Publications

TitleAbstractYear(sorted descending)
Filter
PMID
Filter
molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, thermus thermophilus hb8.the gene coding for isocitrate dehydrogenase of an extreme thermophile, thermus thermophilus hb8, was cloned and sequenced. this gene consists of a single open reading frame of 1,485 bp preceded by a shine-dalgarno ribosome binding site. promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. the g + c content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. on the basis of the deduced amino ac ...19921539996
sequence and base modifications of two phenylalanine-trnas from thermus thermophilus hb8. 19921738592
cloning, nucleotide sequence, and engineered expression of thermus thermophilus dna ligase, a homolog of escherichia coli dna ligase.we have cloned and sequenced the gene for dna ligase from thermus thermophilus. a comparison of this sequence and those of other ligases reveals significant homology only with that of escherichia coli. the overall amino acid composition of the thermophilic ligase and the pattern of amino acid substitutions between the two proteins are consistent with compositional biases in other thermophilic enzymes. we have engineered the expression of the t. thermophilus gene in escherichia coli, and we show ...19911840584
cloning and expression in escherichia coli of the structural gene coding for the monomeric protein of the s layer of thermus thermophilus hb8.the gene coding for the 100 kda monomeric protein (p100) of the s layer of thermus thermophilus hb8 has been cloned in the escherichia coli plasmid vector puc9. recombinant plasmids were selected by colony screening with anti-p100 rabbit antiserum. the gene, named slpa (for surface layer protein a), was identified in a bacterial clone harboring a hybrid plasmid, pmf4, with a 5.8-kbp insert. this plasmid consistently expressed a protein specifically recognized by anti-p100 antiserum. expression w ...19911885515
phosphorothioate-containing rnas show mrna activity in the prokaryotic translation systems in vitro.phosphorothioate-containing rnas were generated by transcription of coliphage t7 dna using the sp diastereomers of ribonucleoside 5'-o-(1-thiotriphosphates) and t7 rna polymerase. rnas in which a single nucleotide was substituted by the corresponding nucleoside phosphorothioate functioned as mrna in the cell-free translation systems prepared from escherichia coli and from an extreme thermophilic bacterium, thermus thermophilus. this substitution increased the efficiency of protein synthesis by s ...19912011526
processing and termination of 23s rrna-5s rrna-trna(gly) primary transcripts in thermus thermophilus hb8.the two 23s rrna-5s rrna-trnagly operons from the extreme thermophilic eubacterium thermus thermophilus hb8 were used to characterized the in vivo processing and termination of 23s rrna-5s rrna-trnagly primary transcripts in this organism by nuclease s1 mapping. a processing site in the pre-23s rrna 3'-flanking region is located approximately 25 nucleotides upstream of 5s rrna and precedes a putative 23s-5s rrna spacer antitermination box a. cleavage at this site and 5s rrna 5' end formation wer ...19912013580
xylose (glucose) isomerase gene from the thermophile thermus thermophilus: cloning, sequencing, and comparison with other thermostable xylose isomerases.the xylose isomerase gene from the thermophile thermus thermophilus was cloned by using a fragment of the streptomyces griseofuscus gene as a probe. the complete nucleotide sequence of the gene was determined. t. thermophilus is the most thermophilic organism from which a xylose isomerase gene has been cloned and characterized. the gene codes for a polypeptide of 387 amino acids with a molecular weight of 44,000. the thermus xylose isomerase is considerably more thermostable than other described ...19912022613
molecular cloning of a ribonuclease h (rnase hi) gene from an extreme thermophile thermus thermophilus hb8: a thermostable rnase h can functionally replace the escherichia coli enzyme in vivo.a dna fragment encoding ribonuclease h (ec 3. 1.26.4) was isolated from an extreme thermophilic bacterium, thermus thermophilus hb8, by its ability to complement the temperature-sensitive growth of an escherichia coli rnha deficient mutant. the primary amino acid sequence showed 56% similarity to that of e. coli rnase hi but little or no homology to e. coli rnase hii. enzymes derived from thermophilic organisms tend to have fewer cysteines than their bacterial counterparts. however, t. thermophi ...19911653414
production and extracellular secretion of aqualysin i (a thermophilic subtilisin-type protease) in a host-vector system for thermus thermophilus.aqualysin i is synthesized as a large precursor, processed, and secreted into the culture medium by thermus aquaticus yt-1. an expression plasmid for the aqualysin i gene in t. thermophilus hb27 was constructed. t. thermophilus cells harboring the recombinant plasmid produced correctly processed aqualysin i, and the mature enzyme was secreted into the culture medium.199116348594
cloning of alpha- and beta-galactosidase genes from an extreme thermophile, thermus strain t2, and their expression in thermus thermophilus hb27.the genes encoding thermostable alpha- and beta-galactosidases from an extremely thermophilic bacterium, thermus strain t2, were cloned in escherichia coli. the alpha-galactosidase gene was located just downstream from the beta-galactosidase gene. the genes were introduced into thermus thermophilus hb27 with the aid of thermus cryptic plasmid ptt8, and beta-galactosidases were expressed constitutively.19902167630
cloning and sequence analysis of tryptophan synthetase genes of an extreme thermophile, thermus thermophilus hb27: plasmid transfer from replica-plated escherichia coli recombinant colonies to competent t. thermophilus cells.tryptophan synthetase genes (trpba) of the extreme thermophile thermus thermophilus hb27 were cloned by a novel method of direct plasmid transfer from replica-plated escherichia coli recombinant colonies to competent t. thermophilus hb27 trpb cells. the nucleotide sequences of the trpba genes were determined. the amino acid sequences deduced from the nucleotide sequences of thermus trpb and trpa were found to have identities of 54.8 and 28.7%, respectively, with those of e. coli trpb and trpa ge ...19902188962
interaction of the isolated domain ii/iii of thermus thermophilus elongation factor tu with the nucleotide exchange factor ef-ts.the middle and c-terminal domain (domain ii/iii) of elongation factor tu from thermus thermophilus lacking the gtp/gdp binding domain have been prepared by treating nucleotide-free protein with staphylococcus aureus v8 protease. the isolated domain ii/iii of ef-tu has a compact structure and high resistance against tryptic treatment and thermal denaturation. as demonstrated by circular dichroism spectroscopy, the isolated domain ii/iii does not contain any alpha-helical structure. nucleotide exc ...19902263451
sequences of four trna genes adjacent to the tuf2 gene of thermus thermophilus. 19902336371
nucleotide sequence of the thermus thermophilus hb8 rps12 and rps7 genes coding for the ribosomal proteins s12 and s7. 19902362824
nucleotide sequence of the thermus thermophilus hb8 gene coding for elongation factor g. 19892587224
dna sequencing with thermostable tet dna polymerase from thermus thermophilus. 19892602167
thermus thermophilus 16s rrna is transcribed from an isolated transcription unit.a cloned 16s rrna gene from the extreme thermophilic eubacterium thermus thermophilus hb8 was used to characterize the in vivo expression of the 16s rrna genes in this organism by nuclease s1 mapping. the gene represents an isolated transcription unit encoding solely 16s rrna. under exponential growth conditions, transcription was initiated at a single promoter, which represents the structural equivalent of escherichia coli rrn p2 promoters. the promoter-leader region was very similar to the e. ...19892722737
properties of a copper-containing cytochrome ba3: a second terminal oxidase from the extreme thermophile thermus thermophilus.we describe an alternate terminal oxidase found in the plasma membrane of thermus thermophilus and designate it cytochrome ba3. the enzyme consists of a single approximately equal to 35-kda polypeptide that binds one heme b molecule, one heme a molecule, and two cu ions. optical spectra suggest the presence of cytochrome b, cytochrome a3, and cua in this protein. quantitative epr and mössbauer studies of the oxidized protein indicate the presence of one low-spin ferric heme, which is assigned to ...19882842747
nucleotide sequence of the 4.5s rna gene from thermus thermophilus hb8. 19882459659
complete nucleotide sequence of a 23s ribosomal rna gene from thermus thermophilus hb8. 19882459660
nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile thermus thermophilus. comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, thermus thermophilus, was cloned in escherichia coli and its complete nucleotide sequence determined. the gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated mr 41,791) with an extreme bias for g or c (93.1%) in the codon third base position. comparison of the deduced amino acid sequence wit ...19883052437
partial purification and characterization of an inactive precursor of pseudomonas aeruginosa elastase.an inactive precursor of the extracellular elastase of pseudomonas aeruginosa was extensively purified by immunoadsorption chromatography of the soluble bacterial cell fraction on a column of sepharose coupled to antielastase antibodies. sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified precursor fraction revealed two major protein bands with molecular weights of about 36,000 (p36) and 20,000 (p20) that in the absence of sodium dodecyl sulfate were associated with each ot ...19883125153
ca2+-stabilized oligomeric protein complexes are major components of the cell envelope of "thermus thermophilus" hb8.the major cell envelope proteins of the gram-negative thermophilic eubacterium "thermus thermophilus" gave an electrophoretical pattern characterized by two well-defined groups of bands. one of them showed up as four regularly spaced proteins (hmrps) with mrs higher than 310,000, a value corresponding to the smaller hmrp. the second one was formed by two proteins with mrs of 100,000 (p100) and 84,000 (p84). hmrps p100 and p84 were apparently located in the outer layer of the cell envelope, as in ...19883131301
malate dehydrogenase from the thermophilic green bacterium chloroflexus aurantiacus: purification, molecular weight, amino acid composition, and partial amino acid sequence.malate dehydrogenase (mdh; ec 1.1.1.37) from the thermophilic green nonsulfur bacterium chloroflexus aurantiacus was purified by a two-step procedure involving affinity chromatography and gel filtration. the enzyme consists of identical subunits which had molecular weights of approximately 35,000. in its active form at 55 degrees c, it formed tetramers. at lower temperatures, inactive dimers and trimers existed. antibodies against the purified enzyme were produced, and immunotitration and enzyme ...19883133356
acceleration of starvation- and glycerol-induced myxospore formation by prior heat shock in myxococcus xanthus.the effect of heat shock on myxococcus xanthus was investigated during both glycerol- and starvation-induced development. cells heat shocked at 40 degrees c for 1 h prior to a development-inducing signal displayed an accelerated rate of myxospore formation at 30 degrees c. additionally, m. xanthus cells heat shocked prior to glycerol induction formed a greater total number of myxospores when sporulation was complete than did control cells maintained at 30 degrees c. however, in starvation-induce ...19883141380
predisposing factors in microbial keratitis: the significance of contact lens wear.fifty-three patients consecutively admitted to moorfields eye hospital for treatment of suspected microbial keratitis were examined to identify predisposing factors. the principal associations were pre-existing corneal disease (22 patients (41.5%] and contact lens wear (22 patients (41.5%]. in 13 cases (25%) contact lens wear was the only factor in patients with otherwise healthy eyes using contact lenses as an alternative to spectacles. gram-negative keratitis was more frequent in the lens wear ...19883147696
purification and biochemical characterization of tellurite-reducing activities from thermus thermophilus hb8.cell-free extracts of thermus thermophilus hb8 catalyze the in vitro, nadh-dependent reduction of potassium tellurite (k2teo3). three different protein fractions with tellurite-reducing activities were identified. two exhibited high molecular weight and were composed of at least two different polypeptides. the protein in the third fraction was purified to homogeneity and had a single polypeptide chain of 53 to 54 kilodaltons, with an isoelectric point of 8.1. each enzyme was thermostable, the te ...19883384810
nucleotide sequence of thermus thermophilus hb8 gene coding 16s rrna. 19883419905
resistance of thermus spp. to potassium tellurite.two members of the genus thermus were examined for their resistance to toxic inorganic compounds. they both proved to be fairly resistant to tellurite and selenite and to many other heavy metal salts. cell extracts of thermus thermophilus hb8 and of t. flavus at-62 catalyze the reduction of k(2)teo(3) in a reaction which is dependent on nadh oxidation.198816347571
laboratory and clinical evaluation of isolation media for campylobacter jejuni.six selective isolation media were evaluated for their ability to support the growth of campylobacter jejuni. colony counts of 70 isolated strains of c. jejuni and recovery studies on these strains in simulated positive feces samples demonstrated that bolton and hutchinson' charcoal, cefoperazone, deoxycholate agar and karmali's charcoal-based selective medium produced the highest recovery rates with the greatest suppression of other fecal flora. c. jejuni colonies were more easily recognized on ...19873429621
sequences implicated in the processing of thermus thermophilus hb8 23s rrna.nuclease s1 mapping analyses were performed in order to detect processing intermediates of pre-23s rrna from thermus thermophilus hb8. two processing sites were identified downstream the start of transcription and several consecutive cleavage sites are associated with the mature 5'-end. in the 3'-flanking region one "primary" site and two cleavages which generate short-living intermediates were detected. a series of successive intermediates in the region of the mature 3'-end implies the existenc ...19873313273
sequence and identification of the nucleotide binding site for the elongation factor tu from thermus thermophilus hb8.two structural genes for the thermus thermophilus elongation factor tu (tuf) were identified by cross-hybridization with the tufa gene from e. coli. the sequence of one of these tuf genes, localized on a 6.6 kb bam hi fragment, was determined and confirmed by partial protein sequencing of an authentic elongation factor tu from t. thermophilus hb8. expression of this tuf gene in e. coli minicells provided a low amount of immuno-precipitable thermophilic ef-tu. affinity labeling of the t. thermoph ...19873317278
monoclonal antibodies in identifying neisseria gonorrhoeae: cautionary note. 19873123361
the circular-dichroic properties of the 'rieske' iron-sulphur protein in the mitochondrial ubiquinol: cytochrome c reductase.we have studied the c.d. spectra of the 'rieske' iron-sulphur protein isolated from the ubiquinol: cytochrome c reductase (bc1 complex) of bovine heart mitochondria. both the oxidized and the reduced form of the 'rieske' protein display a series of well-resolved c.d. features resembling those reported for the 'rieske'-type iron-sulphur protein purified from the bacterium thermus thermophilus [fee, findling, yoshida, hille, tarr, hearshen, dunham, day, kent & münck (1984) j. biol, chem. 259, 124- ...19873032159
the sequence of the 6s rna gene of pseudomonas aeruginosa.from the gram-negative eubacterium pseudomonas aeruginosa we have isolated a stable 6s rna, approximately 180 nucleotides in length. the rna was partially sequenced and identified by comparison with the known escherichia coli 6s rna sequence. southern hybridizations revealed a single copy gene coding for the 6s rna. dna from other prokaryotes, i.e. e. coli, thermus thermophilus, bacillus subtilis, bacillus stearothermophilus and halobacterium maris mortui, did not give detectable hybridization s ...19872438656
the interaction of spermine and pentamines with dna.we studied the effects of spermine, two naturally-occurring pentamines isolated from the thermophile thermus thermophilus and one synthetic pentamine on the aggregation and 'melting' temperature of calf-thymus dna and on the b-to-z transition of poly(dg-me5dc). all pentamines caused aggregation of dna at much lower concentrations than that of spermine. concentrations that increased the melting temperature of dna and induced the b-to-z transition in poly(dg-me5dc) were different for each pentamin ...19873663115
genetic transformation of the extreme thermophile thermus thermophilus and of other thermus spp.genetic transformation of auxotrophs of the extreme thermophile thermus thermophilus hb27 to prototrophy was obtained at high frequencies of 10(-2) to 10(-1) when proliferating cell populations were exposed to chromosomal dna from a nutritionally independent wild-type strain. the transformation frequency was proportional to the dna concentration from 10 pg/ml to 100 ng/ml. t. thermophilus hb27 cells did not require chemical treatment to induce competence, although optimal transformation was obta ...19863957870
ser-trnas from bovine mitochondrion form ternary complexes with bacterial elongation factor tu and gtp.transfer ribonucleic acids were isolated from mitochondria of bovine heart and aminoacylated in vitro by a crude mitochondrial enzyme. ser-trnaserucn and ser-trnaseragy were isolated and characterized by partial sequencing. although these trnas possess unique structural features not found in any bacterial trna, they form a ternary complex with elongation factor from the extreme thermophilic bacterium thermus thermophilus and gtp.19863639440
a comparison of virulence of two strains of legionella pneumophila based on experimental aerosol infection of guinea-pigs.two strains of legionella pneumophila (lp) serogroup i, of differing virulence, were examined in terms of numbers of viable organisms in tissues, pyrexia and mortality following aerosol infection. the corby strain was the more virulent, with pyrexia and deaths of guinea-pigs 3 to 6 days after infection. this strain multiplied very rapidly in the lungs to reach a peak of 5 x 10(11) viable organisms/lung. organisms were present in the blood, liver, spleen and kidney. the philadelphia-1 strain (nct ...19854020112
comparative structural analysis of eubacterial 5s rrna by oxidation of adenines in the n-1 position.adenines in free 5s rrna from escherichia coli, bacillus stearothermophilus and thermus thermophilus have been oxidized at their n-1 position using monoperphthalic acid. the determination of the number of adenine 1-n-oxides was on the basis of uv spectroscopic data of the intact molecule. identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. implica ...19846201825
the number of ribosomal rna genes in thermus thermophilus hb8.we have examined the number of rrna genes in thermus thermophilus hb8 by hybridization of bam hi -, hind iii - and pst i - digests of dna to 3'- (3 2p) 23s, 16s and 5s rrnas according to the southern procedure. the restriction gels gave two radioactive bands with 23s and 5s rrna. furthermore, band positions were indistinguishable from one another when 23s and 5s rrnas were used as probes to bam hi and hind iii digests, indicating that each band contains sequences corresponding to the 3'-end of 2 ...19846322133
terminal heterogeneity and corrections of the nucleotide sequence of 5s rrna from an extreme thermophile, thermus thermophilus hb8.the nucleotide sequence of 5s rrna from an extreme thermophile thermusthermophilus hb8 has been re-examined and determined as [formula: see text] the present study could resolve previously ambiguous residues and find two additional residues (g(8 3), c(9 7)), g at position 89 and two terminal heterogeneities which are exactly the same as reported with thermusaquaticus 5s rrna.images19836828381
consensus structure and evolution of 5s rrna.a consensus structure model of 5s rrna presenting all conserved nucleotides in fixed positions has been deduced from the primary and secondary structure of 71 eubacterial, archaebacterial, eukaryotic cytosolic and organellar molecules. phylogenetically related groups of molecules are characterized by nucleotide deletions in helices iii, iv and v, and by potential base pair interactions in helix iv. the group-specific deletions are correlated with the early branching pattern of a dendrogram calcu ...19836835839
glycolipids from some extreme thermophilic bacteria belonging to the genus thermus.the lipids of thermus aquaticus yt1, thermus thermophilus hb8, thermus sp. strains h and j (from icelandic hot springs), and thermus sp. strain nh (from domestic hot water) have been investigated. each strain contained two major components, a glycolipid and a glycophospholipid, which have been isolated and analyzed. all of the strains contained as the principal component (41 to 57% of total lipid) a diacyldiglycosyl-(n-acyl)glycosaminylglucosylglycerol, but the five glycolipids differed in carbo ...19827054151
purification and characterization of two new modification methylases: mclai from caryophanon latum l and mtaqi from thermus aquaticus yti.a method for detecting type ii modification methylases and determining their methylation site by assaying the ability of methylated dna to be cleaved by heterologous restriction enzymes is described and applied to the isolation of the restriction modification methylases from thermus thermophilus hb8, thermus aquaticus yti and caryophanon latum l. m.taqi is shown to have a methylation specificity identical to m.thi (tcgmea). m.clai methylates at adenine and protects a subset of tthi sites indicat ...19816278447
the nucleotide sequence of 5s rrna from an extreme thermophile, thermus thermophilus hb8.using 3'- and 5'-end labelling sequencing techniques, the following primary structure for thermusthermophilus hb8 5s rna could be determined: paa (u) cccccgugcccauagcggcguggaaccacccguucccauuccgaacacggaagugaaacgcgccagcgcc gaugguacuggcggacgaccgcugggagaguaggucggugcggggga (oh). this sequence is most similar to thermusaquaticus 5s rna with which it shows 85% homology.19816171775
a spite specific endonuclease from thermus thermophilus 111, tth111i.a site specific endonuclease with novel specificity has been isolated from thermus thermophilus strain 111 and named tth111i. tth111i cleaves lambda dna into three fragments of 23.5, 25.7 and 50.8% of the total length, and cole1 dna into two fragments of nearly equal length. the sequences around tth111i cleavage sites of cole1 and lambda dna were determined by the maxam and gilbert method and the two dimensional mapping method. the results suggest that tth111i recognizes the dna sequence (formu ...19806243779
properties of a copper-containing cytochrome c1aa3 complex: a terminal oxidase of the extreme thermophile thermus thermophilus hb8.from the plasma membrane of thermus thermophilus hb8 we have partially purified a detergent-solubilized complex of cytochromes a and c1 that actively catalyzes the transfer of electrons from ascorbate via a redox dye to oxygen. the complex is composed of two types of polypeptides, with molecular weights of approximately 55,000 and 33,000. quantitative analysis revealed the presence of heme a, heme c, and copper in a ratio of 2:1:2, with the heme a being present at 10 +/- 1.3 nmol/mg of protein. ...19806244539
a second site specific endonuclease from thermus thermophilus 111, tth111ii.a second site specific endonuclease with novel specificity has been purified from thermus thermophilus strain 111 and named tth111ii. the enzyme is active at temperature up to 80 degrees c and requires mg2+ or mn2+ for endonuclease activity. tth111ii cleaves phi x174rfdna into 11 fragments and lambda na into more than 25 fragments. from the 5'-terminal sequences of tthlllii fragments of phi x174rfdna determined by the two dimensional homochromatography and the survey on nucleotide sequence of ph ...19806255411
nuclease tt1 from thermus thermophilus hb8 has an endonuclease activity preferential to circular dnas.homogeneously purified nuclease tt1 from thermus thermophilus hb8 is known as an exonuclease to produce 5'-mononucleotides. besides the exonuclease activity, nuclease tt1 also possesses endonuclease activity preferential to superhelical (form i) and single-stranded circular dna. although the rate of cleavage is slower than that of form i, covalently closed circular dna (form i') is also cleaved. form i dna was nicked to yield relaxed circles (form ii) first, and was then nicked at the opposite s ...19806258147
thermally induced biosynthesis of 2'-o-methylguanosine in trna from an extreme thermophile, thermus thermophilus hb27.the contents of 2'-o-methylguanosine and 1-methyladenosine in unfractionated trna obtained from thermus thermophilus hb27 were found to increase significantly when the bacterium was grown at a higher temperature (80 degrees c). s-adenosyl-l-methionine-dependent trna (guanosine-2')-methyltransferase (ec 2.1.1.34) and trna (adenine-1)-methyltransferase (ec 2.1.1.36) were detected in a cell-free extract of the thermophile, and both of them were partially purified. trna (guanosine-2')-methyltransfer ...19806990416
Refresh
firstprev
...5152535455
nextlast
Displaying items 5401 - 5451 of 5451