Publications

TitleAbstractYear(sorted ascending)
Filter
PMID
Filter
effects of beauveria bassiana on survival, blood-feeding success, and fecundity of aedes aegypti in laboratory and semi-field conditions.the fungus beauveria bassiana reduces aedes aegypti longevity in laboratory conditions, but effects on survival, blood-feeding behavior, and fecundity in realistic environmental conditions have not been tested. adult, female ae. aegypti infected with b. bassiana (fi-277) were monitored for blood-feeding success and fecundity in the laboratory. fungal infection reduced mosquito-human contact by 30%. fecundity was reduced by (mean ± sd) 29.3 ± 8.6 eggs per female per lifetime in the laboratory; eg ...022492151
expression of a toll signaling regulator serpin in a mycoinsecticide for increased virulence.serpins are ubiquitously distributed serine protease inhibitors that covalently bind to target proteases to exert their activities. serpins regulate a wide range of activities, particularly those in which protease-mediated cascades are active. the drosophila melanogaster serpin spn43ac negatively controls the toll pathway that is activated in response to fungal infection. the entomopathogenic fungus beauveria bassiana offers an environmentally friendly alternative to chemical pesticides for inse ...024837378
[research on the chitinase action of the insectkilling fungus, beauveria bassiana (bals.) vuill]. 196113693944
[on simultaneous effects of the fungus beauveria bassiana (bals.) vuill. and small doses of ddt on lipronatarsa decemlineata say larvae]. 196414220979
microbial transformations of steroids. xxv. the effect of substituents on the direction of the transformation of steroids by beauveria bassiana. 19665916363
biosynthesis of oosporein in beauveria bassiana (bals.) vuill. 19666006742
the effect of certain insecticides on the entomogenous fungi beauveria bassiana and metarrhizium anisopliae. 19676064157
field and laboratory studies on the pathogenicity of the fungus beauveria bassiana to three genera of mosquitoes. 19685654770
infection of the alfalfa weevil, hypera postica, by the fungus beauveria bassiana. 19685654771
toxins of the entomophagous fungus beauveria bassiana. 19685752486
phenol oxidase activity in the integument of the silkworm bombyx mori infected with beauveria bassiana and spicaria fumoso-rosea. 19704993487
[mass culture of the insect pathogen fungus beauveria bassiana (bals) vuill]. 19705531111
[toxins of the entomophagous fungus beauveria bassiana. ii. effect of nitrogen sources on formation of the toxic protease in submerged culture]. 19714930316
[the effect of aeration on the development of the entomopathogenic fungus beauveria bassiana (bals) vuill. in submerged cultures]. 19725077290
[effect of the medium ph on the growth and virulence of beauveria bassiana (bals.) vuill]. 19724676998
[enzymic character of toxic substances released by the entomophagous fungus beauveria bassiana and their stimulation of their production]. 19734740802
genetics and selection of the entemopathogenic fungus beauveria bassiana (bals.) vuill. communication i. lethal and mutagenic effects of ultraviolet and x-rays. 19734807847
[genetics and selection of the entomopathogenic fungus beauveria bassiana (bals.) vuill. ii. virulence of auxotrophic mutants of beauveria bassiana on drosophila melanogaster]. 19734219928
[biochemical features of four strains of the fungus beauveria bassiana]. 19744478020
[drosophila and the entomopathogenic fungus beauveria bassiana as a model for the study of host and parasite interrelationships]. 1975810991
defensive reactions of l3, l4 larvae of the colorado beetle to the insecticidal fungi paecilomyces farinosus (dicks) brown et smith, paecilomyces fumoso--roseus (wize), beauveria bassiana (bols/vuill.) (fungi imperfecti: moniliales). 19751238153
the degradation of the cuticle proteins of greater wax moth larvae (galleria mellonella) by toxic proteolytic enzymes, secreted by the entomophagous fungus beauveria bassiana (author's transl). 19768934
a mechanism of pathogenicity of beauveria bassiana on larvae of the imported fire ant, solenopsis richteri. 1976932482
age of three dipteran hosts as a factor governing the pathogenicity of beauveria bassiana and metarrhizium anisopliae. 1977908836
cyclodepsipeptides from beauveria bassiana bals. part 1. beauverolides h and i. 1977557053
[sedimentation of the conidia of beauveria bassiana (bals) vuill by aluminum sulfate]. 1977559230
use of 13c in biosynthetic studies. the labelling pattern in tenellin enriched from isotope-labelled acetate, methionine, and phenylalanine.the biogenetic origin of the carbon atoms in tenellin has been established by adding 13c-enriched compounds to cultures of beauveria bassiana, and determining the isotopic distribution in the metabolite by 13c nuclear magnetic resonance spectrometry. tenellin is formed by condensation of an acetate-derived polyketide chain with a phenylpropanoid unit that may be phenylalanine. alternate carbon atoms of the polyketide chain were labelled with sodium [1(-13c)]- and [2-(13c]-acetate; sodium [1,2-(1 ...1977560900
[influence of clay on microorganisms conservation. i. ultrastructural study of the biodegradation of beauveria bassiana (bals). vuill. (entomopathogenous hyphomycete) in soil (author's transl)].blastospores of b. bassiana enclosed in fine mesh bags were submitted to soil microflora. clay minerals coating fungal spores protected from by decreasing bacterial activity. the role of amoeba in biodegradation of fungi is also considered.1977563207
[nature of the parasite-host relations of the entomopathogenic fungi, metarrhizium anisopliae (metsch.) sorokin and beauveria bassiana (bals.) vouill. (fungi imperfecti) to ceratophyllus fasciatus bosc. (siphonaptera) fleas]. 1978567273
noninvolvement of beauvericin in the entomopathogenicity of beauveria bassiana.development of a microbiological autobiographic assay procedure permitted a detailed investigation of the possible role of beauvericin (a toxic ionophoric antibiotic produced by beauveria bassiana) in the entomopathogenicity of b. bassiana against corn earworm (heliothis zea) larvae. analysis of spent media of b. bassiana and the hemolymph of infected and moribund larvae revealed that beauvericin was not present in a soluble form during the time that most (about 90%) larvae died of fungal infect ...1979573587
crude oil utilization by fungi.sixty fungal isolates, 34 obtained by a static enrichment technique from soils of northern canadian oil-producing areas and 26 from culture collections, were screened for their ability to grow on n-tetradecane, toluene, naphthalene, and seven crude oils of varying composition. forty cultures, including 28 soil isolates, were capable of growth on one or more crude oils. the genera most frequently isolated from soils were those producing abundant small condida, e.g. penicillium and verticillium sp ...1979436012
fatal mycotic pulmonary disease of captive american alligators.fatal pulmonary disease occurred in two captive american alligators. the entomopathogenic fungus, beauveria bassiana, was isolated from pulmonary lesions in both alligators. an extended hibernation period because of a severe winter and a failure of the zoo heating system may have predisposed the alligators to infection.1979452316
fatal beauveria bassiana infection in a captive american alligator.the entomopathogenic fungus, beauveria bassiana, was isolated from pulmonary lesions of a dead american alligator (alligator mississipiensis) at the oklahoma city zoo. colonies of the fungus, which had sporulated in vivo, were found in the thoracic air spaces. septate, branching hyphae and fungal spores were seen in stained histologic sections of pleura and lung. dissemination to other viscera had not occurred. this case indicated that b bassiana, a rare vertebrate pathogen, may be a fatal mycot ...1979521377
investigation of the safety of industrial strains of microorganisms and microbial insecticides.toxicology-hygienic studies of insecticidal preparations produced on the basis of fungi of the species beauveria bassiana and bacteria of the species bac. thuringiensis, recommended for use in plant-growing, were carried out. it has been established that the industrial strains of entomopathogenic microorganisms and insecticidal preparations produced on the basis of these microorganisms are harmless in the epidemiological sense and of low toxicity, but they may have a sensitizing effect on the hu ...19807462611
[studies on the pathogenesis of beauveria bassiana (author's transl)]. 19817341103
inhibitory effect of bassianolide, a cyclodepsipeptide, on drug-induced contractions of isolated smooth muscle preparations.bassianolide (bass) is a cyclodepsipeptide isolated from cultured mycelia of beauveria bassiana and is pathogenic to insects. in a longitudinal muscle preparation from guinea pig ileum, 10(-6) m bass almost irreversibly inhibited an isotonic contraction induced by acetylcholine (ach) and made the dose-response curve shift in parallel to the right (pa2: 7.6). it also inhibited the contractions induced by carbachol, pilocarpine, histamine, 5-hydroxytriptamine (5-ht) and prostaglandin e2, but did n ...19826953262
antibacterial and antimycotic effect of a newly discovered secretion from larvae of an endoparasitic insect, pimpla turionellae l. (hym.).the larvae of pimpla turionellae, that develop in pupae of various lepidoptera, discharged through their anus up to 8 microliters/h of a hyaline liquid, which is termed "anal secretion". it exerted a strong bacteriostatic effect on enterobacter cloacae, a highly virulent intestinal microorganism isolated from the midgut of the host pupa, pieris brassicae. growth inhibition of escherichia coli, micrococcus luteus and pseudomonas phaseolicola was also evident, but less pronounced. inhibition depen ...19827171286
cell-free synthesis of the depsipeptide beauvericin.the enzymatic formation of the cyclodepsipeptide beauvericin was demonstrated in cell-free extracts from beauveria bassiana. in analogy to the enniatin synthetase system formation of beauvericin is strictly dependent on the presence of the constituent amino and hydroxy acid, s-adenosylmethionine, and atp/mg2+. synthesizing activity could be enriched about 12-fold by fractional ammonium sulfate precipitation. besides the enniatin synthetase system this represents another example of the cell-free ...19836686599
[submerged culture of the fungus beauveria bassiana]. 19836228339
hemocyte lysate enhancement of fungal spore encapsulation by crayfish hemocytes.crayfish hemocytes exhibited a stronger encapsulation reaction to fungal blastospores of beauveria bassiana coated with hemocyte lysate, than to blastospores treated with plasma or buffer, indicating an opsonic function of hemocyte lysate proteins. five proteins of the prophenoloxidase activating system in the hemocytes were attached to foreign surfaces (including the blastospores) after activation and it is suggested that these attaching proteins (one being phenoloxidase) are responsible for th ...19846427033
effect of soil fungistasis on zoopathogenic fungi.the inhibiting action of west-siberian soils on spore germination and the growth and development of zoopathogenic fungi such as emmonsia (chrysosporium) crescens , trichophyton mentagrophytes, beauveria bassiana , metarrhizium anisopliae , paecilomyces farinosus , p. fumoso -roseus and chrysosporium keratinophilum have been studied by the authors. the influence of carbon sources and the root exudates of plants on fungistasis have also been studied.19846727979
sensitivity of the entomogenous fungus beauveria bassiana to selected plant growth regulators and spray additives.mefluidide was the only one of four plant growth regulators that caused little to no significant inhibition of in vitro germination and growth of the entomogenous fungus beauveria bassiana. silaid, paclobutrazol, and flurprimidol significantly inhibited germination and growth. mortality of fall armyworm, spodoptera frugiperda, resulting from b. bassiana was significantly reduced when larvae were exposed to conidia plus soil treated with paclobutrazol. larval mortality resulting from conidia plus ...198616347095
purification and properties of an extracellular protease produced by the entomopathogenic fungus beauveria bassiana.beauveria bassiana gk2016 grown in a medium with gelatin as the sole carbon and nitrogen source produced an extracellular protease. the protease production was highest when the fungus was grown on a semiliquid medium and was purified about 18-fold, with a recovery of 21%. the protease molecular weight was estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis to be about 35,000. it had an optimum activity at ph 8.5 and 37 degrees c and was rapidly inactivated at 50 degrees c. its ...198716347395
[method of biological control of triatominae, vectors of chagas disease, using entomopathogenic hyphomycetes. preliminary study].bioassays determined the pathogenic activity of 14 strains of 5 entomopathogenic hyphomycetous species (fungi imperfecti), beauveria bassiana, beauveria brongniartii, metarhizium anisopliae, nomuraea rileyi and paecilomyces fumosoroseus to rhodnius prolixus. treatments consisted of direct spraying with conidial titrated suspensions on first instar larvae. when tested at 3 x 10(5) conidia/cm2, only 2 strains, b. bassiana n. 297 and b. bassiana n. 326 killed 100% of larvae at 10 days post-exposure ...19873111731
the pathogenicity of beauveria bassiana in the rabbit cornea. 19873295537
distribution of chymoelastases and trypsin-like enzymes in five species of entomopathogenic deuteromycetes.nine isolates of the entomopathogenic deuteromycetes metarhizium anisopliae, beauveria bassiana, verticillium lecanii, nomuraea rileyi, and aschersonia aleyrodis produced basic (pi greater than 7.0) chymoelastases that possessed extended binding sites, comprising at least four or five subsites, with preference for hydrophobic residues at the primary binding site. most isolates also produced additional acidic enzymes with similar specificities against ester and amide substrates but which lacked a ...19873310895
microbial transformation studies on arteannuin b.the microbial transformation of the sesquiterpene lactone arreannuin b [3] using aspergillus flavipes produced dihydroarteannuin b [4] as the main transformation product. preparative-scale fermentation of 3 with beauveria bassiana, on the other hand, has resulted in the production of two metabolites, 3 beta-hydroxyarteannuin b [5] and 13-hydroxy-11-epi-dihydroarteannuin b [6]. the structure of these metabolites, all of which are new compounds, was established using chemical and spectroscopic tec ...19873437286
microbial transformation of azacarbazoles. ix. preliminary studies on hydroxylation of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline by paecilomyces flavinosus.microbial transformation of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline performed with several strains of fungi beauveria bassiana, verticillum lecani and paecilomyces flavinosus yielded common products which were expected to be hydroxylated derivatives of starting compound. among the microorganisms tested, strain paecilomyces flavinosus p-5 was selected to perform quantitative bioconversion of 2,3-benzo-1,4-dimethyl-alpha-iso-carboline for preparative scale.19873447531
synthesis of beauvericin by a multifunctional enzyme.beauvericin synthetase, a multifunctional enzyme catalyzing depsipeptide formation in beauveria bassiana was purified to near homogeneity. the enzyme consists of a single polypeptide chain with a molecular mass of about 250 kdaltons. the mechanism of beauvericin formation is very similar to that of the cyclohexadepsipeptide enniatin. the constituents of the beauvericin molecule, l-phenylalanine and d-alpha-hydroxyisovaleric acid are activated as thioesters via the corresponding adenylates. n-met ...19883366693
[effect of entomopathogenic fungus inoculum on the control of corythycha ciliata say adults, wintering on plane-trees of city groves].within a three years research program, infection tests were carried on adults of corythucha ciliata wintering on the plane-trees of same city avenues, inoculating entomopathogenic deuteromycetes beauveria bassiana, verticillium lecanii, paecilomyces farinsus, microorganisms which are known to be naturally present in such an environment. inoculated fungi were able to settle only where the trees were free from any kind of disturbance, while this failed to occur in the areas of intense car traffic. ...19883274763
nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle.the attachment of the conidia of the insect-pathogenic fungi nomuraea rileyi, beauveria bassiana, and metarrhizium anisopliae to insect cuticle was mediated by strong binding forces. the attachment was passive and nonspecific in that the conidia adhered readily to both host and nonhost cuticle preparations. the hydrophobicity of the conidial wall and the insect epicuticle appeared to mediate the adhesion process. detergents, solvents, and high-molecular-weight proteins known to neutralize hydrop ...198816347689
n-acetyl-d-glucosamine-mediated regulation of extracellular protease in the entomopathogenic fungus beauveria bassiana.the entomopathogenic fungus beauveria bassiana gk2016 grown in a liquid medium incorporating gelatin as the sole carbon and nitrogen source produced an extracellular serine protease (molecular weight, 35,000; pi ca. 10). without gelatin, b. bassiana could utilize n-acetyl-d-glucosamine (glcnac; 2-acetamido-2-deoxy-d-glucose) as the sole source of carbon and nitrogen, and glcnac availability increased the storage carbohydrate content in mycelia. synthesis of protease was repressed in gelatin medi ...198816347772
glossina morsitans morsitans: mortalities caused in adults by experimental infection with entomopathogenic fungi.various strains of the entomopathogenic fungi: beauveria bassiana, metarhizium anisopliae, paecilomyces fumosoroseus and p. farinosus were found to be pathogenic for adult tsetse, glossina morsitans morsitans but b. bassiana and m. anisopliae were the most pathogenic, often causing mortalities of up to 100%. dose-mortality relationships were demonstrated for both b. bassiana and m. anisopliae and male tsetse were observed to be more susceptible to infection than females. pure cultures of b. bass ...19892565071
[experimental study on farmer's lung-like lesions caused by beauveria bassiana].113 lung specimens from rats and mice were observed under both lm and tem, after inhalation of gonidiospores of beauveria bassiana for 18 months 78.8% of the 113 cases developed chronic interstitial pneumonia (ip). there were desquamative pneumonitis mainly with macrophage; granuloma with multinucleate giant cells or fibrosis, and localized pulmonary edema. these lesions were firstly described to be caused by the spores here. it was considered that if lesions might be related to types iii, iv hy ...19892582546
[natural microbial control of crickets populations (orthoptera: gryllotalpidae: scapteriscus borellii): regulation of populations aggregated in time and space].from 1983 through 1988, a total of 1,762 collections, containing 31,312 individuals of the mole cricket, scapteriscus borellii, were made, principally in the state of são paulo, brazil. collections were found to fit a negative binomial distribution both as whole and when divided into monthly collections. in these collections, an iridovirus, a entomogenous nematode, and the fungi metarhizium anisopliae, beauveria bassiana, paecilomyces sp., and entomophtora sp., were found to be agents of natural ...19892640737
larvicidal activity of blastospores and conidiospores of beauveria bassiana (strain gk 2016) against age groups of aedes aegypti.laboratory bioassays of two development stages, blastospores (bs) and conidiospores (cs) of beauveria bassiana (strain gk 2016) against aedes aegypti larvae were conducted at 27 degrees c. in study 1, against 24 h post-hatched larvae, both bs and cs stages showed significant difference in their respective larvicidal efficacy over the control (p less than 0.0001). larval mortality between 24 and 96 h post-exposure was significantly higher than any other time period investigated. significantly hig ...19902251749
carbohydrate storage in the entomopathogenic fungus beauveria bassiana.the entomopathogenic fungus beauveria bassiana was grown in 1% (wt/vol) gelatin-liquid media singly supplemented with a monosaccharide (glucose or fructose), a disaccharide (maltose or trehalose), a polyol (glycerol, mannitol, or sorbitol), or the amino sugar n-acetyl-d-glucosamine. the relative contributions of the carbohydrate, protein, and water contents in the fungal biomass were determined. carbohydrates composed 18 to 42% of the mycelial dry weight, and this value was lowest in unsupplemen ...199016348325
method to enhance growth and sporulation of pelletized biocontrol fungi.the biocontrol fungi trichoderma harzianum, used to control soilborne plant pathogens, and beauveria bassiana, used to control insect pests, were formulated as mycelial biomass in alginate pellets with wheat bran added. after drying for 0, 4, or 16 h, pellets were placed in water or in aqueous solutions of polyethylene glycol (peg) 8000 for 4 to 24 h and then allowed to continue drying. peg-treated pellets containing t. harzianum showed significantly greater proliferation of hyphae in soil than ...199116348562
genomic analysis of a virulent and a less virulent strain of the entomopathogenic fungus beauveria bassiana, using restriction fragment length polymorphisms.the genomic dna of two strains of the entomopathogenic fungus beauveria bassiana, strain gk2016, a "wild type" (virulent), and strain gk2051, a less virulent mutant to grasshoppers, was digested with 12 restriction endonucleases. gel electrophoresis conditions were established to show restriction fragment length patterns visually in the digested dna stained with ethidium bromide. the less virulent mutant was generated by ultraviolet illumination of conidiospores at a 95% lethal dose. both strain ...19911680543
cloning and analysis of five mitochondrial trna-encoding genes from the fungus beauveria bassiana.five mitochondrial (mt) trna genes from the filamentous fungus, beauveria bassiana, were cloned and sequenced. the genes encoding the val-, ile-, ser-, trp- and pro-accepting trnas were found clustered in the region 5' to the lrrna-encoding gene. the genes were 64-77% homologous with the equivalent genes from other filamentous fungi, 49-58% to yeasts with the exception of the val-accepting trna-encoding gene which was 76%, and only slightly homologous with escherichia coli. the b. bassiana mt ge ...19911756976
formation of beauvericin by selected strains of beauveria bassiana.various strains of beauveria bassiana were cultivated in submerged cultures and examined for their abilities to produce beauvericin, cyclodepsipeptide antibiotic displaying antibacterial and insecticidal properties. it has been found that among twenty four strains of beauveria bassiana only three produced beauvericin. apparently, the striking differences among tested strains concerning several secondary product formations have been observed.19911804050
production of beauvericin by beauveria bassiana on l-methionine enriched medium.beauveria bassiana strain isolated from curculionid beetle (coleoptera) was cultivated in fermentation tank on the medium composed of protein hydrolysate and glucose. it has been found that l-methionine addition to the medium increases significantly the yield of beauvericin biosynthesis. apparently, for the optimal antibiotic production, low aeration conditions are preferable.19911804051
novel metabolite structures from biotransformation of a sesquiterpenoid ketone by selected fungal strains.the sesquiterpenoid ketone, 1,4,4-trimethyltricyclo[5.4.0.0(3.5)]undec-7-en-9-one (1), was subjected to microbial transformation by six fungal strains: aspergillus niger atcc 9142, aspergillus ochraceus dsm 824, beauveria bassiana atcc 7159, cunninghamella echinulata atcc 9244, rhizopus arrhizus atcc 11.145, and absidia blakesleeana atcc 10.148. four main metabolites were formed from 1: 10(r)- and 10(s)-hydroxy-1,4,4-trimethyltricyclo-[5.4.0.0(3.5)]undec-7- en- 9-one (2 and 3, respectively), bes ...19911872996
rrna sequence comparison of beauveria bassiana, tolypocladium cylindrosporum, and tolypocladium extinguens.five strains of tolypocladium cylindrosporum, one strain of tolypocladium extinguens, and nine strains of beauveria bassiana were analyzed using a rapid rrna sequencing technique. the sequences of two highly variable domains (d1 and d2) located at the 5' end of the 28s-like rrna molecule were determined. the phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus beauveria and the genus tolypocladium and points out that t. cylindrospor ...19912002243
parentally provided alkaloid does not protect eggs ofutetheisa ornatrix (lepidoptera: arctiidae) against entomopathogenic fungi.eggs ofutetheisa ornatrix proved equally vulnerable to fungal infection (beauveria bassiana, paecilomyces lilacinus) whether they contained parentally provided pyrrolizidine alkaloid (monocrotaline) or were free of such alkaloid. in in vitro tests, monocrotaline, either as free base or n-oxide, had no inhibiting effect on fungal cultures.199124258914
hemagglutinins of beauveria bassiana strains: the effect of growth conditions on their production.forty strains of beauveria bassiana were screened for their ability to produce hemagglutinins. it has been found that majority of mycelial extracts but not cultural broth display non specific hemagglutinating activity toward animal and human type ab and a, b, o erythrocytes when microorganisms are cultivated on rich in amino acids media supplemented with saccharose. the formation of hemagglutinins in mycelia is strongly dependent on composition of medium and associated with a production of extra ...19921340188
purification and some properties of hemagglutinin from beauveria bassiana.a novel hemagglutinin produced by insect pathogen beauveria bassiana was isolated from mycelium of the stationary growing microorganism and purified by adsorption on carboxymethyl cellulose followed by separation on spherogel tsk--phenyl 5 pw column using high performance liquid chromatography. the purified hemagglutinin was homogeneous in polyacrylamide gel electrophoresis and isoelectric focusing. its molecular weight was estimated to be around 25,000, isoelectric point was found at ph 8.6 +/- ...19921340189
relative susceptibility of different stages of rhodnius prolixus to the entomopathogenic hyphomycete beauveria bassiana.laboratory bioassays were conducted to determine the relative susceptibility of eggs, 1st-, 3rd-, 5th-instar nymphs and adults of rhodnius prolixus to one isolate of the entomopathogenic hyphomycete, beauveria bassiana. treatments consisted of directly spraying on insects of increasing doses of inoculum (3 x 10(2) to 3 x 10(5) conidia per cm2). mortality due to all doses of conidia was very high in the five tested stages of the target insect. experiments on eggs demonstrated that the fungal isol ...19921343645
use of a colorimetric system to detect enzymes expressed by germinating conidia of entomopathogenic fungi.an apizym system, with 19 substrates, was used to detect enzymes expressed by germinating conidia of nomuraea rileyi (5 isolates), nomuraea atypicola, nomuraea anemonoides, beauveria bassiana and metarhizium anisopliae. similar enzyme profiles were obtained for two of the n. rileyi isolates (mississippi, ecuador) regardless of whether culture medium (sabouraud-maltose-yeast) or cuticle (from larvae of trichoplusia ni, heliothis zea or heliothis virescens) were used as substrates. centroid-cluste ...19921406899
effects of beauveria bassiana on embryos of the inland silverside fish (menidia beryllina).a chemical toxicity and teratogenicity test was adapted to assess potential adverse effects of a microbial pest control agent on a nontarget fish. developing embryos of the inland silverside, menidia beryllina, were exposed to conidiospores of the insect-pathogenic fungus beauveria bassiana. embryo rupture and death were observed. embryo rupture did not always result in death, nor was death always associated with embryo rupture. adherence of spores to the chorion, followed by germination and pen ...19921444395
pathogenicity of beauveria bassiana in mice.the potential pathogenicity of beauveria bassiana was examined by intramuscular injection of high (2 x 10(8)) or low (2 x 10(5)) concentrations of conidia spores, into the left or right quadriceps muscles of cd-1 mice, respectively. the injection sites were monitored over a period of 28 days by both microbiological and histopathological methods. focal muscle necrosis, edema and inflammation occurred rapidly (within 12 hours) at the high dose application (2 x 10(8)) site, but such lesions were fa ...19921621478
metabolism of xenobiotics by beauveria bassiana.1. diazepam, warfarin and testosterone were metabolized by whole resting cells of the fungus beauveria bassiana imi 12939 via oxidative reactions such as hydroxylation and n-demethylation. 2. metabolism of each substrate was inhibited by the cytochrome p450 inhibitors skf-525a and metyrapone, consistent with the involvement of this enzyme system in the metabolism of these drugs by b. bassiana. 3. substrate concentration-dependent inhibition was observed during diazepam metabolism by this organis ...19938259691
evasion of host defense by in vivo-produced protoplast-like cells of the insect mycopathogen beauveria bassiana.in vivo cells (hyphal bodies) of the hyphomycetous insect pathogen beauveria bassiana collected from host spodoptera exigua larval hemolymph were osmotically sensitive and lacked a well-defined cell wall. in light and electron microscope studies, a galactose-specific lectin purified from s. exigua hemolymph, concanavalin a (specific for alpha-mannose), and a polyclonal antibody to b. bassiana cell walls all bound to surfaces of in vitro-produced b. bassiana blastospores; however, none of these p ...19938376342
the mitochondrial genome of the entomopathogenic fungus beauveria bassiana: analysis of the ribosomal rna region.the 28.5-kbp mitochondrial (mt) genome from the entomopathogenic fungus beauveria bassiana was studied using restriction enzyme analysis, gene probe hybridization, and dna sequence comparisons. a detailed restriction enzyme map allowed cloning of the entire genome into a number of segments. hybridization of heterologous gene probes to the mtdna resulted in the identification of the large ribosomal rna (lrrna) and small ribosomal rna (srrna) genes. gene probes derived from several yeasts and fung ...19938439871
partial purification and characterization of two extracellular n-acetyl-d-glucosaminidases produced by the entomopathogenic fungus beauveria bassiana.beauveria bassiana grown in a liquid medium containing n-acetyl-d-glucosamine and colloidal chitin produced two distinct n-acetyl-d-glucosaminidases, nagase 1 and nagase 2. nagase 1 had a molecular weight of 97,000 and nagase 2 was comprised of two subunits, of molecular weights 64,000 and 66,000. the optimal temperature and ph for nagase 1 were 57 degrees c and ph 5 and for nagase 2 they were 37 degrees c and ph 5. nagase 1 was more thermostable than nagase 2. the isolectric points of nagase 1 ...19938439872
regulation of extracellular n-acetyl-d-glucosaminidase production in the entomopathogenic fungus beauveria bassiana.the entomopathogenic fungus beauveria bassiana produces two extracellular n-acetylglucosaminidases (nagase) in liquid medium containing colloidal chitin as the sole source of carbon and nitrogen. to study the regulation of nagase synthesis, n-acetyl-d-glucosamine (glcnac), glucose nh4no3, or amino acids were added to the colloidal chitin medium and nagase activity was measured. nagase synthesis was (i) induced with glcnac, and no repression was observed with glcnac provided at 2% (w/v); (ii) rep ...19938439875
comparative efficacies of soft contact lens disinfection systems against a fungal contaminant.the efficacies of five fda-approved soft contact lens disinfecting solutions and heat disinfection were evaluated against the mold, beauveria bassiana. beauveria bassiana is a ubiquitous soil fungus with a demonstrated ability to grow into a soft contact lens matrix. a stock solution of the fungus was prepared and aliquots were added to each of the following disinfection solutions: renu multi-purpose disinfecting solution, opti-free, aosept disinfection/neutralization solution, lens plus oxysept ...19938454840
effect of beauveria bassiana and candida albicans on the cellular defense response of spodoptera exigua.a marked difference in the cellular response of spodoptera exigua was observed when larvae were challenged with the insect mycopathogen beauveria bassiana versus the yeast candida albicans. both fungi were rapidly phagocytized by circulating hemocytes. the relative growth rate of c. albicans as measured by daughter cell formation was partially suppressed, whereas b. bassiana blastospores produced germ tubes at rates equivalent to those under in vitro conditions. limited growth by c. albicans wit ...19938463710
identification of molecular variants in mitochondrial dnas of members of the genera beauveria, verticillium, paecilomyces, tolypocladium, and metarhizium.a set of five mitochondrial (mt) probes derived from a strain of beauveria bassiana was used to evaluate the similarity of mtdnas from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. the probes and genes encoded for (shown in parentheses) were pbbmte2 (nadi, atp6), pbbmte3 (atp6, small rrna [srrna]), pbbmte4 (srrna, co3, nad6), pbbse1 (nad6, trna, large rrna [lrrna]), and pbbxs1 (lrrna). the probes produced identical hybridization patterns in ecori-digested ...199316349124
use of solid state fermentation to produce beauveria bassiana for the biological control of european corn borer.the production process of a new bioinsecticide against european corn borer is described. the entomopathogenic fungus, beauveria bassiana, is cultivated by solid state fermentation (ssf). the culture support chosen, clay microgranules, humidified with optimal nutritive solution, is incubated in optimal conditions during 48 hours, then dried for 5 days. the bioinsecticide can be directly used after harvesting, without formulation. this process is original for several reasons : - the granulometry ( ...199314545678
keratinolysis and its morphological expression in hair digestion by airborne fungi.the morphological expression of keratinolysis in fungi isolated from the air of torino (98 isolates belonging to 36 species) was studied. light microscopy on whole material and on semithin sections, as well as scanning electron microscopy was used. there were 19 keratinolytically active species, with seven in the genus chrysosporium (c. indicum, c. keratinophilum, c. pannicola, c. tropicum, c. an. arthroderma cuniculi, c. an. pectinotrichum llanense, c. an. renispora flavissima), four in the gen ...19947527126
infectivity and teratogenicity of beauveria bassiana in menidia beryllina embryos.developing embryos of the inland silverside fish, menidia beryllina, were exposed to conidiospores of the insect pathogenic fungus, beauveria bassiana, that possessed activity against the migratory grasshopper, melanoplus sanguinipes. various adverse effects were observed in menidia beryllina embryos and larvae. they included rupture of the chorion, embryo death, developmental defects (vertebral abnormalities) in the embryo or hatched larvae, and fungal infections on the mandibles of larvae. alt ...19948024326
differentiation of species and strains of entomopathogenic fungi by random amplification of polymorphic dna (rapd).polymerase chain reaction (pcr)-based technology, involving random amplification of polymorphic dna (rapd), was used to assess the genomic variability between 24 isolates of deuteromycetous fungi (metarhizium anisopliae, metarhizium flavoviride, unidentified strains of metarhizium and beauveria bassiana) which were found to infect grasshoppers or locusts. m. flavoviride showed little intraspecific variability in pcr-amplified fragments when compared to m. anisopliae. the high level of variabilit ...19948087878
entomopathogenic fungi associated with ixodes ricinus ticks.the objective of this study was to demonstrate the occurrence of entomopathogenic fungi on ixodes ricinus ticks in relation to the tick stage, engorgement and season. ticks were collected from the vegetation, from small rodents and from deer. all entomopathogenic fungi found belonged to the hyphomycetes. paecilomyces farinosus and verticillium lecanii were the predominant species. other species, found only on engorged females were: beauveria bassiana, b. brongniartii, p. fumosoroseus and v. aran ...19957621711
an inner cell wall protein (cwp1) from conidia of the entomopathogenic fungus beauveria bassiana.following the removal of the rodlet layer from aerial or submerged conidia of the entomopathogenic deuteromycetous fungus beauveria bassiana, sds-insoluble, formic-acid-extractable proteins were found in the residual cell wall material. two major proteins (12.8 and 14.0 kda) were extracted with formic acid from fractured aerial and submerged conidia but not from blastospores. oxidation of the sample extracted by formic acid resulted in a single protein band (15.4 kda) as judged by sds-page. anti ...19957773402
manipulation of intracellular glycerol and erythritol enhances germination of conidia at low water availability.the insect pathogens beauveria bassiana, metarhizium anisopliae and paecilomyces farinosus can be effective biocontrol agents when relative humidity (rh) is close to 100%. at reduced water availability, germination of propagules, and therefore host infection, cannot occur. cultures of b. bassiana, m. anisopliae and p. farinosus were grown under different conditions to obtain conidia with a modified polyol and trehalose content. conidia with higher intracellular concentrations of glycerol and ery ...19957773406
cloning of a cuticle-degrading protease from the entomopathogenic fungus, beauveria bassiana.a beauveria bassiana extracellular subtilisin-like serine endoprotease is a potential virulence factor by virtue of its activity against insect cuticles. a cdna clone of the protease was isolated from mycelia of b. bassiana grown on cuticle/chitin cultures. the amino acid sequence of this gene was compared to that of metarhizium anisopliae pr1, the only pathogenicity determinant so far described from an entomopathogenic fungus, and proteinase k, isolated from tritirachium album, a saprophytic fu ...19957875568
bassiatin, a new platelet aggregation inhibitor produced by beauveria bassiana k-717.a new platelet aggregation inhibitor, bassiatin, was isolated from the cultured broth of beauveria bassiana which had been isolated from a soil sample collected in yunnan province, china. the structure of bassiatin was determined to be (3s, 6r)-4-methyl-6-(1-methylethyl)-3-phenylmethyl-1, 4-perhydrooxazine-2,5-dione by nmr analysis, x-ray crystallographic analysis and chemical synthesis. bassiatin inhibited adp-induced aggregation of rabbit platelets with the ic50 being 1.9 x 10(-4) m.19958557595
biocontrol potential of the entomogenous fungi beauveria bassiana and metarhizium anisopliae for tsetse flies (glossina spp.) at developmental sites.spores of two entomogenous fungi, beauveria bassiana and metarhizium anisopliae, were mixed with sterile sand at two different concentrations (1.0 and 0.5 g/liter) and larvae of tsetse flies glossina morsitans morsitans allowed to pupate in it, simulating field larviposition sites. one gram weight of b. bassiana-sand mixture was estimated to contain 1.4 x 10(6) spores/g and that of m. anisopliae-sand mixture 2.3 x 10(6) spores/g. adult tsetse emerging from pupae in sand-spore mixtures suffered h ...19958568279
mycotic pulmonary disease by beauveria bassiana in a captive tortoise.a case of fatal pulmonary infection in a female tortoise (tachemys scripta) imported into spain from cuba is reported. necropsy revealed general pulmonary congestion with pleuritis and a large number of yellowish nodules of the granulomatous type, similar to aspergillomata. histological examination showed some infiltration of round cells, surrounding a small mass of fungal hyphae. culturing on sabouraud glucose agar, demonstrated the presence of a fungus whose macroscopic and microscopic charact ...19957477096
complete nucleotide sequence of beauveria bassiana 5.8s rrna coding gene and flanking internal transcribed spacers.the nucleotide sequence of two clones of beauveria bassiana in 5.8s rrna coding gene and its regions were completely sequenced. the overall sequence similarity of these two clones is 96%. the identities of internal transcribed spacer (its) regions are 91 % (itsi) and 100% (itsii), respectively. both of 5.8s rrna sequences have 98% homology.19958777317
prospects for biological control of livestock ticks, rhipicephalus appendiculatus and amblyomma variegatum, using the entomogenous fungi beauveria bassiana and metarhizium anisopliae.both beauveria bassiana and metarhizium anisopliae induced approximately 30% mortalities in adult rhipicephalus appendiculatus feeding on rabbits while m. anisopliae induced a mortality of 37% in adult amblyomma variegatum. both fungal species induced reductions in engorgement weights, fecundity, and egg hatchability in adult a. variegatum. m. anisopliae reduced fecundity by 94% in a. variegatum. furthermore, b. bassiana reduced egg hatchability to 0%, while 11% of the infected females failed to ...19968812559
analysis and modeling of time-dose-mortality of melanoplus sanguinipes, locusta migratoria migratorioides, and schistocerca gregaria (orthoptera: acrididae) from beauveria, metarhizium, and paecilomyces isolates from madagascara complementary log-log (cll) model was used to model time-dose-mortality relationships from bioassay tests of 26 fungal isolates mostly from madagascar, africa, against three acridid species, all referred to here as "grasshoppers." the fungal pathogens included 15 isolates of beauveria bassiana, 9 isolates of metarhizium flavoviridae, and 2 isolates of paecilomyces spp. grasshopper species tested included melanoplus sanguinipes, locusta migratoria migratorioides, and schistocerca gregaria. the ...19968812605
identification and differentiation of the entomopathogenic fungus beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis.a series of genomic dna probes which exhibit specificity for beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal dna (hegedus and khachatourians, 1993a). to improve the sensitivity of a dna-based monitoring system for detection of this entomopathogenic fungus we have developed a pcr-based method. using sequence information from a region of the b. bassiana-specific probe pbb22, primers p1 (5'aagcttcgacatggtctg) and p3 (5ggaggtggtgaggttctgtt) were generated. th ...19968812610
an oil-bait bioassay method used to test the efficacy of beauveria bassiana against grasshoppers 19968812614
[studies of the usefulness of beauveria bassiana for eradication of cockroaches (blattella germanica l.)].the ability of killing cockroaches (blattella germanica l.) by various strains of the mushroom beauveria bassiana was studied, including also strains obtained by passaging. the study was conducted using adult insects, of varying age and sex, derived from laboratory cultures or caught in hospital rooms. the obtained results pointed out differences in the pathogenicity of b. bassiana strains for the studied populations of insects. the per cent of mortality among the insects depended on the pathoge ...19969026901
genetic nature, stability, and improved virulence of hybrids from protoplast fusion in beauveriagenetic improvement of two different strains of the entomopathogenic fungus beauveria bassiana for more effective control of ostrinia nubilalis and leptinotarsa decemlineata was obtained by crosses with the insecticidal toxin-producing strain beauveria sulfurescens. protoplast fusion between diauxotrophic mutants resulted in the recovery of some stable prototrophic fusion products. the low levels of virulence of the wild type strain b. bassiana 28 isolated originally from l. decemlineata were en ...19968661542
characterization and ultrastructural localization of chitinases from metarhizium anisopliae, m. flavoviride, and beauveria bassiana during fungal invasion of host (manduca sexta) cuticle.extracellular chitinases have been suggested to be virulence factors in fungal entomopathogenicity. we employed isoelectric focusing and a set of three fluorescent substrates to investigate the numbers and types of chitinolytic enzymes produced by the entomopathogenic fungi metarhizium anisopliae, metarhizium flavoviride, and beauveria bassiana. each species produced a variety of n-acetyl-(beta)-d-glucosaminidases and endochitinases during growth in media containing insect cuticle. m. flavovirid ...199616535278
culture age, temperature, and ph affect the polyol and trehalose contents of fungal propagules.the growth and conidial physiology of the entomopathogenic fungi beauveria bassiana, metarhizium anisopliae, and paecilomyces farinosus were studied under different conditions. the effects of culture age (up to 120 days), temperature (5 to 35(deg)c), and ph (2.9 to 11.1) were determined. growth was optimal at ph 5 to 8 for each isolate and between 20 and 35(deg)c, depending on the isolate. the predominant polyol in conidia was mannitol, with up to 39, 134, and 61 mg g of conidia(sup-1) for b. ba ...199616535354
pathogenicity of fungi to eggs of heterodera glycines.twenty-one isolates of 18 fungal species were tested on water agar for their pathogenicity to eggs of heterodera glycines. an egg-parasitic index (epi) for each of these fungi was recorded on a scale from 0 to 10, and hatch of nematode eggs was determined after exposure to the fungi on water agar for 3 weeks at 24 c. the epi for verticillium chlamydosporium was 7.6, and the fungus reduced hatch 74%. pyrenochaeta terrestris and two sterile fungi also showed a high epi and reduced hatch 42-73%. ar ...199619277130
Displaying items 1 - 100 of 1213