 229e and nl63. the bat fauna of central asia, which link china to eastern europe, are relatively less studied than other regions of the ...201930999711
discovery and characterization of novel bat coronavirus lineages from kazakhstan.coronaviruses are positive-stranded rna viruses that infect a variety of hosts, resulting in a range of symptoms from gastrointestinal illness to respiratory distress. bats are reservoirs for a high diversity of coronaviruses, and focused surveillance detected several strains genetically similar to mers-coronavirus, sars-coronavirus, and the human coronaviruses 229e and nl63. the bat fauna of central asia, which link china to eastern europe, are relatively less studied than other regions of the ...201930999711
gilt restricts the cellular entry mediated by the envelope glycoproteins of sars-cov, ebola virus and lassa fever virus.interferons (ifns) control viral infections by inducing expression of ifn-stimulated genes (isgs) that restrict distinct steps of viral replication. we report herein that gamma-interferon-inducible lysosomal thiol reductase (gilt), a lysosome-associated isg, restricts the infectious entry of selected enveloped rna viruses. specifically, we demonstrated that gilt was constitutively expressed in lung epithelial cells and fibroblasts and its expression could be further induced by type ii interferon ...201931631785
structure of interferon-stimulated gene product 15 (isg15) from the bat species myotis davidii and the impact of interdomain isg15 interactions on viral protein engagement.bats have long been observed to be the hosts and the origin of numerous human diseases. bats, like all mammals, rely on a number of innate immune mechanisms to combat invading pathogens, including the interferon type i, ii and iii responses. ubiquitin-like interferon-stimulated gene product 15 (isg15) is a key modulator of these interferon responses. within these pathways, isg15 can serve to stabilize host proteins modulating innate immune responses and act as a cytokine. post-translational modi ...201930644842
complemented palindromic small rnas first discovered from sars coronavirus.in this study, we report for the first time the existence of complemented palindromic small rnas (cpsrnas) and propose that cpsrnas and palindromic small rnas (psrnas) constitute a novel class of small rnas. the first discovered 19-nt cpsrna uuaacaagcuuguuaaaga, named sars-cov-cpsr-19, was detected from a 22-bp dna complemented palindrome tctttaacaagcttgttaaaga in the severe acute respiratory syndrome coronavirus (sars-cov) genome. the phylogenetic analysis supported that this dna complemented p ...201830189613
genomic characterization and infectivity of a novel sars-like coronavirus in chinese bats.sars coronavirus (sars-cov), the causative agent of the large sars outbreak in 2003, originated in bats. many sars-like coronaviruses (sl-covs) have been detected in bats, particularly those that reside in china, europe, and africa. to further understand the evolutionary relationship between sars-cov and its reservoirs, 334 bats were collected from zhoushan city, zhejiang province, china, between 2015 and 2017. pcr amplification of the conserved coronaviral protein rdrp detected coronaviruses in ...201830209269
sars-coronavirus open reading frame-3a drives multimodal necrotic cell death.the molecular mechanisms underlying the severe lung pathology that occurs during sars-cov infections remain incompletely understood. the largest of the sars-cov accessory protein open reading frames (sars 3a) oligomerizes, dynamically inserting into late endosomal, lysosomal, and trans-golgi-network membranes. while previously implicated in a non-inflammatory apoptotic cell death pathway, here we extend the range of sars 3a pathophysiologic targets by examining its effects on necrotic cell death ...201830185776
cryo-em structure of the sars coronavirus spike glycoprotein in complex with its host cell receptor ace2.the trimeric sars coronavirus (sars-cov) surface spike (s) glycoprotein consisting of three s1-s2 heterodimers binds the cellular receptor angiotensin-converting enzyme 2 (ace2) and mediates fusion of the viral and cellular membranes through a pre- to postfusion conformation transition. here, we report the structure of the sars-cov s glycoprotein in complex with its host cell receptor ace2 revealed by cryo-electron microscopy (cryo-em). the complex structure shows that only one receptor-binding ...201830102747
the impacts on health, society, and economy of sars and h7n9 outbreaks in china: a case comparison study.epidemics such as sars and h7n9 have caused huge negative impacts on population health and the economy in china.201830050581
disulfiram can inhibit mers and sars coronavirus papain-like proteases via different modes.severe acute respiratory syndrome coronavirus (sars-cov) emerged in southern china in late 2002 and caused a global outbreak with a fatality rate around 10% in 2003. ten years later, a second highly pathogenic human cov, mers-cov, emerged in the middle east and has spread to other countries in europe, north africa, north america and asia. as of november 2017, mers-cov had infected at least 2102 people with a fatality rate of about 35% globally, and hence there is an urgent need to identify antiv ...201829289665
routes of transmission of influenza a h1n1, sars cov, and norovirus in air cabin: comparative analyses.identifying the exact transmission route(s) of infectious diseases in indoor environments is a crucial step in developing effective intervention strategies. in this study, we proposed a comparative analysis approach and built a model to simulate outbreaks of 3 different in-flight infections in a similar cabin environment, that is, influenza a h1n1, severe acute respiratory syndrome (sars) coronavirus (cov), and norovirus. the simulation results seemed to suggest that the close contact route was ...201829244221
attenuation of replication by a 29 nucleotide deletion in sars-coronavirus acquired during the early stages of human-to-human transmission.a 29 nucleotide deletion in open reading frame 8 (orf8) is the most obvious genetic change in severe acute respiratory syndrome coronavirus (sars-cov) during its emergence in humans. in spite of intense study, it remains unclear whether the deletion actually reflects adaptation to humans. here we engineered full, partially deleted (-29 nt), and fully deleted orf8 into a sars-cov infectious cdna clone, strain frankfurt-1. replication of the resulting viruses was compared in primate cell cultures ...201830310104
transcriptional and translational landscape of equine torovirus.the genus torovirus (subfamily torovirinae, family coronaviridae, order nidovirales) encompasses a range of species that infect domestic ungulates, including cattle, sheep, goats, pigs, and horses, causing an acute self-limiting gastroenteritis. using the prototype species equine torovirus (etov), we performed parallel rna sequencing (rna-seq) and ribosome profiling (ribo-seq) to analyze the relative expression levels of the known torovirus proteins and transcripts, chimeric sequences produced v ...201829950409
structural model of the sars coronavirus e channel in lmpg micelles.coronaviruses (cov) cause common colds in humans, but are also responsible for the recent severe acute, and middle east, respiratory syndromes (sars and mers, respectively). a promising approach for prevention are live attenuated vaccines (lavs), some of which target the envelope (e) protein, which is a small membrane protein that forms ion channels. unfortunately, detailed structural information is still limited for sars-cov e, and non-existent for other cov e proteins. herein, we report a stru ...201829474890
recent advances in aiv biosensors composed of nanobio hybrid material.since the beginning of the 2000s, globalization has accelerated because of the development of transportation systems that allow for human and material exchanges throughout the world. however, this globalization has brought with it the rise of various pathogenic viral agents, such as middle east respiratory syndrome coronavirus (mers-cov), severe acute respiratory syndrome coronavirus (sars-cov), zika virus, and dengue virus. in particular, avian influenza virus (aiv) is highly infectious and cau ...201830544883
sars-like coronavirus wiv1-cov does not replicate in egyptian fruit bats (rousettus aegyptiacus).severe acute respiratory syndrome (sars)-like wiv1-coronavirus (cov) was first isolated from rhinolophus sinicus bats and can use the human angiotensin converting enzyme 2 (ace2) receptor. in the current study, we investigate the ability of wiv1-cov to infect rousettus aegyptiacus bats. no clinical signs were observed throughout the experiment. furthermore, only four oropharyngeal swabs and two respiratory tissues, isolated on day 3 post inoculation, were found positive for viral rna. two out of ...201830572566
bioaerosol sampling for respiratory viruses in singapore's mass rapid transit network.as a leading global city with a high population density, singapore is at risk for the introduction of novel biological threats. this risk has been recently reinforced by human epidemics in singapore of sars coronavirus, 2009 pandemic h1n1 influenza a virus, and enterovirus 71. other major threats to singapore include mers-coronavirus and various avian and swine influenza viruses. the ability to quickly identify and robustly track such threats to initiate an early emergency response remains a sig ...201830504827
the papain-like protease determines a virulence trait that varies among members of the sars-coronavirus species.sars-coronavirus (cov) is a zoonotic agent derived from rhinolophid bats, in which a plethora of sars-related, conspecific viral lineages exist. whereas the variability of virulence among reservoir-borne viruses is unknown, it is generally assumed that the emergence of epidemic viruses from animal reservoirs requires human adaptation. to understand the influence of a viral factor in relation to interspecies spillover, we studied the papain-like protease (plp) of sars-cov. this key enzyme drives ...201830248143
basic scholarship in biosafety is critically needed to reduce risk of laboratory accidents.our firm conducted a risk/benefit assessment of "gain-of-function" research, as part of the deliberative process following a u.s. moratorium on the research (u.s. department of health and human services, u.s. government gain-of-function deliberative process and research funding pause on selected gain-of-function research involving influenza, mers, and sars viruses, 2014). due to significant missing but theoretically acquirable data, our biosafety assessment faced limitations, and we were forced ...201728405626
pathogen genomic surveillance elucidates the origins, transmission and evolution of emerging viral agents in china.in the past twenty years, numerous novel zoonotic viral agents with pandemic potential have emerged in china, such as the severe acute respiratory syndrome (sars) coronavirus and, more recently, the avian-origin influenza a/h7n9 virus, which have caused outbreaks among humans with high morbidity and mortality. in addition, several emerging and re-emerging viral pathogens have also been imported into china from travelers, e.g. the middle east respiratory syndrome (mers) coronavirus and zika virus ...201729270793
discovery of a rich gene pool of bat sars-related coronaviruses provides new insights into the origin of sars coronavirus.a large number of sars-related coronaviruses (sarsr-cov) have been detected in horseshoe bats since 2005 in different areas of china. however, these bat sarsr-covs show sequence differences from sars coronavirus (sars-cov) in different genes (s, orf8, orf3, etc) and are considered unlikely to represent the direct progenitor of sars-cov. herein, we report the findings of our 5-year surveillance of sarsr-covs in a cave inhabited by multiple species of horseshoe bats in yunnan province, china. the ...201729190287
viral rewiring of cellular lipid metabolism to create membranous replication compartments.positive-strand rna (+rna) viruses (e.g. poliovirus, hepatitis c virus, dengue virus, sars-coronavirus) remodel cellular membranes to form so-called viral replication compartments (vrcs), which are the sites where viral rna genome replication takes place. to induce vrc formation, these viruses extensively rewire lipid metabolism. disparate viruses have many commonalities as well as disparities in their interactions with the host lipidome and accumulate specific sets of lipids (sterols, glyceroph ...201728242560
surveillance of bat coronaviruses in kenya identifies relatives of human coronaviruses nl63 and 229e and their recombination history.bats harbor a large diversity of coronaviruses (covs), several of which are related to zoonotic pathogens that cause severe disease in humans. our screening of bat samples collected in kenya from 2007 to 2010 not only detected rna from several novel covs but, more significantly, identified sequences that were closely related to human covs nl63 and 229e, suggesting that these two human viruses originate from bats. we also demonstrated that human cov nl63 is a recombinant between nl63-like viruses ...201728077633
the severe acute respiratory syndrome coronavirus nucleocapsid inhibits type i interferon production by interfering with trim25-mediated rig-i ubiquitination.severe acute respiratory syndrome (sars) is a respiratory disease, caused by a coronavirus (sars-cov), that is characterized by atypical pneumonia. the nucleocapsid protein (n protein) of sars-cov plays an important role in inhibition of type i interferon (ifn) production via an unknown mechanism. in this study, the sars-cov n protein was found to bind to the spry domain of the tripartite motif protein 25 (trim25) e3 ubiquitin ligase, thereby interfering with the association between trim25 and r ...201728148787
discovery of a highly divergent coronavirus in the asian house shrew from china illuminates the origin of the alphacoronaviruses.although shrews are one of the largest groups of mammals little is known about their role in the evolution and transmission of viral pathogens including coronaviruses. we captured 266 asian house shrews (suncus murinus) in jiangxi and zhejiang provinces, china, during 2013-2015. coronavirus (cov) rna was detected in 24 asian house shrews, with an overall prevalence of 9.02%. complete viral genome sequences were successfully recovered from the rna positive samples. the newly discovered shrew cov ...201728637760
t-cell immunity of sars-cov: implications for vaccine development against mers-cov.over 12 years have elapsed since severe acute respiratory syndrome (sars) triggered the first global alert for coronavirus infections. virus transmission in humans was quickly halted by public health measures and human infections of sars coronavirus (sars-cov) have not been observed since. however, other coronaviruses still pose a continuous threat to human health, as exemplified by the recent emergence of middle east respiratory syndrome (mers) in humans. the work on sars-cov widens our knowled ...201727840203
alisporivir inhibits mers- and sars-coronavirus replication in cell culture, but not sars-coronavirus infection in a mouse model.currently, there is no registered treatment for infections with emerging zoonotic coronaviruses like sars- and mers-coronavirus. we here report that in cultured cells low-micromolar concentrations of alisporivir, a non-immunosuppressive cyclosporin a-analog, inhibit the replication of four different coronaviruses, including mers- and sars-coronavirus. ribavirin was found to further potentiate the antiviral effect of alisporivir in these cell culture-based infection models, but this combination t ...201727840112
kanyawara virus: a novel rhabdovirus infecting newly discovered nycteribiid bat flies infesting previously unknown pteropodid bats in uganda.bats are natural reservoir hosts of highly virulent pathogens such as marburg virus, nipah virus, and sars coronavirus. however, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. the intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. usi ...201728706276
in silico analysis of the cyanobacterial lectin scytovirin: new insights into binding properties.scytovirin is a lectin isolated from the cyanobacterium scytonema varium that has shown activity against hiv, sars coronavirus and zaire ebola virus. its 95 amino acids are divided into two structural domains (sd), the first spanning amino acids 1-48 (sd1) and the second 49-95 (sd2). interestingly, the domains are nearly identical but differ in their affinities for carbohydrates. with the aim of enhancing understanding of the binding properties of scytovirin, we performed molecular dynamics (md) ...201728756560
comprehensive structural analysis of designed incomplete polypeptide chains of the replicase nonstructural protein 1 from the severe acute respiratory syndrome coronavirus.the cotranslational folding is recognized as a very cooperative process that occurs after the nearly completion of the polypeptide sequence of a domain. here we investigated the challenges faced by polypeptide segments of a non-vectorial β-barrel fold. besides the biological interest behind the sars coronavirus non-structural protein 1 (nsp1, 117 amino acids), this study model has two structural features that motivated its use in this work: 1- its recombinant production is dependent on the tempe ...201728750053
two-amino acids change in the nsp4 of sars coronavirus abolishes viral replication.infection with coronavirus rearranges the host cell membrane to assemble a replication/transcription complex in which replication of the viral genome and transcription of viral mrna occur. although coexistence of nsp3 and nsp4 is known to cause membrane rearrangement, the mechanisms underlying the interaction of these two proteins remain unclear. we demonstrated that binding of nsp4 with nsp3 is essential for membrane rearrangement and identified amino acid residues in nsp4 responsible for the i ...201728738245
role of fomites in sars transmission during the largest hospital outbreak in hong kong.the epidemic of severe acute respiratory syndrome (sars) had a significant effect on global society in the early 2000s and the potential of its resurgence exists. studies on the modes of transmission of sars are limited though a number of outbreak studies have revealed the possible airborne route. to develop more specific and effective control strategies, we conducted a detailed mechanism-based investigation that explored the role of fomite transmission in the well-known ward 8a outbreak. we con ...201728727803
toward the identification of viral cap-methyltransferase inhibitors by fluorescence screening assay.two highly pathogenic human coronaviruses associated with severe respiratory syndromes emerged since the beginning of the century. the severe acute respiratory syndrome sars-coronavirus (cov) spread first in southern china in 2003 with about 8000 infected cases in few months. then in 2012, the middle east respiratory syndrome (mers-cov) emerged from the arabian peninsula giving a still on-going epidemic associated to a high fatality rate. covs are thus considered a major health threat. this is e ...201728676301
targeting endosomal acidification by chloroquine analogs as a promising strategy for the treatment of emerging viral diseases.emerging viruses such as hiv, dengue, influenza a, sars coronavirus, ebola, and other viruses pose a significant threat to human health. majority of these viruses are responsible for the outbreaks of pathogenic lethal infections. to date, there are no effective therapeutic strategies available for the prophylaxis and treatment of these infections. chloroquine analogs have been used for decades as the primary and most successful drugs against malaria. concomitant with the emergence of chloroquine ...201728596841
Refresh
firstprev
12345678910...
nextlast
Displaying items 601 - 700 of 3881