Publications

TitleAbstractYear(sorted descending)
Filter
PMID
Filter
[transcript expression of the cpl 5x, bmd-3a, bmd-10 interrogans leptospira].total rna of leptospira interrogans sv lai strain 017 was prepared by the method of licl-urea, and was used in dot hybridization with biotin-labelled dna probes. the probes included bmd-3a, bmd-10, which were the leptospirial protective antigen genes, and cpl 5x, which was the genus specific gene of interrogans leptospira. all of the three probes have shown various degrees of hybridization signs, proving that they all have transcript expression in leptospira. the transcript expression is the mai ...19947538094
detection of leptospiral dna by pcr.an ecori fragment (1.2 kb) which is highly conserved among leptospira interrogans isolated in korea was cloned into pbluescript vector from l. interrogans serovar lai wh20. the ecori fragment was sequenced, and a pair of primers (lp1 and lp2) was designed for pcr assay. pcr amplification of target dna obtained from cultured l. interrogans showed that 274 bp could be detected when as little as 100 fg of leptospiral genomic dna was used in the reaction mixture. no amplification of dna was detected ...19948027306
detection and identification of leptospira interrogans serovars by pcr coupled with restriction endonuclease analysis of amplified dna.primers for pcr were selected from a sequenced fragment of clone pl590, which contains a repetitive element present in the genome of leptospira interrogans serovar hardjo type hardjoprajitno (m. l. pacciarini, m. l. savio, s. tagliabue, and c. rossi, j. clin. microbiol. 30:1243-1249, 1992). a specific dna fragment was amplified from the genomic dnas of serovar hardjo type hardjoprajitno and nine serovars also belonging to l. interrogans as a consequence of the spread of the same or a closely rel ...19948027346
the effect of vaccination against leptospira interrogans serovar hardjo infection at the time of service on pregnancy rates in dairy cows.fertility data from 16 dairy herds vaccinated against hardjo infection were used to assess pregnancy rates in cattle vaccinated around the day of mating. there was no improvement in pregnancy rates 30-60 d after vaccination. pregnancy rates in the period 5 d before and 10 d after vaccination were statistically lower than those found in 30-60 d around vaccination.19948038799
leptospirosis complicated by a jarisch-herxheimer reaction and adult respiratory distress syndrome: case report.leptospirosis, severe infection due to leptospira interrogans, is a potentially lethal disease that causes multiple organ failure. in addition to hepatic, renal, and cns involvement, which are classic complications of leptospirosis, the disease may also be complicated by adult respiratory distress syndrome. treatment with penicillin may precipitate a severe jarisch-herxheimer reaction. the mechanisms of leptospira-induced toxicity remain obscure. we report a near-fatal case of leptospirosis in a ...19948086528
observations on three outbreaks of leptospira interrogans serovar pomona infection in lambs.sickness and deaths associated with leptospirosis were reported in three lamb flocks in the manawatu region. the clinical, pathological and serological features of leptospiru interrogans serovar pomona infection are described. the mucous membranes of affected animals were pale and jaundiced. haemoglobinuria, haemoglobinaemia and centrilobular hepatocellular necrosis were also consistent findings. all clinically sick lambs had very high titres in the microscopic agglutination test for l. pomona. ...199416031763
prevalence of antibodies to different leptospira interrogans serovars in pigs on large farms.a seroepidemiological survey was carried out in the province of badajoz (south-western spain) in order to determine the presence and spread of leptospira interrogans. the 521 sera tested were drawn from breeding sows on 28 large farms (15 with fewer than 60 and 13 with over 60 breeders). immunological testing was performed using the martin-pettit micro-agglutination technique. pigs with titres equal to or greater than 1:100 were considered positive. haemolysed and/or contaminated test sera were ...19947701864
leptospira species categorized by arbitrarily primed polymerase chain reaction (pcr) and by mapped restriction polymorphisms in pcr-amplified rrna genes.reference strains from 48 selected serovars representing eight species of leptospira were examined by two polymerase chain reaction (pcr)-based strategies. first, mapped restriction site polymorphisms (mrsp) were examined in pcr products from portions of rrs (16s rrna gene) and rrl (23s rrna gene). twenty mrsp and 2 length polymorphisms were used to group reference strains into 16 mrsp profiles. species assignments were consistent with those obtained by a second method, genomic fingerprinting wi ...19938094390
molecular analysis of the hsp (groe) operon of leptospira interrogans serovar copenhageni.a chromosomal gene library of leptospira interrogans serovar copenhageni strain wijnberg was constructed in phage lambda gt11. plaque immunoassay with r alpha p64 antiserum identified one clone expressing a putative groel homologue. dna sequence analysis of the 2.4 kb ecori-bam hi cloned fragment from strain wijnberg revealed two open reading frames encoding polypeptides of 10.5 kda (hsp10) and 58 kda (hsp58). sequence comparison of the deduced amino acid sequences of these orfs confirmed the op ...19938101351
the search for improved methods for diagnosing leptospirosis: the approach of a laboratory in brescia, italy.the authors describe work in progress at the laboratory in brescia, italy, on the application of molecular methods to the diagnosis of leptospirosis. this work includes the following: a) development of polymerase chain reaction (pcr) assays capable of amplifying specific deoxyribonucleic acid fragments from most leptospira interrogans strains. b) development of a microtitre-based assay for rapid detection of pcr-positive samples. c) characterisation of leptospira strains through restriction endo ...19938104548
biological activity of a peptidoglycan extracted from leptospira interrogans: in vitro studies.peptidoglycan (pg) has been isolated from some species of spirochaetes, including leptospira interrogans. although leptospiral pg has been chemically characterized, no study has been carried out on its potential biological activity. since pg of treponema and borrelia is biologically active both in vivo and in vitro, we investigated the capacity of a leptospiral pg preparation to induce relevant biological effects. pg extracted from l. interrogans strain teramo was mitogenic at 0.1 microgram ml-1 ...19938126423
effect of streptomycin treatment on the shedding of and the serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis in experimentally infected cows.shedding patterns of and serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis (l. hardjobovis) have been studied in experimentally infected cows treated with streptomycin in comparison to experimentally infected cows receiving no such treatment. fourteen cows were experimentally infected with l. hardjobovis, and blood and urine samples were collected weekly for 24 weeks. the microscopic agglutination test (mat) and enzyme-linked immunosorbent assay (elisa) were used t ...19938128596
[return to estrus following first insemination in sow herds (incidence and association with reproductivity and various blood parameters)].as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics to get an impression of the economic importance. these objectives wer ...19937505958
comparison of genetic maps for two leptospira interrogans serovars provides evidence for two chromosomes and intraspecies heterogeneity.genetic maps were constructed for leptospira interrogans serovars icterohaemorrhagiae and pomona. previously we independently constructed physical maps of the genomes for these two serovars. the genomes of both serovars consist of a large replicon (4.4 to 4.6 mb) and a small replicon (350 kb). genes were localized on the physical maps by using southern blot analysis with specific probes. among the probes used were genes encoding a variety of essential enzymes and genes usually found near bacteri ...19937690025
characterization of leptospiraceae by 16s dna restriction fragment length polymorphisms.chromosomal dna from 37 leptospiracae representing genetic species, groups and reference strains together with five leptospire isolates and escherichia coli were digested with the restriction endonucleases bamhi, clai and ecori. the southern blots were hybridized with a biotinylated e. coli 1.5 kb 16s rdna probe and gave 36 reproducible and unique patterns. with the exception of the type strain (leptospira interrogans serovar icterohaemorrhagiae rga) and neotype strain (serovar icterohaemorrhagi ...19937691982
[pcr amplification of the leptospiral dnas from different genus and species with the variable sequences of 16s rrna gene].we designed a pair of primers from the variable regions (v2 and v4) of 16s rrna gene of leptospira interrogans, i. e. pi: 5'ggg aac cta ata ctg gat gg; pii: 5' aca tag ttt caa gtg gag gc, and amplified the leptospiral dnas from different genus and species. when denaturing with 55 degrees c, all dnas of l. interrogans had the same products not only in length but also with kpn i-digested pattern. the dna of l. biflexa could be amplified with a c. a. 280 bp-band but not digested by kpn i, while the ...19938150433
[restriction endonuclease analysis of pomona serogroup of leptospira interrogans].restriction endonuclease analysis (rea) was performed on dnas from the type strains of the pomona serogroup of leptospira interrogans by using ecori and hhai restriction enzyme, and the electrophoretic patterns obtained were compared with patterns obtained from 27 isolates from pig kidneys collected at abattoirs in victoria, which belong to pomona serogroup previous identified by mat. all of the isolates were identified as serovar pomona.19938178514
leptospirosis in equine fetuses, stillborn foals, and placentas.leptospirosis was diagnosed in 51 equine fetuses and 16 stillborn foals with gestational ages from 3 1/2 to 11 months. diagnosis was based on one or more of the following: positive fetal antibody titer, positive fluorescent antibody test, demonstration of spirochetes in kidney and/or placental sections stained by the warthin-starry technique, high leptospiral titers in aborting mares, or isolation of leptospira spp. from fetal organs. gross lesions were observed in 80.3% of the fetuses, stillbor ...19938212458
[the use of nonpathogenic leptospira as diagnostic antigens for the diagnosis of leptospira infections in cattle].the seroprevalence of leptospira antibodies was determined in 4377 bovine sera by microagglutination assay using 11 leptospira interrogans serovars. in 10% (439 samples) of the sera, a positive reaction was detected. these included 275 sera (62.6%) with reaction to l. grippotyphosa, 159 (36.2%) to l. saxkoebing and 5 (1.1%) sera with reactions to other serovars. multiple reactions were found in 9.8% of the 439 positive sera, whereby the sejroe group dominated (65%) within the possible combinatio ...19938216195
association between cessation of leptospiruria in cattle and urinary antibody levels.the shedding of leptospira interrogans serovar hardjo in the urine of cattle and the local and systemic response to these organisms was monitored in experimentally and naturally infected animals. twenty yearling heifers, 10 infected by the instillation of leptospires into the conjunctival sac (supraconjunctival route) and 10 infected intrauterinely, shed leptospires for up to 60 weeks after infection. five of 15 naturally infected pregnant heifers with microscopic agglutination test titres > or ...19938235087
cross-reactivity between b. burgdorferi and other spirochetes affects specificity of serotests for detection of antibodies to the lyme disease agent in dogs.western immunoblots, the kinetics-based enzyme-linked immunosorbent assay (kela), and the microagglutination test were used to evaluate cross-reactivity among antibodies to serovars of leptospira interrogans (leptospiral serovars), and b. burgdorferi from naturally infected dogs, and to serpulina (treponema) hyodysenteriae from vaccinated rabbits. whole-cell lysates from borrelia spp., leptospiral serovars, and serpulina spp. were used for sds-page, western blots, and kela. crossreactivity occur ...19938236777
[antigen analysis of mcab e4b7d5 directed against outer envelope of leptospira interrogans serovar lai by sds-page and immunoblot].mcab e4b7d5 was prepared by hybridoma technology in balb/c mice immunized to outer envelope of leptospira interrogans serovar lai. this mcab agglutinated specifically with all the 13 serovars of icterohaemorrhagiae serogroup in mat test at high titres and protected the guinea pigs against the attack of virulent strain (017) of serovar lai. sds-page and immunoblot were used to analyse the reaction of the outer envelopes of the five strains of leptospira (leptospira interrogans icterohaemorrhagiae ...19938244286
isolation of leptospira interrogans serovars hardjo and zanoni from a dairy herd in north queensland. 19938257323
serologic survey for leptospirae in european brown bears (ursus arctos) in croatia.from 1981 to 1991, sera of 42 european brown bears (ursus arctos) from three areas in croatia were tested for antibodies against 12 leptospira interrogans serovars: grippotyphosa, sejroe, australis, pomona, canicola, icterohaemorrhagiae, tarassovi, saxkoebing, ballum, bataviae, poi, and hardjo. diagnostic levels of antibody were found in 17 (40%) of 42 sera. evidence of exposure to at least one of the serovars was found in seven of 14 free-ranging bears from the lika region, four of 12 free-rang ...19938258865
identification of leptospira interrogans strains by monoclonal antibodies and genomic analysis.a recombinant probe derived from a genomic library of serovar hardjo strain hardjoprajitno, and a panel of serovar specific monoclonal antibodies (mabs) were used for the characterization of 31 leptospira isolates from cattle and swine. the two methods performed equally well in serovar identification except for the distinction of the genotypes hardjoprajitno and hardjobovis within serovar hardjo which could only be obtained by genomic analysis. the combination of immunological and genetic inform ...19938264422
[amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr].based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ...19938288193
isolation of leptospira interrogans serovar grippotyphosa from the skin of a dog.leptospira interrogans serovar grippotyphosa was isolated from the skin of a 14-year-old male dog with deteriorating health. necropsy revealed numerous lesions characteristic of aged dogs, but no evidence of acute hepatitis or nephritis, which are common features of pathogenic leptospira infections. antibody to leptospira was not detected in the dog's serum by microagglutination. leptospires grew slowly in barbour-stoenner-kelly medium, a medium commonly used to isolate borrelia, but then grew a ...19938288477
cloning and analysis of the leub gene of leptospira interrogans serovar pomona.the leub gene of leptospira interrogans serovar pomona strain kenniwicki has been cloned on a 9.5 kb plasmid, pwvl1, by complementation of escherichia coli leub mutants. subcloning and tn5 mutagenesis showed that the region required for complementation was approximately 1.2 kb in length. enzyme assays showed that the product of the cloned gene was a beta-isopropylmalate dehydrogenase. defects in the leua, leuc and leud genes of e. coli were not complemented by pwvl1. the nucleotide sequence of t ...19938336106
antimicrobial effects of a new carboxyquinolone drug, q-35, on five serogroups of leptospira interrogans.new carboxyquinolone drugs, including the recently developed q-35, were evaluated for their in vitro potency against five serogroups of leptospira interrogans. q-35, ofloxacin, ciprofloxacin, and tosufloxacin showed mics (0.05 to 0.20 microgram/ml) comparable to those of tetracycline. however, mbcs of these drugs varied between 10- and 100-fold above the mic for most strains tested. q-35 was shown to be active against l. interrogans in vitro as judged by the mics obtained.19938388204
[a severe course of leptospirosis with acute kidney failure and extensive icterus (weil disease)].a 77-year-old man developed a fever up to 38.4 degrees c, with diarrhoea, acute renal failure (creatinine up to 8.7 mg/dl; urea up to 308 mg/dl) and marked jaundice (total bilirubin up to 24.3 mg/dl). in addition there was thrombocytopenia, conjunctivitis and epistaxis, as well as cerebral symptoms with somnolence and general slowing up. at first he was thought to have cholangitis resulting from previously diagnosed gall-stones, and he was therefore treated with ampicillin, 2 g two times daily, ...19938404498
outbreak of leptospirosis associated with swimming.between july 7 and 18, 1991, five boys from a small town in rural illinois experienced the onset of an acute febrile illness subsequently confirmed as leptospirosis by serologic tests. a cohort study found that swimming in a small swimming hole, steel tunnel pond, was associated with disease (p < 0.01), the attack rate being 28%. leptospira interrogans serovar grippotyphosa was isolated from urine cultures from two of the case patients and from a culture of steel tunnel pond water. a high seropr ...19938417426
opsonization of treponema pallidum is mediated by immunoglobulin g antibodies induced only by pathogenic treponemes.rabbit antisera to leptospira interrogans, borrelia hermsii, and treponema phagedenis biotype reiter, reactive to shared spirochetal antigens, failed to enhance phagocytosis of treponema pallidum by macrophages, while immunoglobulin g to treponema pallidum subsp. pertenue and treponema paraluiscuniculi promoted phagocytosis. opsonic antibodies are directed to pathogen-restricted, not shared spirochetal, antigens.19938423106
identification of species-specific, non-cross-reactive proteins of borrelia burgdorferi.the low specificity of diagnostic tests for lyme disease is due to the fact that borrelia burgdorferi possesses many antigenic proteins that are cross-reactive with other spirochetes and bacteria. the low sensitivity is a result of high (> or = 1:100) dilutions used for patient sera during testing to eliminate non-specific cross-reactivity. the present study was conducted to identify species-specific non-cross-reactive protein(s) of b. burgdorferi that might be used as antigen(s) in serologic te ...19938425377
a new leptospiral serovar in the icterohaemorrhagiae serogroup isolated from an ox in zimbabwe.a strain of leptospira interrogans that was isolated from an ox slaughtered in zimbabwe and belonged to serogroup icterohaemorrhagiae could not be identified when we compared it with 18 reference strains belonging to this serogroup by using cross-agglutinin absorption, monoclonal antibody, and restriction endonuclease dna analyses. the name zimbabwe is proposed for the new serovar containing this strain; the type strain of this serovar is strain sbf 23.19938427806
prevalence of leptospiral agglutinins among conservancy workers in madras city, india.in a study of 584 corporation conservancy (sanitation) workers who lived mostly in slums, and who worked in four corporation circles of madras city, india, 192 (32.9%) were found to be positive for agglutinins to leptospira interrogans. seropositivity prevalence increased with age, but was similar in males and females except in the youngest age group, where males predominated. prevalence in the four study areas ranged between 17.8 and 40.5% (p < 0.01). among 152 sera in which one serogroup predo ...19938429573
decision support models of leptospirosis in dairy herds.following the results of a survey which found that 61 per cent of dairy farmers felt that they needed more information about leptospirosis, and the strategies for its control and the costs and benefits involved, this paper describes the construction and preliminary results of two models of the disease intended to help explore the risks and financial implications of leptospira interrogans serovar hardjo infection for dairy producers.19938430482
bacterial agents detected in a 10-year study of bovine abortions and stillbirths.in a 10-year survey started in 1980, specimens from 8,995 bovine abortions and stillbirths were submitted to the south dakota animal disease research and diagnostic laboratory. of these, 8,962 were suitable for some type of examination. bacteria were determined to be the cause of 1,299 (14.49%). the 5 bacteria most commonly associated with bovine abortion or stillbirth were actinomyces pyogenes, 378 (4.22%); bacillus spp., 321 (3.58%); listeria spp., 121 (1.35%); escherichia coli, 98 (1.09%); an ...19938466983
restriction-endonuclease analysis of australian isolates of leptospira interrogans serovar hardjo from cattle with agalactia and abortion.polyacrylamide gel electrophoresis and agarose gel electrophoresis were used to resolve restriction endonuclease digests of 20 australian isolates of leptospira interrogans cultured from urine samples of cattle with agalactia and abortion. the restriction endonuclease profiles of 19 isolates closely matched the profiles of l interrogans serovar hardjo subtype hardjobovis reference strains. the remaining isolate had a different restriction profile from subtype hardjobovis and subtype hardjoprajit ...19938476365
chemotaxis of leptospires to hemoglobin in relation to virulence.a guinea pig-lethal line of leptospira interrogans serovar copenhageni strain shibaura, but not an avirulent line of the same strain, moved in larger numbers toward hemoglobin than toward distilled water (control) in a u-shaped polypropylene tube. l. interrogans serovar lai strains 017 and kh-1, which were also guinea pig lethal, showed a similar move to hemoglobin. no such move toward hemoglobin was shown by 14 avirulent strains of l. interrogans (with one exception) or any of the 8 strains of ...19938478123
leptospiral abortion and leptospiruria in horses from the same farm.leptospirosis was documented as the cause of abortion in a 5-year-old mare. leptospires were detected in tissue specimens from fetal kidneys and from placenta by histologic evaluation of silver-stained sections. antibodies against leptospira interrogans serovar pomona were detected in fetal serum at a titer of 1,600 by use of a microscopic agglutination test. the mare had serum titers of 6,400; 0; 400; 800; 3,200; and 6,400 to l interrogans serovars bratislava, canicola, grippotyphosa, hardjo, i ...19938496088
serological survey for canine leptospirosis in the pretoria area.canine serum samples (n = 400) from the pretoria area were tested for leptospira antibodies, using the microscopic agglutination test. the prevalence of antibodies (inconclusive and positive titres) was 1.5%. reactions were only against leptospira interrogans serovars tarassovi and pyrogens. leptospirosis does not appear to be an important canine disease in the pretoria area.19938496894
association between clinical lameness and borrelia burgdorferi antibody in dairy cows.results of an elisa, indirect fluorescent antibody (ifa) test, and immunoblot analysis (western blotting) for antibody to borrelia burgdorferi in a sample of 216 lactating dairy cows were compared. the microscopic microtitration agglutination test for antibody to 6 serovars of leptospira interrogans was also performed to evaluate possible cross-reactivity between b burgdorferi and l interrogans. using western blotting as the standard test against which the elisa and ifa test were compared, the e ...19938498742
antimicrobial activity of two bactenecins against spirochetes.bac5 and bac7 are antimicrobial peptides of bovine neutrophils that act on enteric gram-negative bacteria. we report here that these two peptides immobilize and kill leptospira interrogans and leptospira biflexa with mbcs of 6 to 25 micrograms/ml. conversely, although both peptides bind to borrelia burgdorferi, the organism is resistant to their action.19938514417
comparative pathogenicity study of leptospira interrogans serovar pomona strains.the comparative pathogenicity study of two leptospira interrogans serovar pomona strains isolated from pig herds of different epizootiological status is reported. using monoclonal antibodies (mabs), the isolates were identified as leptospira interrogans serovar pomona. the results obtained for the reference strain of l. pomona were identical with those of the two isolates, with the exception of monoclonal serum designated 61-7, which gave a 1:30 titre with the reference strain. in a pig herd com ...19938017234
[the detection and analysis of leptospiral dna in patients' serum of early leptospirosis by polymerase chain reaction and dna hybridization with digoxigenin-amppd].we have detected and analysed the leptospiral dna in serum of patients with early leptospirosis from the epidemic area of china by pcr and dna hybridization with digoxigenin (dig)-3-(2'-spiroadamantane)-4-methoxy-4-(3"-phosphoryloxy)- phenyl-1,2-dioxetane (amppd) to develop a sensitive, specific and reliable technique for the early diagnosis of leptospirosis, and full satisfactory results have obtained. fourteen serum specimens from patients with leptospirosis proven by blood culture and serolog ...19921298711
[detection of leptospiral dna in the serum of 175 patients with early leptospirosis by polymerase chain reaction].we have developed a sensitive assay for leptospira, using the polymerase chain reaction (pcr). on the basis of the published nucleotides sequence of 23s rrna gene from leptospira interrogans serovar canicola strain moulton, primers were chosen to produce an amplified fragment of 123 bp. primer a: 5'gat cta att cgc tgt agc agg3' and primer b: 5'act ttc acc ctc tat ggt cgg3' eight different svs. of leptospira interrogans could all be detected by pcr, but the dnas from l. biflexa. leptonema bacteri ...19921298712
[the immunochemical and biological properties of leptospira membranes].the immunochemical and biological properties of purified membrane fractions obtained from leptospira interrogans, serovar copenhageni, strain rat 2, and leptospira biflexa, strain patoc 1, were studied. the presence of genus-specific and group-specific antigens in leptospiral membranes was established by the methods of immunodiffusion analysis, the microagglutination (ma) and lysis tests. in animal experiments cell membrane preparations produced no toxic and allergic effects. leptospiral membran ...19921301663
[marking and detection of dna of leptospires in the dot-blot and situ hybridization with digoxigenin-labelled probes].dna of leptospira interrogans sv. lai strain 017 was labelled with digoxigenin or alpha 32p or biotin and used as probes to detect dna of leptospires. probes labelled with digoxigenin were able to detect 0.1-1 pg of homologous dna and 10(2) of l. interrogans sv. lai strain 017. probes alpha 32p and biotin detected 1 pg and 10 pg of homologous dna and 10(3), 5 x 10(3) of l. interrogans sv. lai strain 017 respectively. these three probes couldn't detect l. biflexa sv. patoc strain patoc i, l. illi ...19921304535
assay for measuring relative potency of leptospiral bacterins containing serovar pomona.an enzyme-linked immunosorbent assay (elisa) was developed for the quantitation of leptospiral antigen in bacterins containing leptospira interrogans serovar pomona type kennewicki. a monoclonal antibody (mab), 2d7, which is directed against a surface antigen on whole cells of l. interrogans serovar pomona type kennewicki, was used in the assay. the capture of antigen in bacterins by a polyclonal antiserum was followed by the addition of the 2d7 ascites fluid, an anti-mouse conjugate and substra ...19921305402
muskrats as carriers of pathogenic leptospires in the netherlands.leptospires were isolated from 24 of 327 (7%) muskrats (ondatra zibethicus) caught in the netherlands. all isolates were identified as leptospira interrogans. one isolate was typed as serovar copenhageni in the icterohaemorrhagiae serogroup, one as serovar lora in the australis serogroup. twenty-one isolates showed a close relationship with serovars grippotyphosa, valbuzzi, muelleri and ratnapura from the grippotyphosa serogroup. one isolate was lost. sera from 196 muskrats were examined by the ...19921315497
[the serovars of leptospira interrogans isolated from cases of human leptospirosis in são paulo, brazil].eighteen strains of l. interrogans isolated from human cases were serotyped by the agglutinin-absorption test at instituto adolfo lutz in são paulo, brazil. fourteen were identified as serovar copenhageni (icterohaemorrhagiae serogroup), 2 as canicola (canicola serogroup), 1 as castellonis (ballum serogroup) and 1 as pomona serogroup (serovar not yet defined). the frequency of serovar copenhageni in 100% of the isolates in icterohaemorrhagiae serogroup is emphasized and more studies to verify th ...19921342073
chemical and biological properties of endotoxin from leptospira interrogans serovars canicola and icterohaemorrhagiae.1. endotoxin-like activity was extracted with phenol-chloroform-petroleum either (pcp) from leptospira interrogans serovars icterohaemorrhagiae and canicola. chemical analysis of leptospiral cells obtained from the pcp extract indicated the following distribution of lipopolysaccharide (lps), protein and polysaccharide in mg/ml: 3.0, 4.5 and 1.0 for icterohaemorrhagiae and 3.3, 5.6 and 1.5 for canicola. 2. the preparations presented several biological activities: positive limulus test (1.0 pg/ml) ...19921342222
[the identification of leptospira strains of different origins].leptospirosis is at present an ever-increasing problem in human and animal health. by means of the korthof medium, 43 leptospira strains were isolated from samples of human blood, water and soil. for their identification the microagglutination technique was used. the strains corresponded to the species leptospira biflexa and leptospira interrogans.19921344685
cloning of dapd, arod and asd of leptospira interrogans serovar icterohaemorrhagiae, and nucleotide sequence of the asd gene.metabolites such as diaminopimelate and some aromatic derivatives, not synthesized in mammalian cells, are essential for growth of bacteria. as a first step towards the design of a new human live vaccine that uses attenuated strains of leptospira interrogans, the asd, arod and dapd genes, encoding aspartate beta-semialdehyde dehydrogenase, 3-dehydroquinase and tetrahydrodipicolinate n-succinyltransferase, respectively, were cloned by complementation of escherichia coli mutants. the complete nucl ...19921348268
genome structure of spirochetes.the genome structures of several pathogenic spirochetes have recently been determined. the genomes of borrelia species consist of a linear chromosome of approximately one million base pairs (mb) and various linear and circular plasmids. analysis of restriction fragment length polymorphisms and 16s ribosomal rna sequence data indicate the division of borrelia burgdorferi into at least three distinct genetic groups. leptospira interrogans has a circular chromosome 5 mb in size and a 0.35 mb extrac ...19921362002
detection of leptospiraceae by amplification of 16s ribosomal dna.the polymerase chain reaction (pcr) was developed to detect leptospiraceae. primers were used to amplify 1 631 base-pair (bp) 5'-region of 16s rdna. representative strains from the species, leptospira interrogans sensu stricto, l. borgpetersenii, l. noguchii, l. santarosai, l. weilii, l. inadai, l. meyeri and the single member strain of leptonema were amplified. in contrast, strains representing the saprophytic species. l. biflexa, l. wolbachii and l. parva were not amplified. there was no pcr p ...19921372872
specific immunofluorescent staining of pathogenic treponemes with a monoclonal antibody.two hybrid cell lines which produced mouse monoclonal antibody to the dal-1 street strain of treponema pallidum subsp. pallidum were established. these monoclonal antibodies strongly reacted with t. pallidum subsp. pallidum (nichols strain, dal-1, and two other street strains, strains mn-1 and mn-3) and t. pallidum subsp. pertenue by indirect microimmunofluorescent antibody and enzyme-linked immunosorbent assay techniques, but they did not react with normal rabbit testicular tissue. these monocl ...19921374079
comparison of flanking regions of the 5s ribosomal ribonucleic acid genes in leptospira biflexa and leptospira interrogans.one of the genes encoding the 5s ribosomal ribonucleic acid (rrna) for the leptospira biflexa strain patoc i was isolated and sequenced. the physical maps of the 5s rrna genes in leptospira were constructed. the strains of leptospira biflexa had two genes on their chromosome; these two 5s rrna genes were located several kb apart and sequences flanking these genes were divergent. in contrast to saprophytic leptospires, maps in parasitic leptospires that had only one gene for 5s rrna on their geno ...19921376643
[homology study of leptospires by molecular hybridization].nick translation and random primer labelling method were applied to prepare three genomic dna probes from leptospira interrogans strain 017, leptospira biflexa strain patoc i and leptonema illini strain 3055, and then hybridized with dna of 17 strains leptospires from different genus, species, serogroup and serovar. the results showed no homology between leptospira and leptonema, and only a low degree of homology between l. interrogans and l. biflexa but it showed a high degree of homology among ...19921398616
polymerase chain reaction for detection of leptospira spp. in clinical samples.a sensitive assay for leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (pcr). a 331-bp sequence from the leptospira interrogans serovar canicola rrs (16s) gene was amplified, and the pcr products were analyzed by dna-dna hybridization by using a 289-bp fragment internal to the amplified dna. specific pcr products also were obtained with dna from the closely related nonpathogenic leptospira biflexa but not with dna from other spiro ...19921400983
renal dysfunction associated with infection of leptospira interrogans in a horse.renal failure associated with infection of leptospira interrogans was detected in a horse. fever, leukocytosis, pyuria, isosthenuria, and azotemia were suggestive of an inflammatory urinary tract disease. despite persistent pyuria, no bacteria were found during routine microscopic examinations or bacteriologic culturing of urine. a fluorescent antibody examination of the urine was positive for l interrogans. serologic testing during a 6-month period, supported an acute infection with l interroga ...19921429185
experimental infection of pregnant gilts with leptospira interrogans serovar mozdok.three pregnant gilts were experimentally infected with leptospires of the serovar mozdok, isolated from an aborted pig fetus from a portuguese pig farm with abortion problems. all the gilts aborted dead or dying piglets on days 105 or 106 of pregnancy. serovar mozdok was isolated from 12 of the 22 piglets in the three litters. histological examination of the livers and kidneys of the gilts at the end of the experiment revealed evidence of disease, and leptospires were isolated from their kidneys ...19921441176
c3 fixed in vivo to cornea from horses inoculated with leptospira interrogans.c3 was detected bound in vivo to the opaque cornea of horses inoculated with killed leptospira interrogans. employing epithelial corneal cells isolated from a monolayer in tissue culture, we proved that c3 is fixed in vitro to the intact cell surface after incubation with a fresh equine anti-leptospira serum. these findings, in addition to the infiltration of cornea with neutrophils and lymphocytes, may explain the mechanisms of tissue damage in recurrent uveitis of horses with leptospirosis.19921441226
scattering of the rrna genes on the physical map of the circular chromosome of leptospira interrogans serovar icterohaemorrhagiae.leptospira interrogans is a pathogenic bacterium with a low g+c content (34 to 39%). the restriction enzymes noti, asci, and srfi cut the chromosome of l. interrogans serovar icterohaemorrhagiae into 13, 3, and 5 fragments separable by one- and two-dimensional pulsed-field gel electrophoresis (pfge). the genome is composed of a circular 4.6-mbp chromosome and a 0.35-mbp extrachromosomal element. a physical map of the chromosome was constructed for noti, asci, and srfi by using single and double ...19921447129
[investigation of microbicidal activity of neutrophil defensins against leptospires].defensins play an important role in oxygen-independent microbicidal mechanisms of neutrophils. they are effective against many bacteria, fungi and enveloped viruses. however, the effect of defensins upon leptospires has not been studied. in the present report, human defensins (i.e. hnp, a mixture of hnp1, hnp2 and hnp3 were prepared from human polymorphonuclear neutrophils by chromatography on sephadex g-100 and then on biogel p-10. rabbit defensin np1 was purified from rabbit peritoneal granulo ...19921452139
duration of urinary excretion of leptospires by cattle naturally or experimentally infected with leptospira interrogans serovar hardjo.the excretion of leptospira interrogans serovar hardjo in the urine of cattle was studied in naturally and experimentally infected animals. five of 15 naturally infected animals with microscopic agglutination test titres of > or = 1:300 shed leptospires for between 28 and 40 weeks. twenty yearling heifers, experimentally infected by either the supraconjunctival or intrauterine routes, shed leptospires for from eight to 60 weeks; the 10 infected via the uterus shed l interrogans serovar hardjo fo ...19921455593
immunoblotting study of the antigenic relationships among eight serogroups of leptospira.seven strains of leptospira interrogans belonging to seven different serogroups, and one strain of leptospira biflexa were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) with gradient gels and immunoblotting with hyperimmune rabbit sera raised against each strain. the molecular masses of the proteins were calculated with a polynomial regression model. the sds-page patterns of the l. interrogans strains were similar and characterized by 24 common bands. this prof ...19921455625
diseases, parasites and survival of coyotes in south-central georgia.serologic testing, radio-telemetry and post-mortem diagnostic evaluations were used to investigate survival and causes of mortality among 17 coyotes (canis latrans) in south-central georgia (usa). prevalence of canine heartworm (dirofilaria immitis) microfilariae was lower (p = 0.057) among fall-captured (22%) than among winter-captured (75%) coyotes. prevalence of heartworm was higher among adults than juveniles in the fall, but no significant difference was detected between animals captured in ...19921474655
the chemiluminescent detection of leptospiral antigen.the aim of this study was to investigate the feasibility of using enhanced chemiluminescence for the rapid detection of leptospiral antigen (l. interrogans serovar hardjo) in biological fluids, and to assess the suitability of such an assay for the early diagnosis of human leptospiral infections. the limit of detection for homologous antigen in phosphate buffered saline was 9 x 10(4) leptospires/ml. in human blood the sensitivity remained unchanged throughout the sampling time, (1.8 x 10(5) lept ...19921486231
antigens involved in the human antibody response to natural infections with leptospira interrogans serovar copenhageni.serum samples from patients with leptospirosis were screened by the microscopic agglutination test (mat), elisa and by immunoblotting. the latter two tests were performed with l. interrogans serovar copenhageni isolated from human blood culture. immunoblotting with patients' sera revealed antibodies recognizing several leptospiral components in the molecular weight range 14.5-105 kda of both igm and igg response. all patients' serum samples presented igm antibodies reacting with a diffuse band o ...19921495119
comparative analysis of lipopolysaccharide and lipid antigens of leptospira interrogans serovars.lipopolysaccharide (lps) or glycolipid antigens of leptospira interrogans have been candidates as serogroup or serotype specific antigen. in this study, therefore, we prepared the lps and lipid antigens from l. interrogans serovars lai, icterohaemorrhagiae, copenhageni, canicola, pomona, grippotyphosa, and a korean isolate 30r. the lps antigens were analyzed by a polyacrylamide gel electrophoresis and lipid antigens by thin-layer chromatography, respectively. the seroreactivity of the antigens w ...19921502827
[infection with leptospira interrogans, serovar mozdok, in cattle].in east germany the same serovar, leptospira mozdok, of the pomona serogroup is found in cattle as well as in swine populations (zieris 1989). nowadays cases of bovine leptospirosis caused by infection with l. pomona have no significance. there are marked epizoological differences between infection with l. mozdok and l. pomona. the main source of infection with l. mozdok for cattle is the black striped field mouse (apodemus agrarius). secondary homonomous transmission occurs among the cattle. th ...19921509476
prevalence of antibody titers to leptospira spp. in minnesota white-tailed deer.serum samples (n = 204) from 124 white-tailed deer (odocoileus virginianus) in northeastern minnesota (usa) were collected from 1984 through 1989 and tested for antibodies to six serovars of leptospira interrogans (bratislava, canicola, grippotyphosa, hardjo, icterohemorrhagiae, and pomona) using a microtiter agglutination test. eighty-eight (43%) sera were positive at greater than or equal to 1:100 for antibodies against serovars pomona and/or bratislava; none was positive for any of the other ...19921512878
immunodominant antigens recognized by the human immune response to infection by organisms of the species leptospira interrogans serogroup australis.serum samples from patients infected by organisms of leptospira interrogans serogroup australis were tested by western blot to determine the nature of major antigens that are involved in the immune response. although there was some patient-to-patient variability, immunodominant genus-specific antigens were found to be proteins of apparent molecular ratio 68, 46 and 35-kda, and lipopolysaccharide (lps) sub-units in the 35-14-kda region. serogroup epitopes specific for australis were exclusively s ...19921515158
prevalence and serovars of leptospira involved in equine abortions in central kentucky during the 1990 foaling season.a study to determine the prevalence of leptospira-induced abortions in the central kentucky equine population during the 1990 foaling season and to determine the leptospira serovars responsible was conducted. from july 1, 1989 through june 30, 1990, 32 (4.4%) of 726 submissions (fetuses, stillborn foals, and/or placentas) were diagnosed as leptospirosis by the fluorescent antibody test and/or microscopic agglutination test. attempts were made to isolate leptospires from the fetal tissues and/or ...19921515489
the isolation and identification of leptospira interrogans serovar bratislava from a pig in germany.during a study on the improvement of selective media for the isolation of leptospires from clinical material, leptospires were isolated from the kidneys of a pig. test material was cultured in emjh-medium containing 0.4% rabbit serum and 3 inhibitory substances (rifampicin 10 micrograms/ml, amphotericin b 2 micrograms/ml, 5-fluorouracil 100 micrograms/ml). the cultured leptospira-strain (berlin 406) was identified to serogroup level using the cross agglutination method and it was further typed t ...19921519413
canine leptospirosis. a retrospective study of 17 cases.seventeen dogs were diagnosed with leptospirosis on the basis of clinical findings, laboratory abnormalities, and serology. this article summarizes and characterizes the historical and physical findings, laboratory data, serology, treatment, and outcome of these dogs. all of the dogs had serologic evidence of infection with interrogans serovars pomona and grippotyphosa. these findings are compared with previous reports of canine infection with leptospira interrogans serovars icteroaemorrhagiae a ...19921522555
leptospirosis in the seychelles.to ascertain the incidence of leptospirosis in the seychelles, identify its sources, review diagnostic features and assess complications.19921545718
analysis of leptospira spp., leptonema illini, and rickettsia rickettsii for the 39-kilodalton antigen (p39) of borrelia burgdorferi.five serovars of leptospira interrogans, leptospira biflexa, leptonema illini, and rickettsia rickettsii were examined and found not to contain the 39-kda antigen (p39) of borrelia burgdorferi, the lyme disease spirochete. the specificity of this antigen and its reactivity with human lyme disease sera should exclude the possibility of false-positive serum samples from patients having had either leptospirosis or rocky mountain spotted fever, as well as tick-borne relapsing fever and syphilis, as ...19921551994
isolation of leptospira interrogans serovars bratislava and hardjo from swine at slaughter. 19921554777
identification of the tick-borne relapsing fever spirochete borrelia hermsii by using a species-specific monoclonal antibody.borrelia hermsii causes a relapsing fever in humans and is one of several species of tick-borne spirochetes known to occur in the western united states. spirochetes observed in the peripheral blood of patients acutely ill have been presumptively identified in the past by the geographic location of exposure and the probable species of tick vector. we describe a monoclonal antibody (h9826) that bound to the flagellar protein of b. hermsii but not to those of any of the other species tested, which ...19921572965
repetitive sequences cloned from leptospira interrogans serovar hardjo genotype hardjoprajitno and their application to serovar identification.we selected, from a genomic library of leptospira interrogans serovar hardjo genotype hardjoprajitno, two probes containing repetitive sequences (pl1 and pl590). the hybridization patterns of these probes to dna isolated from a variety of leptospira serovars were examined and their ability to detect subtle differences at the genomic organization level was established. we identified the dna fragments within pl1 and pl590 which are sufficient to yield polymorphic hybridization patterns; these resu ...19921583126
cross-reactive proteins of borrelia burgdorferi.the specificity of serological tests for lyme borreliosis is impaired by cross-reacting antibodies. in order to select antigens for more specific tests, specific and cross-reactive proteins of borrelia burgdorferi must be identified. therefore, to analyze cross reactions of borrelia burgdorferi with other bacteria, rabbit immune sera against heterologous bacteria (borrelia hermsii, treponema pallidum, treponema phagedenis, leptospira interrogans (serogroup grippotyphosa), neisseria meningitidis, ...19921597198
occurrence of severe leptospirosis in a breeding colony of squirrel monkeys.although experimental leptospirosis has been studied in various species of monkeys, the occurrence of acute leptospirosis in a population of nonhuman primates is uncommon. we report on a number of severe cases of icterohemorrhagic leptospirosis that appeared in the squirrel monkey (saimiri sciureus) colony of 109 animals at the institute pasteur in french guiana. initially, 11 animals had acute illness, with jaundice and a hemorrhagic syndrome, leading to 10 deaths. two leptospira interrogans st ...19921599047
isolation and biological activities of endotoxin from leptospira interrogans.endotoxins extracted with ethylenediaminetetraacetate (edta) from leptospira interrogans serovars icterohaemorrhagiae and canicola and leptospira biflexa serovar patoc were tested for various biological activities characteristic of endotoxins. the presence of lipopolysaccharide biological activity was demonstrated by the limulus amoebocyte lysate test, pyrogenicity in rabbits, complement interaction inhibiting the erythrocyte lysis, and chicken-embryo lethality. the lipopolysaccharides did not i ...19921611553
serodiagnosis of leptospirosis in pigs using an axial filament enzyme-linked immunosorbent assay.the axial filament (af) from leptospira interrogans serovar canicola was isolated by cesium chloride density gradient centrifugation of 2% sarcosyl treated whole cells. isolation of af was confirmed by electron microscopic examination, by protein-a immunogold labelling, sodium dodecyl sulphate polyacrylamide gel electrophoresis (sds-page), and immunoblotting. analysis by sds-page of the purified preparation showed relatively weak bands of molecular size 41 kda and 21 kda, and strong bands of 35 ...19921615635
isolation of leptospira interrogans from kidneys of zimbabwe beef cattle.four hundred and eighty bovine kidneys were collected from an abattoir near harare between december 1987 and november 1988, and leptospires were recovered from 50 (10.4 per cent) of them. the isolates were identified to serogroup level by the microscopic agglutination test; 32 belonged to serogroup sejroe, seven were pyogenes, four hebdomadis, two tarassovi, and one isolate each belonged to serogroups australis, bataviae, grippotyphosa, icterohaemorrhagiae and pomona.19921621343
characterization of the periplasmic flagellum proteins of leptospira interrogans.the structure and composition of periplasmic flagella (pf) from leptospira interrogans serovar pomona type kennewicki were characterized. electron microscopic observations showed that leptospiral pf were complex structures composed of an 11.3-nm-diameter core surrounded by two sheath layers with 21.5- and 42-nm diameters. two-dimensional gel electrophoresis of isolated pf showed the presence of seven different proteins ranging in mass from 31.5 to 36 kda. rabbit polyclonal and mouse monoclonal a ...19921624463
leptospira serology in small ruminants on st. croix, u.s. virgin islands.a serological survey of 16 serovars of leptospira interrogans, previously reported in tropical small ruminants, was undertaken to determine the serovars involved and the prevalence of these antibodies in sheep and goats on st. croix, u. s. virgin islands (usvi). seven of eight goat herds (108 animals) had at least two seropositive animals in each herd with an individual animal seroprevalence of 26%. the 53 sheep tested (one flock only) showed a 32% seroprevalence. antibodies against seven serova ...19921626866
serological evidence for the presence of leptospira interrogans serovar bratislava in australian pigs. 19921627090
biochemical analysis by sds-page and western blotting of the antigenic relationship between leptospira and equine ocular tissues.the antigenic relationship between leptospira interrogans, equine cornea and lens was previously noted in our studies. serum antibodies from horses inoculated with serovars wolffi, pomona, icterohaemorrhagiae, and tarassovi, were able to bind to five antigenic fractions from both cornea and lens, as demonstrated by immunoblotting. these antigens seem to be made up of protein and carbohydrates. after treatment with periodate for cleavage of glycoside ring structures, those fractions kept their co ...19921632080
genetic diversity among australian and new zealand isolates of leptospira interrogans serovar pomona.restriction endonuclease analysis of 16 australian and 4 new zealand isolates of leptospira interrogans serovar pomona showed that they could be divided into 3 genetic groups. most of the isolates closely resembled the serovar kennewicki reference strain, and they all differed from the reference strain of serovar pomona. based on these findings, it is suggested that vaccine manufacturers re-evaluate their choice of serovar pomona vaccine strain.19921632725
antibodies in dogs against leptospira interrogans serovars copenhageni, ballum and canicola.in a nationwide survey carried out during 1990-91 of more than 5800 dogs to detect antibodies against leptospira interrogans serovars copenhageni, ballum and canicola, only one weak reactor against serovar canicola was found. reactors of varying titre were found against serovar ballum in 0.7% of dogs tested, indicating sporadic infection with this serovar. reactors (0.9%) to serovar copenhageni came mainly from the waikato, northland and the auckland region. this was in agreement with the report ...199216031675
a survey of house mice from iowa swine farms for infection with leptospira interrogans serovar bratislava. 199217424117
serological reactions against leptospira interrogans serovars in alpacas after vaccination. 199116031613
restriction endonuclease analysis as a taxonomic tool in the study of pig isolates belonging to the australis serogroup of leptospira interrogans.restriction endonuclease analysis was performed on dnas from the type strains of the australis serogroup of leptospira interrogans by using 20 restriction enzymes, and the electrophoretic patterns obtained were compared with patterns obtained from 162 australis serogroup isolates from pigs. it proved to be a quick and reliable method for typing such strains. all of the pig isolates were identified as either serovar bratislava or muenchen. it also showed differences at the subserovar level which ...19911647408
nucleotide sequence of a repetitive element isolated from leptospira interrogans serovar hardjo type hardjo-bovis.a repetitive element from the genome of leptospira interrogans serovar hardjo type hardjo-bovis ('l. hardjo-bovis') was identified, cloned and sequenced. similar sequences were shown by hybridization to be encoded by a further eight of 32 other leptospiral serovars tested. an undefined number of repetitive elements were located in the l. hardjo-bovis genome; sequence degeneracy of the elements was observed and no significant open reading frames were identified within the at-rich (60%) 1467 bp re ...19911650813
prevalence of pseudorabies virus infection and associated infections in six large swine herds in illinois.sera were collected from 6 large farrow-to-finish swine herds infected with pseudorabies virus (prv) in illinois. all herds were participating in the large herd cleanup study, a usda-initiated project to evaluate the feasibility of eradicating pseudorabies from large farms (greater than 400 sows) by use of a combination of vaccination and management changes. herd size ranged between 425 and 1,500 breeding females. between april and july 1990, sera for measurement of prv antibodies were obtained ...19911651912
serologic survey for selected microbial pathogens in bison from kansas.a serologic survey was conducted on an american bison (bison bison) herd in kansas for antibodies against brucella spp., leptospira interrogans serovar canicola, pomona, grippotyphosa, icterohaemorrhagiae, and hardjo, anaplasma spp., bluetongue virus, infectious bovine rhinotracheitis virus and bovine viral diarrhea virus. there was an increase in prevalence of bluetongue antibodies from 38% in 1987 to 100% in 1989 in animals greater than or equal to 24-mo-old. prevalences of antibodies against ...19911656107
physical map of chromosomal and plasmid dna comprising the genome of leptospira interrogans.the size and physical structure of the leptospira interrogans genome was characterized using contour-clamped homogenous electric field (chef) gel electrophoresis. the l. interrogans genome is approximately 4750 kb in size and is composed of two molecular species of dna: a 4400 kb chromosome; and a 350 kb plasmid, plin1. a physical map of the chromosome was constructed with the restriction enzymes noti and sfii. a physical map of plin1 was constructed with apai, noti, sse83871, sgrai, and smai. b ...19911656379
Refresh
firstprev
...2122232425262728
nextlast
Displaying items 2101 - 2200 of 2728