Publications
Title | Abstract | Year(sorted descending) Filter | PMID Filter |
---|
microcolinearity and genome evolution in the adha region of diploid and polyploid cotton (gossypium). | genome sizes vary by several orders of magnitude, driven by mechanisms such as illegitimate recombination and transposable element proliferation. prior analysis of the cesa region in two cotton genomes that diverged 5-10 million years ago (ma), and acquired a twofold difference in genome size, revealed extensive local conservation of genic and intergenic regions, with no evidence of the global genome size difference. the present study extends the comparison to include bac sequences surrounding t ... | 2007 | 17461788 |
integrative mapping of gossypium hirsutum l. by meiotic fluorescent in situ hybridization of a tandemly repetitive sequence (b77). | we determined the relative positions of the tandem-repeat molecular cytogenetic marker b77, translocation breakpoints, and telosome arms in gossypium hirsutum cytogenetic stocks by fluorescence in situ hybridization (fish) analysis of meiotic quadrivalents in 16 single and 2 double translocation heterozygotes and five monotelodisomics. results delimited the b77 fish locus to the right arm of the d-subgenome chromosome 14 (14r) and the short arm (14sh), respectively. by equating 14r with 14sh and ... | 2007 | 17409065 |
computational identification of micrornas and their targets in gossypium hirsutum expressed sequence tags. | micrornas (mirnas) are a class of non-coding rnas that regulate gene post-transcriptional expression in animals and plants. comparatively genomic computational methods have been developed to predict new mirnas in worms, humans, and arabidopsis. here we present an est (expressed sequence tags)--and gss (genomic survey sequences)-based combined approach for the detection of novel mirnas in gossypium hirsutum. this was initiated by using previously known mirna sequences from arabidopsis, rice and o ... | 2007 | 17408884 |
evaluation of source leaf responses to water-deficit stresses in cotton using a novel stress bioassay. | water-deficit stresses preferentially reduce shoot growth, thereby disrupting the flow of carbohydrates from source leaves to the developing sinks. here, we use a novel stress bioassay to dissect responses of field and greenhouse-grown cotton (gossypium hirsutum) source leaves to water-deficit stresses. fifth main stem leaf samples were harvested at sunrise and subjected to a prolonged elevated respiratory demand in the dark. sucrose levels are lower in nonstressed cotton at sunrise compared to ... | 2007 | 17071650 |
simultaneous growth and emission measurements demonstrate an interactive control of methanol release by leaf expansion and stomata. | emission from plants is a major source of atmospheric methanol. growing tissues contribute most to plant-generated methanol in the atmosphere, but there is still controversy over biological and physico-chemical controls of methanol emission. methanol as a water-soluble compound is thought to be strongly controlled by gas-phase diffusion (stomatal conductance), but growth rate can follow a different diurnal rhythm from that of stomatal conductance, and the extent to which the emission control is ... | 2007 | 17374874 |
selectivity of pesticides used on cotton (gossypium hirsutum) to trichogramma pretiosum reared on two laboratory-reared hosts. | the side-effects of pesticides (insecticides, fungicides, herbicides and plant growth regulators) used on cotton were tested on adults and pupae of trichogramma pretiosum riley reared in the laboratory on two different hosts, the angoumois grain moth (sitotroga cerealella olivier) and the mediterranean flour moth (ephestia kuehniella (zeller)). the eggs of the host enclosing the parasitoid pupae received direct pesticide sprays, while the adults of the parasitoid were exposed to the pesticides t ... | 2006 | 16308868 |
[molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. | using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to c-terminal peptides ggaactcccttttctggatagctcacc and cctggtccgaacccaaacaggacgcccc, were used to amplify, via polymerase chain reaction, genomic sequences from two gossypium species, a diploid gossypium herbaceum, and a tetraploid gossypium hirsutum cv. 108f. amplified dna was separated into individual sequences by cloning into an m13 vector. six diff ... | 2006 | 1339958 |
infraspecific dna methylation polymorphism in cotton (gossypium hirsutum l.). | cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. relatively little information exists, however, on levels and patterns of methylation polymorphism (mp) at homologous loci within species. here we explored the levels and patterns of methylation-polymorphism diversity at ccgg sites within allotetraploid cotton, gossypium hirsutum, using a ... | 2006 | 16987937 |
soil microbial activity is affected by roundup weathermax and pesticides applied to cotton (gossypium hirsutum). | adoption of glyphosate-based weed control systems has led to increased use of the herbicide with continued use of additional pesticides. combinations of pesticides may affect soil microbial activity differently than pesticides applied alone. research was conducted to evaluate the influence of glyphosate-based cotton pest management systems on soil microbial activity. soil was treated with commercial formulations of trifluralin, aldicarb, and mefenoxam + pentachloronitrobenzene (pcnb) with or wit ... | 2006 | 16968086 |
efficient delivery of small interfering rna to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing. | small interfering rna (sirna) induced posttranscriptional gene silencing (ptgs) has been an efficient method for genetic and molecular analysis of certain developmental and physiological processes and represented a potential strategy for both controlling virus replication and developing therapeutic products. however, there are limitations for the methods currently used to deliver sirna into cells. we report here, to our knowledge, the first efficient delivery of sirna to plant cells by a nanosec ... | 2006 | 22980207 |
[spectral characteristics and the structure of chloroplasts upon blocking the early stages of chlorophyll biosynthesis]. | the cotton mutant xantha (gossypium hirsutum l.) with the blocked synthesis of 5-aminolevulinic acid in the light has been shown to accumulate chlorophyll 30 times less than the parent type. in chloroplasts of the mutant xantha, the formation of the membrane system is blocked at the earliest stages, mainly at the stage of bubbles and single short thylakoids. only light-harvesting chlorophyll-a/b-protein complexes i and ii with chlorophyll fluorescence maxima at 728 and 681 nm, respectively, are ... | 2006 | 16909851 |
effect of monosodium methanarsonate application on cuticle wax content of cocklebur and cotton plants. | leaf cuticle waxes were extracted from monosodium methanearsonate (msma)-resistant (r) and -susceptible (s) common cocklebur (xanthium strumarium l.) and cotton (gossypium hirsutum l.) plants at 0, 3, 5, and 7 days after treatment (dat) following 1x and 2x msma applications. wax constituents were analyzed by gas chromatography (gc) with flame ionization detection and compared to alkane and alcohol standards of carbon lengths varying from c21 to c30. differences in waxes were calculated and repor ... | 2006 | 16893783 |
accumulation of genome-specific transcripts, transcription factors and phytohormonal regulators during early stages of fiber cell development in allotetraploid cotton. | gene expression during the early stages of fiber cell development and in allopolyploid crops is poorly understood. here we report computational and expression analyses of 32 789 high-quality ests derived from gossypium hirsutum l. texas marker-1 (tm-1) immature ovules (gh_tmo). the ests were assembled into 8540 unique sequences including 4036 tentative consensus sequences (tcs) and 4504 singletons, representing approximately 15% of the unique sequences in the cotton est collection. compared with ... | 2006 | 16889650 |
molecular cloning of a peroxidase gene from poplar and its expression in response to stress. | to elucidate the precise functions of peroxidase in poplar (populus alba x p. tremula var. glandulosa), we cloned a peroxidase gene (popod1) from poplar suspension culture cells and examined its expression pattern in response to various stresses. popod1 showed the highest homology with a bacterial-induced peroxidase gene from cotton (gossypium hirsutum l.). the popod1 gene encodes a putative 316 amino acid protein with an n-terminal signal peptide of 23 residues. the dna blot analysis indicated ... | 2006 | 16877325 |
foliar washoff potential and simulated surface runoff losses of trifloxysulfuron in cotton. | the surface runoff potential of trifloxysulfuron {n-[(4,6-dimethoxy-2-pyrimidinyl)carbamoyl]-3-(2,2,2-trifluoroethoy)-pyridin-2-sulfonamide sodium salt} in cotton (gossypium hirsutum l.) production systems has not been evaluated. the objectives of this study were to (i) determine sorption/desorption coefficients for trifloxysulfuron; (ii) quantify foliar washoff of trifloxysulfuron when applied to cotton at the five-leaf stage; and (iii) determine the surface runoff potential of trifloxysulfuron ... | 2006 | 16848537 |
soil organic carbon sequestration in cotton production systems of the southeastern united states: a review. | past agricultural management practices have contributed to the loss of soil organic carbon (soc) and emission of greenhouse gases (e.g., carbon dioxide and nitrous oxide). fortunately, however, conservation-oriented agricultural management systems can be, and have been, developed to sequester soc, improve soil quality, and increase crop productivity. our objectives were to (i) review literature related to soc sequestration in cotton (gossypium hirsutum l.) production systems, (ii) recommend best ... | 2006 | 16825457 |
influence of cytokinins, auxins and polyamines on in vitro mass multiplication of cotton (gossypium hirsutum l. cv. svpr2). | in the present investigation, the influence of different forms of cytokinins, auxins and polyamines were tested for mass multiplication and regeneration of cotton. initially, for the identification of effective concentration for multiple shoot induction, various concentrations of bap, kin and 2ip along with iaa and naa were tested. among tested concentrations, media fortified with ms salts; b5 vitamins; 30 g/l, glucose; 2.0 mg/l, 2ip; 2.0 mg/l, iaa and 0.7 % agar showed best response for multipl ... | 2006 | 16784123 |
effect of racemic and (+)- and (-)-gossypol on the survival and development of helicoverpa zea larvae. | gossypol is a sesquiterpene that occurs naturally in seed and other parts of the cotton plant. because of restricted rotation around the binaphthyl bond, it occurs naturally as enantiomeric mixtures with (+)-gossypol to (-)-gossypol ratios that vary between 97:3 and 31:69. commercial cotton varieties (gossypium hirsutum) normally exhibit an approximate 3:2 ratio. (+)-gossypol is significantly less toxic than (-)-gossypol to nonruminant animals; thus, cottonseed containing high levels of (+)-goss ... | 2006 | 16739016 |
sampling methods, dispersion patterns, and fixed precision sequential sampling plans for western flower thrips (thysanoptera: thripidae) and cotton fleahoppers (hemiptera: miridae) in cotton. | a 2-yr field study was conducted to examine the effectiveness of two sampling methods (visual and plant washing techniques) for western flower thrips, frankliniella occidentalis (pergande), and five sampling methods (visual, beat bucket, drop cloth, sweep net, and vacuum) for cotton fleahopper, pseudatomoscelis seriatus (reuter), in texas cotton, gossypium hirsutum (l.), and to develop sequential sampling plans for each pest. the plant washing technique gave similar results to the visual method ... | 2006 | 16686161 |
complete assignment of the chromosomes of gossypium hirsutum l. by translocation and fluorescence in situ hybridization mapping. | significant progress has been made in the construction of genetic maps in the tetraploid cotton gossypium hirsutum. however, six linkage groups (lgs) have still not been assigned to specific chromosomes, which is a hindrance for integrated genetic map construction. in the present research, specific bacterial artificial chromosome (bac) clones constructed in g. hirsutum acc. tm-1 for these six lgs were identified by screening the bac library using linkage group-specific simple-sequence repeats ma ... | 2006 | 16609860 |
physical mapping of the rf1 fertility-restoring gene to a 100 kb region in cotton. | cytoplasmic male sterility (cms) plays an important role in crop heterosis exploitation. determining one or more nuclear genes that can restore male fertility to cms is essential for developing hybrid cultivars. genetic and physical mapping is the standard technique required for isolating these restoration genes. by screening 2,250 simple sequence repeat (ssr) primer pairs in cotton (gossypium hirsutum l.), we identified five new ssr markers that are closely linked to the rf1 gene, a fertility r ... | 2006 | 16544127 |
ratios of (+)- and (-)-gossypol in leaves, stems, and roots of selected accessions of gossypium hirsutum var. marie galante (watt) hutchinson. | gossypol is an allelochemical that occurs naturally throughout the cotton plant as an enantiomeric mixture. gossypol and related terpenoids protect the plant from some insect herbivores. cottonseed has a high protein content, but it is underutilized because (-)-gossypol, which is toxic to nonruminants, occurs in the seed along with (+)-gossypol. commercial upland cottons usually have an approximate 3:2 (+)- to (-)-gossypol ratio in the seed, but plants can be bred with <8% (-)-gossypol using acc ... | 2006 | 16506812 |
cotton genome mapping with new microsatellites from acala 'maxxa' bac-ends. | fine mapping and positional cloning will eventually improve with the anchoring of additional markers derived from genomic clones such as bacs. from 2,603 new bac-end genomic sequences from gossypium hirsutum acala 'maxxa', 1,316 pcr primer pairs (designated as musb) were designed to flank microsatellite or simple sequence repeat motif sequences. most (1164 or 88%) musb primer pairs successfully amplified dna from three species of cotton with an average of three amplicons per marker and 365 marke ... | 2006 | 16501995 |
a global assembly of cotton ests. | approximately 185,000 gossypium est sequences comprising >94,800,000 nucleotides were amassed from 30 cdna libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. these libraries were derived from allopolyploid cotton (gossypium hirsutum; a(t) and d(t) genomes) as well as its two diploid progenitors, gossypium arboreum (a genome) and gossypium raimondii (d genome). ests were assembled using the program for assembli ... | 2006 | 16478941 |
transcriptome profiling, molecular biological, and physiological studies reveal a major role for ethylene in cotton fiber cell elongation. | upland cotton (gossypium hirsutum) produces the most widely used natural fibers, yet the regulatory mechanisms governing fiber cell elongation are not well understood. through sequencing of a cotton fiber cdna library and subsequent microarray analysis, we found that ethylene biosynthesis is one of the most significantly upregulated biochemical pathways during fiber elongation. the 1-aminocyclopropane-1-carboxylic acid oxidase1-3 (aco1-3) genes responsible for ethylene production were expressed ... | 2006 | 16461577 |
the peroxidative coupling of hemigossypol to (+)- and (-)-gossypol in cottonseed extracts. | peroxidase(s) present in embryo extracts of gossypium hirsutum cv. texas marker 1 catalyzed a bimolecular coupling of [4-(3)h]-hemigossypol to [4,4'-(3)h(2)]-gossypol. the reaction was dependent on the addition of h(2)o(2) and was inhibited 71-94% by 1 and 10mm sodium azide. the phenolic coupling produced 53% (+)-gossypol and 47% (-)-gossypol in close agreement to the 49% (+)-gossypol and 51% (-)-gossypol found in the intact seed. the nearly racemic mixture of (+)-and (-)-gossypol produced in th ... | 2006 | 16403543 |
oviposition deterrents in larval frass of the cotton boll worm, helicoverpa armigera (lepidoptera: noctuidae): chemical identification and electroantennography analysis. | oviposition deterrents in the frass of cotton bollworm (cbw), helicoverpa armigera larvae fed on an artificial diet (fa) and on cotton gossypium hirsutum leaves (fc) were investigated by behavioral bioassays and electroantennography analyses in the laboratory. it was found that a water suspension or a hexane extract of the frass fa or fc, in contrast to the corresponding foods, significantly deterred oviposition of conspecifics. when hexane extracts of the frass fa and fc were further partitione ... | 2006 | 16388821 |
characteristics, development and mapping of gossypium hirsutum derived est-ssrs in allotetraploid cotton. | in order to construct a saturated genetic map and facilitate marker-assisted selection (mas) breeding, it is necessary to enhance the current reservoir of known molecular markers in gossypium. microsatellites or simple sequence repeats (ssrs) occur in expressed sequence tags (est) in plants. many ests are publicly available now and represent a good tool in developing est-ssrs. from 13,505 ests developed from our two cotton fiber/ovule cdna libraries constructed for upland cotton, 966 (7.15%) con ... | 2006 | 16341684 |
gene action and morphological characteristics of pink flower and pink filament mutants in cotton (gossypium hirsutum l.). | 2006 | 17406101 | |
the gh3 family in plants: genome wide analysis in rice and evolutionary history based on est analysis. | the gh3 gene family in arabidopsis, implicated in hormonal homeostasis through the conjugation of indolacetic and jasmonic acids to amino acids, is involved in a broad range of plant growth and development processes. in this work, the analysis of the gh3 family in the genome of oryza sativa identified 13 hypothetical orfs. est analysis and rt-pcr assays demonstrated that 12 of them were active genes. an extensive est analysis of the gh3 family performed on 26 plant species was used to estimate t ... | 2006 | 16488558 |
comparative study of the five biological parameters of cotton whitefly bemisia tabaci and silverleaf whitefly b. argentifolii bellows and perring reared on cotton under laboratory condition. | the five biological parameters of sweetpotato whitefly, bemisia tabaci (genn.) and silverleaf whitefly bemisia argentifolii bellows and perring (hom: aleyrodidae) as an important pest of cotton were compared on cotton in laboratory condition. the infested leaves containing nymphs and pupae were collected from cotton fields in iran. experiments were conducted in a growth chamber under 24+/-2 degrees c, 55+/-3% rh and 16:8 (l:d) photoperiod on cotton, gossypium hirsutum l. the newly emerged popula ... | 2006 | 17385531 |
enzyme activities and arylsulfatase protein content of dust and the soil source: biochemical fingerprints? | little is known about the potential of enzyme activities, which are sensitive to soil properties and management, for the characterization of dust properties. enzyme activities may be among the dust properties key to identifying the soil source of dust. we generated dust (27 and 7 microm) under controlled laboratory conditions from agricultural soils (0-5 cm) with history of continuous cotton (gossypium hirsutum l.) or cotton rotated with peanut (arachis hypogaea l.), sorghum [sorghum bicolor (l. ... | 2006 | 15356225 |
how do leaf hydraulics limit stomatal conductance at high water vapour pressure deficits? | a reduction in leaf stomatal conductance (g) with increasing leaf-to-air difference in water vapour pressure (d) is nearly ubiquitous. ecological comparisons of sensitivity have led to the hypothesis that the reduction in g with increasing d serves to maintain leaf water potentials above those that would cause loss of hydraulic conductance. a reduction in leaf water potential is commonly hypothesized to cause stomatal closure at high d. the importance of these particular hydraulic factors was te ... | 2006 | 16898024 |
qtl mapping for resistance to root-knot nematodes in the m-120 rnr upland cotton line (gossypium hirsutum l.) of the auburn 623 rnr source. | root-knot nematodes meloidogyne incognita (kofoid and white) can cause severe yield loss in cotton (gossypium hirsutum l.). the objectives of this study were to determine the inheritance and genomic location of genes conferring root-knot nematode resistance in m-120 rnr, a highly resistant g. hirsutum line with the auburn 623 rnr source of resistance. utilizing two interspecific f(2) populations developed from the same m-120 rnr by gossypium barbadense (cv. pima s-6) cross, genome-wide scanning ... | 2006 | 16960714 |
phenotypic expression of rkn1-mediated meloidogyne incognita resistance in gossypium hirsutum populations. | the root-knot nematode meloidogyne incognita is a damaging pest of cotton (gossypium hirsutum) worldwide. a major gene (rkn1) conferring resistance to m. incognita was previously identified on linkage group a03 in g. hirsutum cv. acala nemx. to determine the patterns of segregation and phenotypic expression of rkn1, f(1), f(2), f(2:3), bc(1)f(1) and f(2:7) recombinant inbred lines (ril) from intraspecific crosses between acala nemx and a closely related susceptible cultivar acala sj-2 were inocu ... | 2006 | 19259455 |
reproduction of meloidogyne incognita on winter cover crops used in cotton production. | substantial reproduction of meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (gossypium hirsutum) crop. the amount of population increase during the winter depends on soil temperature and the host status of the cover crop. our objectives were to quantify m. incognita race 3 reproduction on rye (secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of m. incognita and subsequent dam ... | 2006 | 19259434 |
identification and mapping of microsatellite markers linked to a root-knot nematode resistance gene (rkn1) in acala nemx cotton (gossypium hirsutum l.). | host-plant resistance is the most economic and effective strategy for root-knot nematode (rkn) meloidogyne incognita control in cotton (gossypium hirsutum l.). molecular markers linked to resistance are important for incorporating resistance genes into elite cultivars. to screen for microsatellite markers (ssr) closely linked to rkn resistance in g. hirsutum cv. acala nemx, f1, f2, bc1f1, and f2:7 recombinant inbred lines (rils) from intraspecific crosses and an f2 from an interspecific cross wi ... | 2006 | 16362274 |
fusarium wilt (fusarium oxysporum f. sp. vasinfectum) genes expressed during infection of cotton (gossypium hirsutum)dagger. | summary we sought to identify fusarium oxysporum f. sp. vasinfectum (fov) genes that may be associated with pathogenicity. initially we utilized microarray and q-pcr technology to identify fov genes expressed in root and hypocotyl tissues during a compatible infection of cotton. we identified 218 fungal clones representing 174 fov non-redundant genes as expressed in planta. the majority of the expressed sequences were expressed in infected roots, with only six genes detected in hypocotyl tissue. ... | 2006 | 20507430 |
expression of cp4 epsps in microspores and tapetum cells of cotton (gossypium hirsutum) is critical for male reproductive development in response to late-stage glyphosate applications. | plants expressing agrobacterium sp. strain cp4 5-enolpyruvylshikimate-3-phosphate synthase (cp4 epsps) are known to be resistant to glyphosate, a potent herbicide that inhibits the activity of the endogenous plant epsps. the rr1445 transgenic cotton line (current commercial line for roundup ready cotton) was generated using the figwort mosaic virus (fmv) 35s promoter to drive the expression of the cp4 epsps gene, and has excellent vegetative tolerance to glyphosate. however, with high glyphosate ... | 2006 | 17309724 |
characterization and expression of a putative retinoblastoma protein binding gene from gossypium hirsutum. | a genomic clone representing a putative retinoblastoma binding (rbb) protein was isolated from a gossypium hirsutum bac library. alignment of the gene sequence with the cdna sequence indicated the gene consists of six exons that have standard eukaryotic splice junctions. the conceptual spliced transcript was 98% identical to tc37171 in the tigr gene index, however it encoded an orf 107 amino acids longer than best deduced protein from tc37171. the conceptual translation of the genomic clone was ... | 2006 | 17312951 |
cloning and characterization of cotton ghbg gene encoding beta-glucosidase. | beta-1,4-glucosidase (bg, ec3.2.1.21), one of three cellulases, is a widespread family of enzymes involved in the metabolism of cell wall polysaccharides in both prokaryocytes and eukaryotes. here, we report the isolation of a full-length cdna encoding beta-1,4-glucosidase protein (designated as ghbg) and its putative function in the process of fiber development and in yeast. through random sequencing of the cotton fiber cdna library from 7235 germplasm line, with elite fiber quality in gossypiu ... | 2006 | 17343209 |
detection by rapd-pcr of polymorphism in populations of bemisia tabaci (genn.) collected on four host plants from iran. | the sweetpotato whitefly, bernisia tabaci (genn.) (hom: aleyrodidae) is a major pest of field crops, vegetables and ornamentals in iran. in this study, the infested leaves of cucumber (cucurnis sativus l.) zucchini (cucurbita pepo l.) eggplant (solanum melongena l.) and cotton (gossypium hirsutum l.) with whitefly nymphs and pupae were collected from iran, and were transferred to the laboratory. the newly emerged males and females of each population were released separately into a large cage set ... | 2006 | 17385530 |
dna screening reveals pink bollworm resistance to bt cotton remains rare after a decade of exposure. | transgenic crops producing toxins from the bacterium bacillus thuringiensis (bt) kill insect pests and can reduce reliance on insecticide sprays. although bt cotton (gossypium hirsutum l.) and bt corn (zea mays l.) covered 26 million ha worldwide in 2005, their success could be cut short by evolution of pest resistance. monitoring the early phases of pest resistance to bt crops is crucial, but it has been extremely difficult because bioassays usually cannot detect heterozygotes harboring one all ... | 2006 | 17066779 |
genetic variation for resistance to bacillus thuringiensis toxins in helicoverpa zea (lepidoptera: noctuidae) in eastern north carolina. | to evaluate resistance to bacillus thuringiensis berliner (bt) toxins, adult female bollworms, helicoverpa zea (boddie) (lepidoptera: noctuidae), were collected from four light trap locations in two eastern north carolina counties from august to october during 2001 and 2002. females were allowed to oviposit, and upon hatching, 24 neonates from each female (f1 lines) were screened for survival and growth rate on each of three diets: non-bt diet, diet containing 5.0 microg/ml cry1ac toxin, or diet ... | 2006 | 17066814 |
effect of cotton cultivar on performance of aphis gossypii (homoptera: aphididae) in iran. | cotton aphids, aphis gossypii glover (homoptera: aphididae), obtained from cotton, gossypium hirsutum l., fields in the gorgan region of northern iran, were colonized on 'varamin' cotton plants in a growth chamber. the development, survivorship, and life table parameters of the cotton aphid were evaluated at 27.5 +/- 1 degrees c, 65 +/- 10% rh, and aphotoperiod of 14:10 (l:d) h of artificial light on five commonly growing cotton cultivars: varamin, 'sealand' (relatively resistant cultivar), 'bak ... | 2006 | 17066818 |
selecting for efficacy of bollgard cotton cultivars against various lepidoptera using forward breeding techniques. | studies during the past 5 yr have shown that the overall level of protein (cry1ac) produced from the cry1ac transgene (monsanto co., st. louis, mo) differ among commercial bollgard cotton, gossypium hirsutum l., cultivars. these differences between cultivars are under genetic control and have been correlated with efficacy of certain lepidopteran pests. previous studies have shown that the parental background (i.e., non-cry1ac conventional cultivar) has a significant influence on the amount of cr ... | 2006 | 17066820 |
[isolation by suppression-subtractive hybridization of genes preferentially expressed during early and late fiber development stages in cotton]. | as a main natural fiber source, cotton plays an important role in human life. to identify genes preferentially expressed during early and late cotton fiber development, we constructed two fiber subtracted libraries on the basis of pcr-selected subtraction using a pool of nonfiber tissues as the same driver and 10 days postanthesis (dpa) and 20 dpa fiber cells as testers, respectively. through differential screening, 292 clones in both libraries were identified as being preferentially expressed d ... | 2006 | 17086983 |
cadherin-based resistance to bacillus thuringiensis cotton in hybrid strains of pink bollworm: fitness costs and incomplete resistance. | recessive resistance to bacillus thuringiensis (bt) cotton, gossypium hirsutum l., in laboratory-selected strains of pink bollworm, pectinophora gossypiella (saunders), is associated with three resistance alleles (r1, r2, and r3) of a cadherin gene. previous experiments based on measurement of fitness components in bt-resistant and bt-susceptible strains revealed that fitness costs and incomplete resistance are associated with resistance. here, we used two hybrid strains of pink bollworm, each c ... | 2006 | 17195656 |
modeling the impact of alternative hosts on helicoverpa zea adaptation to bollgard cotton. | for highly polyphagous cotton, gossypium hirsutum l., pests such as helicoverpa zea (boddie), a substantial portion of the larval population develops on noncotton alternative hosts. these noncotton hosts potentially provide a natural refuge for h. zea, thereby slowing the evolution of resistance to the bacillus thuringiensis berliner (bt)-derived cry1ac protein present in bollgard cotton. here, we demonstrate how the measured contribution of such alternative hosts can be included in estimating t ... | 2006 | 17195681 |
high-level resistance to bacillus thuringiensis toxin crylac and cadherin genotype in pink bollworm. | resistance to transgenic cotton, gossypium hirsutum l., producing bacillus thuringiensis (bt) toxin cry1ac is linked with three recessive alleles of a cadherin gene in laboratory-selected strains of pink bollworm, pectinophora gossypiella (saunders), a major cotton pest. here, we analyzed a strain (mov97-r) with a high frequency of cadherin resistance alleles, a high frequency of resistance to 10 microg of cry1ac per milliliter of diet, and an intermediate frequency of resistance to 1000 microg ... | 2006 | 17195682 |
cotton (gossypium hirsutum l.). | considering the economic importance of cotton in many developing and developed countries, there is an urgent need to accelerate the application of biotechnological tools to address the problems associated with the production of this crop and to improve the quality of fiber and seed. this requires a simple yet robust gene delivery/transformant recovery system. a protocol for the production of transgenic cotton plants was refined in our laboratory. it involves agrobacterium-mediated transformation ... | 2006 | 16988351 |
molecular variability of spodoptera frugiperda (lepidoptera: noctuidae) populations associated to maize and cotton crops in brazil. | the molecular variability among 10 populations of spodoptera frugiperda (j.e. smith), collected from maize, zea mays l., or cotton gossypium hirsutum l. crops located at distinctive geographical regions in brazil, was assessed through random amplification of polymorphic dna (rapd)-polymerase chain reaction (pcr). in total, 208 rapd markers were evaluated, and 98% of them were polymorphic. the mean genetic similarity was 0.6621 and 0.2499 by the simple matching and jaccard matrices, respectively. ... | 2006 | 16686155 |
analysis of ests from multiple gossypium hirsutum tissues and identification of ssrs. | in an effort to expand the gossypium hirsutum l. (cotton) expressed sequence tag (est) database, ests representing a variety of tissues and treatments were sequenced. assembly of these sequences with ests already in the est database (dbest, genbank) identified 9675 cotton sequences not present in genbank. statistical analysis of a subset of these ests identified genes likely differentially expressed in stems, cotyledons, and drought-stressed tissues. annotation of the differentially expressed cd ... | 2006 | 16699550 |
isolation of the promoter of a cotton beta-galactosidase gene (ghgal1) and its expression in transgenic tobacco plants. | beta-galactosidases (ec 3.2.1.23) constitute a widespread family of glycosyl hydrolases in plants and are thought to be involved in metabolism of cell wall polysaccharides. a cdna of the cotton (gossypium hirsutum) beta-galactosidase gene, designated ghgal1, has previously been identified and its transcripts are highly abundant at the elongation stage of the cotton fiber. to examine the temporal and spatial control of ghgal1 expression, a transcriptional fusion of the ghgal1 promoter region (177 ... | 2006 | 16704113 |
an experiment using neutron activation analysis and a rare earth element to mark cotton plants and two insects that feed on them. | studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. rare earth elements, such as samarium (sm), have been used as ingested markers of some insects and detected using neutron activation analysis (naa). in this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, anthonomus grandis grandis boheman (coleoptera: curculionidae), at different dosages and in water used to irrigate cotton, gossypium hirsut ... | 2006 | 16713273 |
the cloning and sequencing of a cdna encoding a wd repeat protein in cotton (gossypium hirsutum l.). | in this research, one 1156 bp cdna containing full open reading frame and encoding a novel 24-kda protein with four tandem wd repeat motifs was cloned from cotton, therefore was named ghwdr and the genbank accession number is ay870657. by search of ghwdr cdna and amino acid sequences in the database, we found that ghwdr and osjnba0003g23.2 from oryza sativa show 90% sequence identity and 84% identity to wd-repeat protein from arabidopsis thaliana, and also has high sequence identity to other wd ... | 2006 | 16753817 |
glyphosate-induced anther indehiscence in cotton is partially temperature dependent and involves cytoskeleton and secondary wall modifications and auxin accumulation. | yield reduction caused by late application of glyphosate to glyphosate-resistant cotton (gossypium hirsutum; grc) expressing cp4 5-enol-pyruvylshikmate-3-p synthase under the cauliflower mosaic virus-35s promoter has been attributed to male sterility. this study was aimed to elucidate the factors and mechanisms involved in this phenomenon. western and tissue-print blots demonstrated a reduced expression of the transgene in anthers of grc compared to ovules of the same plants. glyphosate applicat ... | 2006 | 16766672 |
agrobacterium-mediated transformation of cotton (gossypium hirsutum l. cv. zhongmian 35) using glyphosate as a selectable marker. | the most economically significant chinese cotton cultivar (gossypium hirsutum l. cv. zhongmian 35) was transformed via agrobacterium tumefaciens-mediated dna transfer. the aroa-m1 gene that confers resistance to the glyphosate was fused with a chloroplast-transit peptide of arabidopsis thaliana 5-enolpyruvyl-3-phosphoshikimate synthase (asp) and expressed in cotton plants under the control of a camv35s promoter. transgenic plants were directly selected on medium containing glyphosate. thirty-fou ... | 2006 | 16799756 |
the absolute configuration of (-)-3-hydroxy-alpha-calacorene. | 3-hydroxy-alpha-calacorene was identified in extracts from cold-shocked seedlings of cotton (gossypium hirsutum l.) and kenaf (hibiscus cannabinus l.), both of which are members of the malvaceae family. (-)-3-hydroxy-alpha-calacorene was isolated from heterotheca inuloides cass. (asteraceae). hplc on a chiral stationary phase column showed that the 3-hydroxy-alpha- calacorene from cotton and kenaf had the same relative configuration, while that from h. inuloides was of the opposite configuration ... | 2006 | 16806327 |
captures of boll weevils (coleoptera: curculionidae) in traps associated with different habitats. | programs to eradicate the boll weevil, anthonomus grandis grandis boheman, from cotton, gossypium hirsutum l., in the united states rely heavily on pheromone traps for monitoring weevil populations in both active and posteradication maintenance programs. modifications to trapping protocols that increase trap effectiveness should contribute to this eradication effort. between october 1996 and may 1997 and between september 1997 and april 1998, we compared trap effectiveness, indicated by the numb ... | 2006 | 16813308 |
effect of resistance to bacillus thuringiensis cotton on pink bollworm (lepidoptera: gelechiidae) response to sex pheromone. | fitness costs associated with resistance to transgenic crops producing toxins from bacillus thuringiensis (bt) could reduce male response to pheromone traps. such costs would cause underestimation of resistance frequency if monitoring was based on analysis of males caught in pheromone traps. to develop a dna-based resistance monitoring program for pink bollworm, pectinophora gossypiella (saunders) (lepidoptera: gelechiidae), we compared the response to pheromone traps of males with and without c ... | 2006 | 16813335 |
carbon supply and storage in tilled and nontilled soils as influenced by cover crops and nitrogen fertilization. | soil carbon (c) sequestration in tilled and nontilled areas can be influenced by crop management practices due to differences in plant c inputs and their rate of mineralization. we examined the influence of four cover crops {legume [hairy vetch (vicia villosa roth)], nonlegume [rye (secale cereale l.)], biculture of legume and nonlegume (vetch and rye), and no cover crops (or winter weeds)} and three nitrogen (n) fertilization rates (0, 60 to 65, and 120 to 130 kg n ha(-1)) on c inputs from cove ... | 2006 | 16825471 |
the cotton fiber zinc-binding domain of cellulose synthase a1 from gossypium hirsutum displays rapid turnover in vitro and in vivo. | little is known about the assembly and turnover of cellulose synthase complexes commonly called rosettes. recent work indicates that rosette assembly could involve the dimerization of cesa (cellulose synthase catalytic subunit) proteins regulated by the redox state of the cesa zinc-binding domain (znbd). several studies in the 1980s led to the suggestion that synthase complexes may have very short half-lives in vivo, but no recent work has directly addressed this issue. in the present work, we s ... | 2006 | 16873546 |
the current status and environmental impacts of glyphosate-resistant crops: a review. | glyphosate [n-(phosphonomethyl) glycine]-resistant crops (grcs), canola (brassica napus l.), cotton (gossypium hirsutum l.), maize (zea mays l.), and soybean [glycine max (l.) merr.] have been commercialized and grown extensively in the western hemisphere and, to a lesser extent, elsewhere. glyphosate-resistant cotton and soybean have become dominant in those countries where their planting is permitted. effects of glyphosate on contamination of soil, water, and air are minimal, compared to some ... | 2006 | 16899736 |
cloning and functional analysis of the novel gene ghdbp3 encoding a dre-binding transcription factor from gossypium hirsutum. | a novel cdna encoding dre-binding transcription factor, designated ghdbp3, was cloned from gossypium hirsutum. this protein was classified into a-4 group of dreb subfamily based on multiple sequence alignment and phylogenetic characterization. semiquantitative rt-pcr showed that ghdbp3 was expressed in the leaves, cotyledons, roots and stems of 2-week-old cotton seedlings under non-stress conditions and was greatly induced in the cotton cotyledons by drought, nacl, low temperature and aba treatm ... | 2006 | 16935362 |
short-range dispersal and overwintering habitats of boll weevils (coleoptera: curculionidae) during and after harvest in the subtropics. | field experiments in the subtropical lower rio grande valley of texas were conducted to determine the extent of adult boll weevil, anthonomus grandis grandis boheman (coleoptera: curculionidae), dispersal from cotton, gossypium hirsutum l., fields during harvest operations and the noncotton-growing ("overwinter") period between 1 september and 1 february. using unbaited large capacity boll weevil traps placed at intervals extending outward from commercial field edges, boll weevils did not move i ... | 2006 | 16937667 |
wide-cross whole-genome radiation hybrid mapping of the cotton (gossypium barbadense l.) genome. | whole-genome radiation hybrid mapping has been applied extensively to human and certain animal species, but little to plants. we recently demonstrated an alternative mapping approach in cotton (gossypium hirsutum l.), based on segmentation by 5-krad gamma-irradiation and derivation of wide-cross whole-genome radiation hybrids (wwrhs). however, limitations observed at the 5-krad level suggested that higher doses might be advantageous. here, we describe the development of an improved second-genera ... | 2006 | 16362372 |
isolation of a cotton reversibly glycosylated polypeptide (ghrgp1) promoter and its expression activity in transgenic tobacco. | reversibly glycosylated polypeptides (rgps) are thought to be involved in polysaccharide metabolism. a cdna of the cotton (gossypium hirsutum) rgp gene, designated ghrgp1, has previously been characterized, and is preferentially expressed in fiber cells. in order to investigate its temporal and spatial control, we isolated a 624bp fragment upstream of the ghrgp1 coding sequence using a polymerase chain reaction (pcr)-based genomic walking method, transcriptionally fused the 624bp promoter sequen ... | 2006 | 16455356 |
cloning and characterization of two erebp transcription factors from cotton (gossypium hirsutum l.). | in this research, two erebp (ethylene response element binding protein) genes were isolated by the yeast one-hybrid system, named ghereb2 and ghereb3, and both have one intron in their coding regions. the deduced amino acid sequences of ghereb2 and ghereb3 have some typical features of transcription factors, one potential basic nuclear-localization signal, one possible acidic activation domain, and one conserved dna binding domain, and they show high similarity, especially in the dna-binding dom ... | 2006 | 16545065 |
the complete chloroplast genome sequence of gossypium hirsutum: organization and phylogenetic relationships to other angiosperms. | cotton (gossypium hirsutum) is the most important fiber crop grown in 90 countries. in 2004-2005, us farmers planted 79% of the 5.7-million hectares of nuclear transgenic cotton. unfortunately, genetically modified cotton has the potential to hybridize with other cultivated and wild relatives, resulting in geographical restrictions to cultivation. however, chloroplast genetic engineering offers the possibility of containment because of maternal inheritance of transgenes. the complete chloroplast ... | 2006 | 16553962 |
metabolism of [14c]-2,4-dichlorophenol in edible plants. | several 2,4-dichlorophenoxyacetic acid (2,4-d)-sensitive plants have been modified by genetic engineering with tfda gene to acquire 2,4-d tolerance. the expression product of this gene degrades 2,4-d to 2,4-dichlorophenol (dcp), which is less phytotoxic but could cause a problem of food safety. after a comparison of 2,4-d and dcp metabolism in transgenic 2,4-d-tolerant and wild cotton (gossypium hirsutum l.), a direct study of dcp metabolism in edible plants was performed. after petiolar uptake ... | 2006 | 16628540 |
diversity of boll weevil populations in south america: a phylogeographic approach. | a phylogeographic approach was conducted to assess the geographic structure and genetic variation in populations of the boll weevil anthonomus grandis, which is the most harmful insect pest of cotton in the americas. coi and coii mitochondrial gene sequences were analyzed to test a former hypothesis on the origin of the boll weevil in argentina, brazil and paraguay, using samples from mexico and usa as putative source populations. the analysis of variability suggests that populations from south ... | 2006 | 16636929 |
[structural-functional organization of chloroplasts in leaves of xantha-702 mutant of gossypium hirsutum l]. | for cotton mutant xantha (gossypium hirsutum l.), it has been established that synthesis of 5-aminolevulinic acid was blocked in the light. in the light this mutant accumulates chlorophyll by 30 times lower as compared to the parent type. in mutant xantha, a very few pigment-protein complexes of ps-i and ps-ii are formed in chloroplasts, and formation of membrane system in these is blocked at the early stages, in most cases, at the stage of bubbles and single short thylakoids. functional activit ... | 2006 | 17087145 |
[cloning of ghaqp1 gene and its specific expression during ovule development in cotton]. | plant aquaporins, belonging to the mip superfamily, are a series of transmembrane proteins that facilitate water transport through cell membranes. in this study, a cdna clone encoding the pip1-like protein was isolated from cotton (gossypium hirsutum) cdna libraries, and designated as ghaqp1 (fig.1). we also isolated the ghaqp1 gene from cotton genome by pcr. the gene is 2,096 bp in length, including an open reading frame (orf) and 5'-/3'-untranslated regions (utr). it contains two introns in it ... | 2006 | 17075177 |
developmental and gene expression analyses of a cotton naked seed mutant. | cotton fiber development is a fundamental biological phenomenon, yet the molecular basis of fiber cell initiation is poorly understood. we examined molecular and cellular events of fiber cell development in the naked seed mutant (n1n1) and its isogenic line of cotton (gossypium hirsutum l. cv. texas marker-1, tm-1). the dominant mutation not only delayed the process of fiber cell formation and elongation but also reduced the total number of fiber cells, resulting in sparsely distributed short fi ... | 2006 | 16254724 |
a rapid single-step multiplex method for discriminating between trichogramma (hymenoptera: trichogrammatidae) species in australia. | inaccurate species identification confounds insect ecological studies. examining aspects of trichogramma ecology pertinent to the novel insect resistance management strategy for future transgenic cotton, gossypium hirsutum l., production in the ord river irrigation area (oria) of western australia required accurate differentiation between morphologically similar trichogramma species. established molecular diagnostic methods for trichogramma identification use species-specific sequence difference ... | 2006 | 17195685 |
xenia effect on seed and embryo size in cotton (gossypium hirsutum l.). | the term xenia was coined to describe the effect of foreign pollen on the development and characters of the seed. to study its importance and consequences for various seed traits in cotton (gossypium hirsutum l.), the effect of pollen genotype on seed and embryo weight was studied with seeds from 15 f1 hybrids. cross-fertilization changed seed weight by up to 7.0% in relation to self-fertilization. xenia effect significantly increased embryo weight of cross-fertilized seeds, by up to 14.4% in co ... | 2006 | 17132897 |
broiler litter as a micronutrient source for cotton: concentrations in plant parts. | analytically, poultry litter contains nearly all essential micronutrients but the extent of phytoavailability of these nutrients and whether cotton (gossypium hirsutum l.) and other crop plants can receive adequate amounts of these nutrients from litter is not fully known. the objective of this research was to determine whether cotton receives sufficient amounts of fe, cu, mn, and zn from litter and estimate the efficiency of cotton in extracting these metal nutrients from litter in the absence ... | 2006 | 16091623 |
isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (gossypium hirsutum l.). | due to the important role of cotton drought-tolerant varieties and the reported involvement in this trait of trehalose-6-phosphate-synthase, the respective gene (tps) was isolated and characterized from cultivated cotton, gossypium hirsutum (zeta 2 cultivar), using a chromosome-walking technique. tps has three exons comprising the coding region. southern blot analysis indicated that the gossypium genomes (a and d) contain a single copy of tps per genome. in addition, the expression of this gene ... | 2006 | 16086175 |
agricultural dust production in standard and conservation tillage systems in the san joaquin valley. | the negative health effects of repeated dust exposure have been well documented. in california's san joaquin valley, agricultural operations may contribute substantially to airborne particulates. we evaluated four management systems to assess impacts on dust production and soil properties for a cotton (gossypium hirsutum l.)-tomato (lycopersicon esculentum mill.) rotation: standard tillage with (stcc) and without (stno) cover crop, and conservation tillage with (ctcc) and without (ctno) cover cr ... | 2006 | 15998847 |
cotton defoliant runoff as a function of active ingredient and tillage. | cotton (gossypium hirsutum l.) defoliant runoff was recently identified as an ecological risk. however, assessments are not supported by field studies. runoff potential of three defoliant active ingredients, dimethipin (2,3-dihydro-5,6-dimethyl-1,4-dithiin 1,1,4,4-tetraoxide), thidiazuron (n-phenyl-n-1,2,3-thidiazol-5-yl-urea), and tribufos (s,s,s-tributyl phosphorotrithioate) was investigated by rainfall simulation on strip (st) and conventionally tilled (ct) cotton in south central georgia. si ... | 2006 | 14674540 |
[nucleotide sequence of internal transcribed spacers and 5.8s rdna for the ribosomal operon from alfalfa medicago sativa and cotton gossypium hirsutum l]. | the 708- and 769-bp fragments from alfalfa and cotton containing the 3'-end of the 18s gene, the internal transcribed spacer. 1 (its1) the 5.8s gene, its2, and the 5'-end of the 28s gene were obtained using primers to the 18s and 28s ends of rdna from tomato by a polymerase chain reaction. these sequences were cloned into ptz19r. the 5.8s rdna, its1 and its2 nucleotide sequences of alfalfa and cotton were determined. comparative analysis of nucleotide sequences of alfalfa and cotton showed large ... | 2006 | 8145750 |
sts markers linked to the rf1 fertility restorer gene of cotton. | marker-assisted selection (mas) can accelerate the process of plant breeding, and sequence-tagged site (sts) markers are highly specific for regions of dna being used for mas. the objective of this research was to develop sts markers tightly linked with rf1, the fertility restoring gene for cytoplasmic male sterility (cms) in cotton (gossypium hirsutum l.). bulked segregant analysis was employed to screen for rf1-linked rapd markers in a backcross population. four rapd markers were identified, t ... | 2005 | 15592810 |
confirmation and quantification of strigolactones, germination stimulants for root parasitic plants striga and orobanche, produced by cotton. | the germination stimulants for root parasitic plants striga and orobanche produced by cotton (gossypium hirsutum l.) were examined in detail. seeds of cotton were germinated and grown on glass wool wetted with sterile distilled water in sterile filter units. the root exudate was collected daily and extracted with ethyl acetate. each of these ethyl acetate extracts was analyzed directly by high-performance liquid chromatography linked with tandem mass spectrometry (lc/ms/ms). the results demonstr ... | 2005 | 15665473 |
effects of farmyard manure and fertilizers on yield, fibre quality and nutrient balance of rainfed cotton (gossypium hirsutum). | two-year field experiments were conducted to evaluate the effect of fertilizer with or without farmyard manure (fym) application on cotton productivity and fibre quality. a partial nutrient balance was calculated by the difference method (nutrient applied--crop removal). seed cotton yield was improved with addition of fym (5 mg ha(-1)). application of both n and p resulted in significant improvements in seed cotton yield than the control and without n plots (pk). uniformity ratio and ginning out ... | 2005 | 15474936 |
molecular dissection of interspecific variation between gossypium hirsutum and g. barbadense (cotton) by a backcross-self approach: ii. fiber fineness. | a backcross-self population from a cross between gossypium hirsutum and g. barbadense was used to dissect the molecular basis of genetic variation governing two parameters reflecting lint fiber fineness and to compare the precision of these two measurements. by applying a detailed restriction fragment length polymorphism (rflp) map to 3,662 bc(3)f(2) plants from 24 independently derived bc(3) families, we were able to detect 32 and nine quantitative trait loci (qtls) for fiber fineness and micro ... | 2005 | 15995865 |
okra-leaf accessions of the upland cotton (gossypium hirsutum l.): genetic variability in agronomic and fibre traits. | okra-leaf types of the upland cotton have the potential to be competitive to the normal-leaf types in yield and fibre quality, in addition to its potential resistance to insect pests and drought. okra-leaf cotton accessions, collected at cotton research institute, faisalabad, pakistan, were evaluated in respect of genetic variance and relative performance in half- and full-sib crosses (combining ability) for 2 years. variation due to parents x years interaction was significant for lint percentag ... | 2005 | 15977325 |
successive chromosome walking by compatible ends ligation inverse pcr. | here we describe an advanced polymerase chain reaction (pcr) technique, the compatible ends ligation inverse pcr (celi-pcr) for chromosome walking. in celi-pcr, several restriction enzymes, which produce compatible cohesive ends, were used to digest target dna simultaneously or sequentially to produce dna fragments of suitable size. dna fragments were then easily circularized and pcr amplification could be carried out efficiently. the previous limitations of inverse pcr were overcome, such as un ... | 2005 | 15920279 |
systemic induction of volatile release in cotton: how specific is the signal to herbivory? | plants attacked by herbivorous insects release chemical signals that attract natural enemies of the herbivores to the damaged plants. feeding of spodoptera exigua larvae on the lower leaves of cotton (gossypium hirsutum l.) for multiple feeding periods of 9-12 h with a 12 h, interval in between when the caterpillars are removed overnight, will induce a systemic release of volatile compounds that is comparable to the volatiles released in response to continuous feeding damage on the lower leaves ... | 2005 | 15856281 |
[cloning and expression analysis of two rac genes from cotton (gossypium hirsutum l.)]. | plant rac proteins belong to an important group of signal switches anchoring on membranes, involved in various physiological processes including cell polar growth, synthesis of secondary wall, resistance response and hormone signaling. in the attempt to elucidate the molecular mechanism of initiation and elongation of cotton fiber, two cotton rac protein genes, designated as ghraca and ghracb, were amplified from elongating fibers and cloned. it was demonstrated that, the cdna of ghraca containe ... | 2005 | 15715441 |
the delayed initiation and slow elongation of fuzz-like short fibre cells in relation to altered patterns of sucrose synthase expression and plasmodesmata gating in a lintless mutant of cotton. | cotton (gossypium hirsutum l.) seed develops single-celled long fibres (lint) from the seed-coat epidermis at anthesis. previous studies have shown that the initiation and rapid elongation of these fibres requires the expression of sucrose synthase (sus) and, potentially, a transient closure of plasmodesmata. this study extends the previous work to examine the patterns of sus expression and plasmodesmata gating in fuzz-like short fibres of a mutant that shows delayed initiation and much slower a ... | 2005 | 15710635 |
genetic mapping of a cross between gossypium hirsutum (cotton) and the hawaiian endemic, gossypium tomentosum. | the existence of five tetraploid species that derive from a common polyploidization event about 1 million years ago makes gossypium (cotton) an attractive genus in which to study polyploid evolution and offers opportunities for crop improvement through introgression. to date, only crosses (hb) between the cultivated tetraploid cottons gossypium hirsutum and g. barbadense have been genetically mapped. genetic analysis of a cross (ht) between g. hirsutum and the hawaiian endemic g. tomentosum is r ... | 2005 | 16044266 |
activity of selected neonicotinoids and dicrotophos on nontarget arthropods in cotton: implications in insect management. | certain neonicotinoids are used in cotton, gossypium hirsutum (l.), to control various piercing-sucking pests. we conducted field studies using three neonicotinoids (acetamiprid, thiamethoxam, and imidacloprid) and an organophosphate (dicrotophos) to assess the activity of these insecticides against nontarget arthropods, particularly predators, and to determine the potential economic consequences of such activity. mortality among populations of the big-eyed bug, geocoris punctipes (say), and the ... | 2005 | 16022310 |
cycloheximide treatment of cotton ovules alters the abundance of specific classes of mrnas and generates novel ests for microarray expression profiling. | fibres of cotton (gossypium hirsutum l.) are single elongated epidermal cells that start to develop on the outer surface of cotton ovules on the day of anthesis. little is known about the control of fibre initiation and development. as a first step towards discovering important genes involved in fibre initiation and development using a genomics approach, we report technical advances aimed at reducing redundancy and increasing coverage for anonymous cdna microarrays in this study. cotton ovule cd ... | 2005 | 16208490 |
carbon source dependent somatic embryogenesis and plant regeneration in cotton, gossypium hirsutum l. cv. svpr2 through suspension cultures. | highly reproducible and simple protocol for cotton somatic embryogenesis is described here by using different concentrations of maltose, glucose, sucrose and fructose. maltose (30 g/l) is the best carbon source for embryogenic callus induction and glucose (30 g/l) was suitable for induction, maturation of embryoids and plant regeneration. creamy white embryogenic calli of hypocotyl explants were formed on medium containing ms basal salts, myo-inositol (100 mg/l), thiamine hci (0.3 mg/l), piclora ... | 2005 | 16235728 |
[spontaneous and induced programmed cell death in suspension cell cultures of cotton (gossypium hirsutum l.)]. | cotton suspension cells grew well in the ms medium supplemented with 0.1 mg/l 2,4 d and 0.1 mg/l kt. senescence occurred when the cells were unsubcultured. the cells began to lose their viabilities on the 17th day, and on the 21th day oligonucleosomal sized dna fragments ( dna ladder) could be detected. oligonucleosomal sized dna fragments ( dna ladder) was the hallmark of the programmed cell death. programmed cell death of cotton suspension cells could be induced respectively by some stress fac ... | 2005 | 16231696 |
toxicity to cotton boll weevil anthonomus grandis of a trypsin inhibitor from chickpea seeds. | cotton (gossypium hirsutum l.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil anthonomus grandis. adult a. grandis feed on fruits and leaf petioles, reducing drastically the crop production. the predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. the present study describes a novel proteinase inhibitor from chickpea ... | 2005 | 15649779 |
comparative study on biological parameters of bemisia tabaci (genn.) collected on four host plants from varamin-iran. | during 2003 biological parameters of sweetpotato whitefly, b. tabaci (genn.) (horn. aleyrodidae) as a major pest of field crops, vegetables and ornamentals were studied. in this study, the infested leaves of cucumber (cucumis sativus l.) zucchini (cucurbita pepo l.) eggplant (solanum melongena l.) and cotton (gossypium hirsutum l.) with whitefly nymphs and pupae were collected from varamin-iran, and were transferred to the laboratory. the newly emerged males and females of each population were r ... | 2005 | 16628901 |
function analysis of promoter trapping system after inserted into cotton (gossypium hirsutum l. ) genome. | the technique of promoter trapping was developed to investigate its viability in cotton ( gossypium hirsutum l.) functional genomics. 141 independent transformants of cotton were generated via agrobacterium tumefaciens mediated transformation, of which 97% showed positive by pcr detection. the reporter, gus gene, was expressed to different extent in different organs, with a frequency of 48% in roots, 9.2% in vascular bundles of stem, 5.2% in leaves, and 51% in flowers. meanwhile, we discovered t ... | 2005 | 16459655 |
proactive spraying against boll weevils (coleoptera: curculionidae) reduces insecticide applications and increases cotton yield and economic return. | the current standard practice of two to three preemptive insecticide applications at the start of pinhead (1-2-mm-diameter) squaring followed by threshold-triggered (whenever 10% of randomly selected squares have oviposition punctures) insecticide applications for boll weevil, anthonomus grandis grandis boheman, control does not provide a reliably positive impact on cotton, gossypium hirsutum l., yields in subtropical conditions. this study showed that four fewer spray applications in a "proacti ... | 2005 | 16539122 |