Publications
Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
---|
[cloning of a mads box protein gene (ghmads1) from cotton (gossypium hirsutum l.)]. | as a kind of transcription factors, mads-box protein plays an important role in various cellular processes, especially in the development of floral organs. based on the contig analysis of the cotton ests, the coding region of a cotton mads-box protein (ghmads1) was obtained by rt-pcr from floral buds of cotton (g. hirsutum). the cloned fragment of 713 bp (ghmads1, genbank accession no. af538965) contains an open reading frame of 711 bp,coding a polypeptide of 236 amino acids. it was demonstrated ... | 2004 | 15552050 |
comparative production of helicoverpa zea (lepidoptera: noctuidae) from transgenic cotton expressing either one or two bacillus thuringiensis proteins with and without insecticide oversprays. | transgenic cotton, gossypium hirsutum (l.), expressing either one or two bacillus thuringiensis ssp. kurstaki berliner (bt) proteins was compared with the conventional sister line in field experiments with regard to production of bollworm, helicoverpa zea (boddie), and bolls damaged by bollworm. the relative numbers of bollworms that developed on bollgard (monsanto co., st. louis, mo), bollgard ii (monsanto co.), and conventional cotton were estimated under nontreated conditions in 2000 and both ... | 2004 | 15568364 |
relative concentration of cry1a in maize leaves and cotton bolls with diverse chlorophyll content and corresponding larval development of fall armyworm (lepidoptera: noctuidae) and southwestern corn borer (lepidoptera: crambidae) on maize whorl leaf profiles. | to manage insect resistance to transgenic crops that express insecticidal proteins from bacillus thuringiensis (bt) berliner, the u.s. environmental protection agency recommends a refuge-based insect resistance management strategy where a percentage of non-bt (refuge) crop is grown in proximity to a bt-expressing crop. an important requirement for this strategy is that the toxin exists at a high effective dose for control of the target pest(s), so that heterozygous individuals in the population ... | 2004 | 15568367 |
the cotton ghnhx1 gene encoding a novel putative tonoplast na(+)/h(+) antiporter plays an important role in salt stress. | a cdna clone was isolated from cotton (gossypium hirsutum) cdna library and characterized with regard to its sequence, regulation in response to salt stress and functions in yeast mutants and transgenic tobacco plants. the clone, designated as ghnhx1, contains 2485 nucleotides with an open reading frame of 1629 nucleotides, and the deduced amino acid sequence showed high identities with other plant vacuolar-type na(+)/h(+) antiporters. northern blot analysis indicated that the mrna accumulation ... | 2004 | 15169942 |
post-transcriptional gene silencing induced by short interfering rnas in cultured transgenic plant cells. | short interfering rna (sirna) is widely used for studying post-transcriptional gene silencing and holds great promise as a tool for both identifying function of novel genes and validating drug targets. two sirna fragments (sirna-a and -b), which were designed against different specific areas of coding region of the same target green fluorescent protein (gfp) gene, were used to silence gfp expression in cultured gfp transgenic cells of rice (oryza sativa l.; os), cotton (gossypium hirsutum l.; gh ... | 2004 | 15629049 |
a simple and rapid agrobacterium-mediated transformation protocol for cotton (gossypium hirsutum l.): embryogenic calli as a source to generate large numbers of transgenic plants. | a protocol is presented for efficient transformation and regeneration of cotton. embryogenic calli co-cultivated with agrobacterium carrying cry1ia5 gene were cultured under dehydration stress and antibiotic selection for 3-6 weeks to generate several transgenic embryos. an average of 75 globular embryo clusters were observed on selection plates and these embryos were cultured on multiplication medium followed by development of cotyledonary embryos on embryo maturation medium to obtain an averag ... | 2004 | 13680138 |
boll injury and yield losses in cotton associated with brown stink bug (heteroptera: pentatomidae) during flowering. | brown stink bug, euschistus servus (say), was infested on cotton, gossypium hirsutum l., plants during reproductive stages to determine the effects on boll injury and seedcotton yield. during each week in 2002 and 2003, significantly more bolls with > or = 1 injured locule, bolls with > or = 2 injured locules, and bolls with discolored lint were recorded on stink bug-infested plants compared with that on noninfested plants. significantly fewer bolls displayed external injury on the boll exocarp ... | 2004 | 15666747 |
effects of burial and soil condition on postharvest mortality of boll weevils (coleoptera: curculionidae) in fallen cotton fruit. | effects of soil condition and burial on boll weevil, anthonomus grandis grandis boheman, mortality in fallen cotton, gossypium hirsutum l., fruit were assessed in this study. during hot weather immediately after summer harvest operations in the lower rio grande valley of texas, burial of infested fruit in conventionally tilled field plots permitted significantly greater survival of weevils than in no-tillage plots. burial of infested squares protected developing weevils from heat and desiccation ... | 2004 | 15154462 |
interaction of rotylenchulus reniformis with seedling disease pathogens of cotton. | the impact of 10 fusarium species in concomitant association with rotylenchulus reniformis on cotton seedling disease was examined under greenhouse conditions. in experiment 1, fungal treatments consisted of fusarium chlamydosporum, f. equiseti, f. lateritium, f. moniliforme, f. oxysporum, f. oxysporum f.sp. vasinfectum, f. proliferatum, f. semitectum, f. solani, and f. sporotrichioides; rhizoctonia solani; and thielaviopsis basicola. the experimental design was a 2 x 14 factorial consisting of ... | 2004 | 19262802 |
influence of poultry litter applications on nematode communities in cotton agroecosystems. | the effects of the application of poultry litter at 0.0, 6.7, 13.4, and 20.1 tons/ha on population changes during the growing season on nematode communities were evaluated in two cotton production fields in north carolina. numbers of bactivorous nematodes increased at midseason in response to the rate at which litter was applied but decreased with increasing litter application rates at cotton harvest. numbers of fungivores at cotton harvest were related positively to the rate of litter applied, ... | 2004 | 19262834 |
suppression of rotylenchulus reniformis on cotton by the nematophagous fungus arf. | the reniform nematode, rotylenchulus reniformis linford &oliveira, has become a serious threat to cotton (gossypium hirsutum l.) production in the united states during the past decade. the objective of this study is to isolate fungi from eggs of r. reniformis and select potential biological control agents for r. reniformis on cotton. soil samples were collected from cotton fields located in jefferson county, arkansas. eight genera of fungi were included in the 128 fungal isolates obtained, and a ... | 2004 | 19262806 |
rotylenchulus reniformis below plow depth suppresses cotton yield and root growth. | damage to cotton by rotylenchulus reniformis below plow depth was evaluated in a sandy clay loam soil at weslaco, texas. in december 1999, 14 holes on 51-cm centers were dug 91 cm deep along the planting bed and adjacent furrow and 2 ml of 1,3-dichloropropene was placed 91, 61, and 30 cm deep as each hole was refilled and packed. this technique eliminated 96%, 81%, and 74% of r. reniformis down to 107 cm at distances 0, 25, and 51 cm laterally from the point of application (p </= 0.05), whereas ... | 2005 | 19262875 |
histological observations of rotylenchulus reniformis on gossypium longicalyx and interspecific cotton hybrids. | observations on the development of reniform nematode (rotylenchulus reniformis) on roots of gossypium longicalyx, g. hirsutum, and two interspecific hybrids derived from them were made by light microscopy. gossypium longicalyx is reported to be immune to reniform nematode, but the mechanism(s) for resistance are unknown. penetration of g. longicalyx roots by female nematodes was confirmed, and incipient swelling of the females, indicating initiation of maturation of the reproductive system, was ... | 2005 | 19262889 |
reproduction of belonolaimus longicaudatus, meloidogyne javanica, paratrichodorus minor, and pratylenchus brachyurus on pearl millet (pennisetum glaucum). | pearl millet (pennisetum glaucum) has potential as a grain crop for dryland crop production in the southeastern united states. whether or not pearl millet will be compatible in rotation with cotton (gossypium hirsutum), corn (zea mays), and peanut (arachis hypogaea) will depend, in part, on its host status for important plant-parasitic nematodes of these crops. the pearl millet hybrid 'tifgrain 102' is resistant to both meloidogyne incognita race 3 and m. arenaria race 1; however, its host statu ... | 2005 | 19262863 |
vertical distribution of rotylenchulus reniformis in cotton fields. | the possible impact of rotylenchulus reniformis below plow depth was evaluated by measuring the vertical distribution of r. reniformis and soil texture in 20 symptomatic fields on 17 farms across six states. the mean nematode population density per field, 0 to 122 cm deep, ranged from 0.4 to 63 nematodes/g soil, and in 15 fields more than half of the r. reniformis present were below 30.5 cm, which is the greatest depth usually plowed by farmers or sampled by consultants. in 11 fields measured, r ... | 2005 | 19262871 |
histological changes in gossypium hirsutum associated with reduced reproduction of rotylenchulus reniformis. | the reniform nematode (rotylenchulus reniformis) is an important parasite of upland cotton (gossypium hirsutum). parasitism involves the formation of syncytia to provide nutrition for the female. events that occur at the feeding site may determine the degree of susceptibility of cotton plants to reniform nematode. the objective of this work was to describe histological modifications associated with reduced reproduction of rotylenchulus reniformis in upland cotton roots. 'deltapine 50' cotton and ... | 2005 | 19262859 |
isolation, selection, and efficacy of pochonia chlamydosporia for control of rotylenchulus reniformis on cotton. | abstract the reniform nematode, rotylenchulus reniformis, is a serious threat to cotton (gossypium hirsutum) production in the united states, causing an annual loss of about $80 million. the objective of this study was to isolate fungi from eggs of r. reniformis and select potential biocontrol agents for r. reniformis on cotton. we focused on the fungus pochonia chlamydosporia because it suppresses root-knot and cyst nematodes and because preliminary data indicated that it was present in arkansa ... | 2005 | 18944410 |
disease resistance conferred by the expression of a gene encoding a synthetic peptide in transgenic cotton (gossypium hirsutum l.) plants. | fertile, transgenic cotton plants expressing the synthetic antimicrobial peptide, d4e1, were produced through agrobacterium-mediated transformation. pcr products and southern blots confirmed integration of the d4e1 gene, while rt-pcr of cotton rna confirmed the presence of d4e1 transcripts. in vitro assays with crude leaf protein extracts from t0 and t1 plants confirmed that d4e1 was expressed at sufficient levels to inhibit the growth of fusarium verticillioides and verticillium dahliae compare ... | 2005 | 17147626 |
antisense suppression of a (+)-delta-cadinene synthase gene in cotton prevents the induction of this defense response gene during bacterial blight infection but not its constitutive expression. | in cotton (gossypium hirsutum) the enzyme (+)-delta-cadinene synthase (cdns) catalyzes the first committed step in the biosynthesis of cadinane-type sesquiterpenes, such as gossypol, that provide constitutive and inducible protection against pests and diseases. a cotton cdna clone encoding cdns (cdn1-c4) was isolated from developing embryos and functionally characterized. southern analysis showed that cdns genes belong to a large multigene family, of which five genomic clones were studied, inclu ... | 2005 | 15849309 |
validation of a cotton-specific gene, sad1, used as an endogenous reference gene in qualitative and real-time quantitative pcr detection of transgenic cottons. | genetically modified (gm) cotton lines have been approved for commercialization and widely cultivated in many countries, especially in china. as a step towards the development of reliable qualitative and quantitative pcr methods for detecting gm cottons, we report here the validation of the cotton (gossypium hirsutum) endogenous reference control gene, sad1, using conventional and real-time (rt)-pcr methods. both methods were tested on 15 different g. hirsutum cultivars, and identical amplicons ... | 2005 | 15726375 |
toxicity to cotton boll weevil anthonomus grandis of a trypsin inhibitor from chickpea seeds. | cotton (gossypium hirsutum l.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil anthonomus grandis. adult a. grandis feed on fruits and leaf petioles, reducing drastically the crop production. the predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. the present study describes a novel proteinase inhibitor from chickpea ... | 2005 | 15649779 |
transgenic cotton (gossypium hirsutum l.) seedlings expressing a tobacco glutathione s-transferase fail to provide improved stress tolerance. | transgenic cotton (gossypium hirsutum l.) lines expressing the tobacco glutathione s-transferase (gst) nt107 were evaluated for tolerance to chilling, salinity, and herbicides, antioxidant enzyme activity, antioxidant compound levels, and lipid peroxidation. although transgenic seedlings exhibited ten-fold and five-fold higher gst activity under normal and salt-stress conditions, respectively, germinating seedlings did not show improved tolerance to salinity, chilling conditions, or herbicides. ... | 2005 | 15824906 |
functional characterization of gossypium hirsutum profilin 1 gene (ghpfn1) in tobacco suspension cells. characterization of in vivo functions of a cotton profilin gene. | cotton fiber is an extremely long plant cell. fiber elongation is a complex process and the genes that are crucial for elongation are largely unknown. we previously cloned a cdna encoding an isoform of cotton profilin and found that the gene (designated ghpfn1) was preferentially expressed in cotton fibers. in the present study, we have further analyzed the expression pattern of ghpfn1 during fiber development and studied its cellular function using tobacco suspension cells as an experimental sy ... | 2005 | 16001260 |
effects of planting dates on boll weevils (coleoptera: curculionidae) and cotton fruit in the subtropics. | the effects of planting dates 2-3-wk apart on boll weevil, anthonomus grandis grandis boheman (coleoptera: curculionidae), field-level populations, and feeding and oviposition damage to cotton, gossypium hirsutum l., squares and bolls, were studied during 2002 and 2003 in the lower rio grande valley of texas. squares were 44-56% more abundant in some later planted treatments than in the earlier planted treatments, but mean cumulative numbers of oviposition- and feeding-damaged squares were 2.7 - ... | 2005 | 16022308 |
ghhb1: a nonsymbiotic hemoglobin gene of cotton responsive to infection by verticillium dahliae. | verticillium wilt of cotton is a widespread and destructive disease that is caused by the fungus pathogen verticillium dahliae. although no cotton cultivar is immune to the disease, some genotypes exhibit superior wilt tolerance. to gain an insight into the molecular mechanisms responsible for wilt tolerance, we employed the method of suppression subtractive hybridization (ssh) to isolate genes whose expression is up-regulated after inoculation of the pathogen in a wilt-tolerant cotton cultivar ... | 2005 | 16084605 |
measuring gene flow in the cultivation of transgenic cotton (gossypium hirsutum l.). | transgenic bt cotton newcott 33b and transgenic tfd a cotton tfd were chosen to evaluate pollen dispersal frequency and distance of transgenic cotton (gossypium hirsutum l.) in the huanghe valley cotton-producing zone, china. the objective was to evaluate the efficacy of biosafety procedures used to reduce pollen movement. a field test plot of transgenic cotton (6 x 6 m) was planted in the middle of a nontransgenic field measuring 210 x 210 m. the results indicated that the pollen of bt cotton o ... | 2005 | 16118411 |
characterization of a cdna encoding metallothionein 3 from cotton (gossypium hirsutum l.). | a cdna encoding metallothionein (mt) was isolated from a library constructed with poly a(+) rna purified from 48 h etiolated cotton (gossypium hirsutum l.) cotyledons. this cdna encodes a deduced protein with 63 residues and a molecular weight of 6.3 kda. the protein has 10 cysteines of which 4 are within the cxxcxcxxxxxc amino-terminus motif and six are within the cxcxxxcxcxxcxc carboxyl-terminus motif characteristic of the type iii mt (mt3). the cotton mt3 protein sequence is 76.2, 69.8, 66.7, ... | 2005 | 16147860 |
molecular cloning and characterization of a cotton glucuronosyltranferase gene. | a glucuronosyltranferase gene has been isolated from cotton (gossypium hirsutum) fiber cells using rapid amplification of the cdna ends. the full-length cdna, designated ghglcat1, is 1400 bp in length (ay346330) and contains an open reading frame of 1107 bp encoding a protein of 368 amino acids. alignment of the ghglcat1 predicted amino acid sequence was shown to have high sequence similarity with animal glucuronosyltranferases. a phylogenic tree generated by the phylip program package showed th ... | 2005 | 15940874 |
evaluation of transgenic cotton varieties and a glyphosate application on seedling disease incidence. | a study was conducted to determine whether stand densities of transgenic cotton (gossypium hirsutum) varieties, with or without glyphosate, were similar to conventional varieties of the same lineage group in georgia and mississippi. transgenic and conventional cotton varieties were placed into five lineage groups of related varieties and seedling disease was evaluated in three greenhouse tests and a field trial using rhizoctonia solani ag-4. seed vigor was determined by standard germination stud ... | 2005 | 15973787 |
size-dependent feeding and reproduction by boll weevil (coleoptera: curculionidae). | the considerable variation in adult size of the boll weevil, anthonomus grandis grandis boheman, has been well documented, but the influences of adult size on reproductive rate are not known. we examined the relationship between the size of boll weevils and their feeding and oviposition. weevils weighed to the nearest milligram were grouped into five categories based on pupal weight: < or =5, 6-10, 11-15, 16-20, and >20 mg. numbers of lifetime punctures produced in flower buds (squares) of cotto ... | 2005 | 16022302 |
cotton honeydew (gossypium hirsutum l.) extract offers very interesting properties for hair cosmetics and care products. | cotton honeydew extract is composed of a unique combination of oligosaccharides, including fructose, glucose, inositol, melezitose, saccharose, trehalose and trehalulose. studies have shown that these oligosaccharides exhibit a protective effect. therefore, we were interested in studying the effect of these oligosaccharides on normal and damaged human hair. both clinical and scanning electron microscopy (sem) studies were performed. standardized human hair samples were used to determine the effe ... | 2005 | 16223202 |
comparative study on biological parameters of bemisia tabaci (genn.) collected on four host plants from varamin-iran. | during 2003 biological parameters of sweetpotato whitefly, b. tabaci (genn.) (horn. aleyrodidae) as a major pest of field crops, vegetables and ornamentals were studied. in this study, the infested leaves of cucumber (cucumis sativus l.) zucchini (cucurbita pepo l.) eggplant (solanum melongena l.) and cotton (gossypium hirsutum l.) with whitefly nymphs and pupae were collected from varamin-iran, and were transferred to the laboratory. the newly emerged males and females of each population were r ... | 2005 | 16628901 |
function analysis of promoter trapping system after inserted into cotton (gossypium hirsutum l. ) genome. | the technique of promoter trapping was developed to investigate its viability in cotton ( gossypium hirsutum l.) functional genomics. 141 independent transformants of cotton were generated via agrobacterium tumefaciens mediated transformation, of which 97% showed positive by pcr detection. the reporter, gus gene, was expressed to different extent in different organs, with a frequency of 48% in roots, 9.2% in vascular bundles of stem, 5.2% in leaves, and 51% in flowers. meanwhile, we discovered t ... | 2005 | 16459655 |
proactive spraying against boll weevils (coleoptera: curculionidae) reduces insecticide applications and increases cotton yield and economic return. | the current standard practice of two to three preemptive insecticide applications at the start of pinhead (1-2-mm-diameter) squaring followed by threshold-triggered (whenever 10% of randomly selected squares have oviposition punctures) insecticide applications for boll weevil, anthonomus grandis grandis boheman, control does not provide a reliably positive impact on cotton, gossypium hirsutum l., yields in subtropical conditions. this study showed that four fewer spray applications in a "proacti ... | 2005 | 16539122 |
the cotton actin1 gene is functionally expressed in fibers and participates in fiber elongation. | single-celled cotton fiber (gossypium hirsutum) provides a unique experimental system to study cell elongation. to investigate the role of the actin cytoskeleton during fiber development, 15 g. hirsutum actin (ghact) cdna clones were characterized. rna gel blot and real-time rt-pcr analysis revealed that ghact genes are differentially expressed in different tissues and can be classified into four groups. one group, represented by ghact1, is expressed predominantly in fiber cells and was studied ... | 2005 | 15722467 |
resistance gene analogue markers are mapped to homeologous chromosomes in cultivated tetraploid cotton. | degenerate primers designed from conserved motifs of known plant resistance gene products were used to amplify genomic dna sequences from the root-knot nematode (meloidogyne incognita) resistance genetic source, upland cotton (gossypium hirsutum) cultivar auburn 634 rnr. a total of 165 clones were isolated, and sequence analysis revealed 57 of the clones to be novel nucleotide sequences, many containing the resistance (r)-protein nucleotide-binding site motif. a cluster analysis was performed wi ... | 2005 | 15726317 |
an internal motor kinesin is associated with the golgi apparatus and plays a role in trichome morphogenesis in arabidopsis. | members of the kinesin superfamily are microtubule-based motor proteins that transport molecules/organelles along microtubules. we have identified similar internal motor kinesins, kinesin-13a, from the cotton gossypium hirsutum and arabidopsis thaliana. their motor domains share high degree of similarity with those of internal motor kinesins of animals and protists in the mcak/kinesin13 subfamily. however, no significant sequence similarities were detected in sequences outside the motor domain. ... | 2005 | 15574882 |
molecular dissection of phenotypic variation between gossypium hirsutum and gossypium barbadense (cotton) by a backcross-self approach: iii. fiber length. | a backcross-self population from a cross between gossypium hirsutum and g. barbadense was used to dissect the molecular basis of genetic variation governing 15 parameters that reflect fiber length. applying a detailed restriction fragment length polymorphism (rflp) map to 3,662 bc(3)f(2) plants from 24 independently derived bc(3) families, we detected 28, nine, and eight quantitative trait loci (qtls) for fiber length, length uniformity, and short fiber content, respectively. for eight, six, and ... | 2005 | 15983757 |
molecular dissection of interspecific variation between gossypium hirsutum and gossypium barbadense (cotton) by a backcross-self approach: i. fiber elongation. | the current study is the first installment of an effort to explore the secondary gene pool for the enhancement of upland cotton (gossypium hirsutum l.) germplasm. we developed advanced-generation backcross populations by first crossing g. hirsutum cv. tamcot 2111 and g. barbadense cv. pima s6, then independently backcrossing f(1) plants to the g. hirsutum parent for three cycles. genome-wide mapping revealed introgressed alleles at an average of 7.3% of loci in each bc(3)f(1) plant, collectively ... | 2005 | 15983756 |
genetic mapping of new cotton fiber loci using est-derived microsatellites in an interspecific recombinant inbred line cotton population. | there is an immediate need for a high-density genetic map of cotton anchored with fiber genes to facilitate marker-assisted selection (mas) for improved fiber traits. with this goal in mind, genetic mapping with a new set of microsatellite markers [comprising both simple (ssr) and complex (csr) sequence repeat markers] was performed on 183 recombinant inbred lines (rils) developed from the progeny of the interspecific cross gossypium hirsutum l. cv. tm1 x gossypium barbadense l. pima 3-79. micro ... | 2005 | 16187061 |
cleaved aflp (caflp), a modified amplified fragment length polymorphism analysis for cotton. | in certain plant species including cotton (gossypium hirsutum l. or gossypium barbadense l.), the level of amplified fragment length polymorphism (aflp) is relatively low, limiting its utilization in the development of genome-wide linkage maps. we propose the use of frequent restriction enzymes in combination with aflp to cleave the aflp fragments, called cleaved aflp analysis (caflp). using four upland cotton genotypes (g. hirsutum) and three pima cotton (g. barbadense), we demonstrated that ca ... | 2005 | 16133304 |
genetic diversity and geographic pattern in early south american cotton domestication. | amplified fragment length polymorphism fingerprinting was applied to survey the genetic diversity of primitive south american gossypium barbadense cotton for establishing a possible link to its pre-columbian expansion. new germplasm was collected along coastal peru and over an andean transect in areas where most of the archaeological evidence relating to cotton domestication has been recorded. gene bank material of three diploid (g. raimondii, g. arboreum, and g. herbaceum) and four allotetraplo ... | 2005 | 15580473 |
structural determinants for plant annexin-membrane interactions. | the interactions of two plant annexins, annexin 24(ca32) from capsicum annuum and annexin gh1 from gossypium hirsutum, with phospholipid membranes have been characterized using liposome-based assays and adsorption to monolayers. these two plant annexins show a preference for phosphatidylserine-containing membranes and display a membrane binding behavior with a half-maximum calcium concentration in the sub-millimolar range. surprisingly, the two plant annexins also display calcium-independent mem ... | 2005 | 16331990 |
a comparison of genetic maps constructed from haploid and bc1 mapping populations from the same crossing between gossypium hirsutum l. and gossypium barbadense l. | simple sequence repeat (ssr) genetic maps have been separately constructed based on doubled haploid (dh) and (or) haploid and bc1 populations from the same cross between gossypium hirsutum l. 'tm-1' and gossypium barbadense l. 'hai7124'. the bc1 population was produced by pollinating individual plants of the 'tm-1' x 'hai7124' f1 with 'tm-1', whereas the dh and (or) haploid population developed from the offspring of vsg x ('tm-1' x 'hai7124'). vsg is a virescently marked semigamy line of gossypi ... | 2005 | 16121235 |
occurrence of (+)- and (-)-gossypol in wild species of cotton and in gossypium hirsutum var. marie-galante (watt) hutchinson. | gossypol occurs as a mixture of enantiomers in cottonseed. these enantiomers exhibit different biological activities. the (-)-enantiomer is toxic to animals, but it has potential medicinal uses. therefore, cottonseed with >95% (-)-gossypol could have biopharmaceutical applications. the (+)-enantiomer shows little, if any, toxicity to nonruminant animals. thus, cottonseed with >95% (+)-gossypol could be more readily utilized as a feed for nonruminants. the (+)- to (-)-gossypol ratio in commercial ... | 2005 | 16076104 |
okra-leaf accessions of the upland cotton (gossypium hirsutum l.): genetic variability in agronomic and fibre traits. | okra-leaf types of the upland cotton have the potential to be competitive to the normal-leaf types in yield and fibre quality, in addition to its potential resistance to insect pests and drought. okra-leaf cotton accessions, collected at cotton research institute, faisalabad, pakistan, were evaluated in respect of genetic variance and relative performance in half- and full-sib crosses (combining ability) for 2 years. variation due to parents x years interaction was significant for lint percentag ... | 2005 | 15977325 |
successive chromosome walking by compatible ends ligation inverse pcr. | here we describe an advanced polymerase chain reaction (pcr) technique, the compatible ends ligation inverse pcr (celi-pcr) for chromosome walking. in celi-pcr, several restriction enzymes, which produce compatible cohesive ends, were used to digest target dna simultaneously or sequentially to produce dna fragments of suitable size. dna fragments were then easily circularized and pcr amplification could be carried out efficiently. the previous limitations of inverse pcr were overcome, such as un ... | 2005 | 15920279 |
systemic induction of volatile release in cotton: how specific is the signal to herbivory? | plants attacked by herbivorous insects release chemical signals that attract natural enemies of the herbivores to the damaged plants. feeding of spodoptera exigua larvae on the lower leaves of cotton (gossypium hirsutum l.) for multiple feeding periods of 9-12 h with a 12 h, interval in between when the caterpillars are removed overnight, will induce a systemic release of volatile compounds that is comparable to the volatiles released in response to continuous feeding damage on the lower leaves ... | 2005 | 15856281 |
[cloning and expression analysis of two rac genes from cotton (gossypium hirsutum l.)]. | plant rac proteins belong to an important group of signal switches anchoring on membranes, involved in various physiological processes including cell polar growth, synthesis of secondary wall, resistance response and hormone signaling. in the attempt to elucidate the molecular mechanism of initiation and elongation of cotton fiber, two cotton rac protein genes, designated as ghraca and ghracb, were amplified from elongating fibers and cloned. it was demonstrated that, the cdna of ghraca containe ... | 2005 | 15715441 |
the delayed initiation and slow elongation of fuzz-like short fibre cells in relation to altered patterns of sucrose synthase expression and plasmodesmata gating in a lintless mutant of cotton. | cotton (gossypium hirsutum l.) seed develops single-celled long fibres (lint) from the seed-coat epidermis at anthesis. previous studies have shown that the initiation and rapid elongation of these fibres requires the expression of sucrose synthase (sus) and, potentially, a transient closure of plasmodesmata. this study extends the previous work to examine the patterns of sus expression and plasmodesmata gating in fuzz-like short fibres of a mutant that shows delayed initiation and much slower a ... | 2005 | 15710635 |
[spontaneous and induced programmed cell death in suspension cell cultures of cotton (gossypium hirsutum l.)]. | cotton suspension cells grew well in the ms medium supplemented with 0.1 mg/l 2,4 d and 0.1 mg/l kt. senescence occurred when the cells were unsubcultured. the cells began to lose their viabilities on the 17th day, and on the 21th day oligonucleosomal sized dna fragments ( dna ladder) could be detected. oligonucleosomal sized dna fragments ( dna ladder) was the hallmark of the programmed cell death. programmed cell death of cotton suspension cells could be induced respectively by some stress fac ... | 2005 | 16231696 |
sts markers linked to the rf1 fertility restorer gene of cotton. | marker-assisted selection (mas) can accelerate the process of plant breeding, and sequence-tagged site (sts) markers are highly specific for regions of dna being used for mas. the objective of this research was to develop sts markers tightly linked with rf1, the fertility restoring gene for cytoplasmic male sterility (cms) in cotton (gossypium hirsutum l.). bulked segregant analysis was employed to screen for rf1-linked rapd markers in a backcross population. four rapd markers were identified, t ... | 2005 | 15592810 |
activity of selected neonicotinoids and dicrotophos on nontarget arthropods in cotton: implications in insect management. | certain neonicotinoids are used in cotton, gossypium hirsutum (l.), to control various piercing-sucking pests. we conducted field studies using three neonicotinoids (acetamiprid, thiamethoxam, and imidacloprid) and an organophosphate (dicrotophos) to assess the activity of these insecticides against nontarget arthropods, particularly predators, and to determine the potential economic consequences of such activity. mortality among populations of the big-eyed bug, geocoris punctipes (say), and the ... | 2005 | 16022310 |
genetic mapping of a cross between gossypium hirsutum (cotton) and the hawaiian endemic, gossypium tomentosum. | the existence of five tetraploid species that derive from a common polyploidization event about 1 million years ago makes gossypium (cotton) an attractive genus in which to study polyploid evolution and offers opportunities for crop improvement through introgression. to date, only crosses (hb) between the cultivated tetraploid cottons gossypium hirsutum and g. barbadense have been genetically mapped. genetic analysis of a cross (ht) between g. hirsutum and the hawaiian endemic g. tomentosum is r ... | 2005 | 16044266 |
effects of farmyard manure and fertilizers on yield, fibre quality and nutrient balance of rainfed cotton (gossypium hirsutum). | two-year field experiments were conducted to evaluate the effect of fertilizer with or without farmyard manure (fym) application on cotton productivity and fibre quality. a partial nutrient balance was calculated by the difference method (nutrient applied--crop removal). seed cotton yield was improved with addition of fym (5 mg ha(-1)). application of both n and p resulted in significant improvements in seed cotton yield than the control and without n plots (pk). uniformity ratio and ginning out ... | 2005 | 15474936 |
cycloheximide treatment of cotton ovules alters the abundance of specific classes of mrnas and generates novel ests for microarray expression profiling. | fibres of cotton (gossypium hirsutum l.) are single elongated epidermal cells that start to develop on the outer surface of cotton ovules on the day of anthesis. little is known about the control of fibre initiation and development. as a first step towards discovering important genes involved in fibre initiation and development using a genomics approach, we report technical advances aimed at reducing redundancy and increasing coverage for anonymous cdna microarrays in this study. cotton ovule cd ... | 2005 | 16208490 |
dna content and expression of genes related to cell cycling in developing gossypium hirsutum (malvaceae) fibers. | the cell cycle in cotton (gossypium hirsutum) fibers is poorly understood. the objective of this study was to evaluate the cell cycle status and dna content in developing cotton fibers. the dna content and cell cycle distribution in fiber and hypocotyl cells were determined by flow cytometry. expression levels of minichrosomal maintenance protein (mcm), cyclin b, and a retinoblastoma-like protein (rb) genes were determined with real-time pcr in fibers and dividing and nondividing tissues. no end ... | 2005 | 21646111 |
carbon source dependent somatic embryogenesis and plant regeneration in cotton, gossypium hirsutum l. cv. svpr2 through suspension cultures. | highly reproducible and simple protocol for cotton somatic embryogenesis is described here by using different concentrations of maltose, glucose, sucrose and fructose. maltose (30 g/l) is the best carbon source for embryogenic callus induction and glucose (30 g/l) was suitable for induction, maturation of embryoids and plant regeneration. creamy white embryogenic calli of hypocotyl explants were formed on medium containing ms basal salts, myo-inositol (100 mg/l), thiamine hci (0.3 mg/l), piclora ... | 2005 | 16235728 |
molecular dissection of interspecific variation between gossypium hirsutum and g. barbadense (cotton) by a backcross-self approach: ii. fiber fineness. | a backcross-self population from a cross between gossypium hirsutum and g. barbadense was used to dissect the molecular basis of genetic variation governing two parameters reflecting lint fiber fineness and to compare the precision of these two measurements. by applying a detailed restriction fragment length polymorphism (rflp) map to 3,662 bc(3)f(2) plants from 24 independently derived bc(3) families, we were able to detect 32 and nine quantitative trait loci (qtls) for fiber fineness and micro ... | 2005 | 15995865 |
confirmation and quantification of strigolactones, germination stimulants for root parasitic plants striga and orobanche, produced by cotton. | the germination stimulants for root parasitic plants striga and orobanche produced by cotton (gossypium hirsutum l.) were examined in detail. seeds of cotton were germinated and grown on glass wool wetted with sterile distilled water in sterile filter units. the root exudate was collected daily and extracted with ethyl acetate. each of these ethyl acetate extracts was analyzed directly by high-performance liquid chromatography linked with tandem mass spectrometry (lc/ms/ms). the results demonstr ... | 2005 | 15665473 |
agricultural dust production in standard and conservation tillage systems in the san joaquin valley. | the negative health effects of repeated dust exposure have been well documented. in california's san joaquin valley, agricultural operations may contribute substantially to airborne particulates. we evaluated four management systems to assess impacts on dust production and soil properties for a cotton (gossypium hirsutum l.)-tomato (lycopersicon esculentum mill.) rotation: standard tillage with (stcc) and without (stno) cover crop, and conservation tillage with (ctcc) and without (ctno) cover cr ... | 2006 | 15998847 |
influence of cytokinins, auxins and polyamines on in vitro mass multiplication of cotton (gossypium hirsutum l. cv. svpr2). | in the present investigation, the influence of different forms of cytokinins, auxins and polyamines were tested for mass multiplication and regeneration of cotton. initially, for the identification of effective concentration for multiple shoot induction, various concentrations of bap, kin and 2ip along with iaa and naa were tested. among tested concentrations, media fortified with ms salts; b5 vitamins; 30 g/l, glucose; 2.0 mg/l, 2ip; 2.0 mg/l, iaa and 0.7 % agar showed best response for multipl ... | 2006 | 16784123 |
broiler litter as a micronutrient source for cotton: concentrations in plant parts. | analytically, poultry litter contains nearly all essential micronutrients but the extent of phytoavailability of these nutrients and whether cotton (gossypium hirsutum l.) and other crop plants can receive adequate amounts of these nutrients from litter is not fully known. the objective of this research was to determine whether cotton receives sufficient amounts of fe, cu, mn, and zn from litter and estimate the efficiency of cotton in extracting these metal nutrients from litter in the absence ... | 2006 | 16091623 |
isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (gossypium hirsutum l.). | due to the important role of cotton drought-tolerant varieties and the reported involvement in this trait of trehalose-6-phosphate-synthase, the respective gene (tps) was isolated and characterized from cultivated cotton, gossypium hirsutum (zeta 2 cultivar), using a chromosome-walking technique. tps has three exons comprising the coding region. southern blot analysis indicated that the gossypium genomes (a and d) contain a single copy of tps per genome. in addition, the expression of this gene ... | 2006 | 16086175 |
effect of racemic and (+)- and (-)-gossypol on the survival and development of helicoverpa zea larvae. | gossypol is a sesquiterpene that occurs naturally in seed and other parts of the cotton plant. because of restricted rotation around the binaphthyl bond, it occurs naturally as enantiomeric mixtures with (+)-gossypol to (-)-gossypol ratios that vary between 97:3 and 31:69. commercial cotton varieties (gossypium hirsutum) normally exhibit an approximate 3:2 ratio. (+)-gossypol is significantly less toxic than (-)-gossypol to nonruminant animals; thus, cottonseed containing high levels of (+)-goss ... | 2006 | 16739016 |
sampling methods, dispersion patterns, and fixed precision sequential sampling plans for western flower thrips (thysanoptera: thripidae) and cotton fleahoppers (hemiptera: miridae) in cotton. | a 2-yr field study was conducted to examine the effectiveness of two sampling methods (visual and plant washing techniques) for western flower thrips, frankliniella occidentalis (pergande), and five sampling methods (visual, beat bucket, drop cloth, sweep net, and vacuum) for cotton fleahopper, pseudatomoscelis seriatus (reuter), in texas cotton, gossypium hirsutum (l.), and to develop sequential sampling plans for each pest. the plant washing technique gave similar results to the visual method ... | 2006 | 16686161 |
complete assignment of the chromosomes of gossypium hirsutum l. by translocation and fluorescence in situ hybridization mapping. | significant progress has been made in the construction of genetic maps in the tetraploid cotton gossypium hirsutum. however, six linkage groups (lgs) have still not been assigned to specific chromosomes, which is a hindrance for integrated genetic map construction. in the present research, specific bacterial artificial chromosome (bac) clones constructed in g. hirsutum acc. tm-1 for these six lgs were identified by screening the bac library using linkage group-specific simple-sequence repeats ma ... | 2006 | 16609860 |
physical mapping of the rf1 fertility-restoring gene to a 100 kb region in cotton. | cytoplasmic male sterility (cms) plays an important role in crop heterosis exploitation. determining one or more nuclear genes that can restore male fertility to cms is essential for developing hybrid cultivars. genetic and physical mapping is the standard technique required for isolating these restoration genes. by screening 2,250 simple sequence repeat (ssr) primer pairs in cotton (gossypium hirsutum l.), we identified five new ssr markers that are closely linked to the rf1 gene, a fertility r ... | 2006 | 16544127 |
cotton defoliant runoff as a function of active ingredient and tillage. | cotton (gossypium hirsutum l.) defoliant runoff was recently identified as an ecological risk. however, assessments are not supported by field studies. runoff potential of three defoliant active ingredients, dimethipin (2,3-dihydro-5,6-dimethyl-1,4-dithiin 1,1,4,4-tetraoxide), thidiazuron (n-phenyl-n-1,2,3-thidiazol-5-yl-urea), and tribufos (s,s,s-tributyl phosphorotrithioate) was investigated by rainfall simulation on strip (st) and conventionally tilled (ct) cotton in south central georgia. si ... | 2006 | 14674540 |
infraspecific dna methylation polymorphism in cotton (gossypium hirsutum l.). | cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. relatively little information exists, however, on levels and patterns of methylation polymorphism (mp) at homologous loci within species. here we explored the levels and patterns of methylation-polymorphism diversity at ccgg sites within allotetraploid cotton, gossypium hirsutum, using a ... | 2006 | 16987937 |
gene action and morphological characteristics of pink flower and pink filament mutants in cotton (gossypium hirsutum l.). | 2006 | 17406101 | |
[structural-functional organization of chloroplasts in leaves of xantha-702 mutant of gossypium hirsutum l]. | for cotton mutant xantha (gossypium hirsutum l.), it has been established that synthesis of 5-aminolevulinic acid was blocked in the light. in the light this mutant accumulates chlorophyll by 30 times lower as compared to the parent type. in mutant xantha, a very few pigment-protein complexes of ps-i and ps-ii are formed in chloroplasts, and formation of membrane system in these is blocked at the early stages, in most cases, at the stage of bubbles and single short thylakoids. functional activit ... | 2006 | 17087145 |
[cloning of ghaqp1 gene and its specific expression during ovule development in cotton]. | plant aquaporins, belonging to the mip superfamily, are a series of transmembrane proteins that facilitate water transport through cell membranes. in this study, a cdna clone encoding the pip1-like protein was isolated from cotton (gossypium hirsutum) cdna libraries, and designated as ghaqp1 (fig.1). we also isolated the ghaqp1 gene from cotton genome by pcr. the gene is 2,096 bp in length, including an open reading frame (orf) and 5'-/3'-untranslated regions (utr). it contains two introns in it ... | 2006 | 17075177 |
foliar washoff potential and simulated surface runoff losses of trifloxysulfuron in cotton. | the surface runoff potential of trifloxysulfuron {n-[(4,6-dimethoxy-2-pyrimidinyl)carbamoyl]-3-(2,2,2-trifluoroethoy)-pyridin-2-sulfonamide sodium salt} in cotton (gossypium hirsutum l.) production systems has not been evaluated. the objectives of this study were to (i) determine sorption/desorption coefficients for trifloxysulfuron; (ii) quantify foliar washoff of trifloxysulfuron when applied to cotton at the five-leaf stage; and (iii) determine the surface runoff potential of trifloxysulfuron ... | 2006 | 16848537 |
molecular cloning of a peroxidase gene from poplar and its expression in response to stress. | to elucidate the precise functions of peroxidase in poplar (populus alba x p. tremula var. glandulosa), we cloned a peroxidase gene (popod1) from poplar suspension culture cells and examined its expression pattern in response to various stresses. popod1 showed the highest homology with a bacterial-induced peroxidase gene from cotton (gossypium hirsutum l.). the popod1 gene encodes a putative 316 amino acid protein with an n-terminal signal peptide of 23 residues. the dna blot analysis indicated ... | 2006 | 16877325 |
the peroxidative coupling of hemigossypol to (+)- and (-)-gossypol in cottonseed extracts. | peroxidase(s) present in embryo extracts of gossypium hirsutum cv. texas marker 1 catalyzed a bimolecular coupling of [4-(3)h]-hemigossypol to [4,4'-(3)h(2)]-gossypol. the reaction was dependent on the addition of h(2)o(2) and was inhibited 71-94% by 1 and 10mm sodium azide. the phenolic coupling produced 53% (+)-gossypol and 47% (-)-gossypol in close agreement to the 49% (+)-gossypol and 51% (-)-gossypol found in the intact seed. the nearly racemic mixture of (+)-and (-)-gossypol produced in th ... | 2006 | 16403543 |
accumulation of genome-specific transcripts, transcription factors and phytohormonal regulators during early stages of fiber cell development in allotetraploid cotton. | gene expression during the early stages of fiber cell development and in allopolyploid crops is poorly understood. here we report computational and expression analyses of 32 789 high-quality ests derived from gossypium hirsutum l. texas marker-1 (tm-1) immature ovules (gh_tmo). the ests were assembled into 8540 unique sequences including 4036 tentative consensus sequences (tcs) and 4504 singletons, representing approximately 15% of the unique sequences in the cotton est collection. compared with ... | 2006 | 16889650 |
oviposition deterrents in larval frass of the cotton boll worm, helicoverpa armigera (lepidoptera: noctuidae): chemical identification and electroantennography analysis. | oviposition deterrents in the frass of cotton bollworm (cbw), helicoverpa armigera larvae fed on an artificial diet (fa) and on cotton gossypium hirsutum leaves (fc) were investigated by behavioral bioassays and electroantennography analyses in the laboratory. it was found that a water suspension or a hexane extract of the frass fa or fc, in contrast to the corresponding foods, significantly deterred oviposition of conspecifics. when hexane extracts of the frass fa and fc were further partitione ... | 2006 | 16388821 |
soil microbial activity is affected by roundup weathermax and pesticides applied to cotton (gossypium hirsutum). | adoption of glyphosate-based weed control systems has led to increased use of the herbicide with continued use of additional pesticides. combinations of pesticides may affect soil microbial activity differently than pesticides applied alone. research was conducted to evaluate the influence of glyphosate-based cotton pest management systems on soil microbial activity. soil was treated with commercial formulations of trifluralin, aldicarb, and mefenoxam + pentachloronitrobenzene (pcnb) with or wit ... | 2006 | 16968086 |
a rapid single-step multiplex method for discriminating between trichogramma (hymenoptera: trichogrammatidae) species in australia. | inaccurate species identification confounds insect ecological studies. examining aspects of trichogramma ecology pertinent to the novel insect resistance management strategy for future transgenic cotton, gossypium hirsutum l., production in the ord river irrigation area (oria) of western australia required accurate differentiation between morphologically similar trichogramma species. established molecular diagnostic methods for trichogramma identification use species-specific sequence difference ... | 2006 | 17195685 |
characteristics, development and mapping of gossypium hirsutum derived est-ssrs in allotetraploid cotton. | in order to construct a saturated genetic map and facilitate marker-assisted selection (mas) breeding, it is necessary to enhance the current reservoir of known molecular markers in gossypium. microsatellites or simple sequence repeats (ssrs) occur in expressed sequence tags (est) in plants. many ests are publicly available now and represent a good tool in developing est-ssrs. from 13,505 ests developed from our two cotton fiber/ovule cdna libraries constructed for upland cotton, 966 (7.15%) con ... | 2006 | 16341684 |
efficient delivery of small interfering rna to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing. | small interfering rna (sirna) induced posttranscriptional gene silencing (ptgs) has been an efficient method for genetic and molecular analysis of certain developmental and physiological processes and represented a potential strategy for both controlling virus replication and developing therapeutic products. however, there are limitations for the methods currently used to deliver sirna into cells. we report here, to our knowledge, the first efficient delivery of sirna to plant cells by a nanosec ... | 2006 | 22980207 |
ratios of (+)- and (-)-gossypol in leaves, stems, and roots of selected accessions of gossypium hirsutum var. marie galante (watt) hutchinson. | gossypol is an allelochemical that occurs naturally throughout the cotton plant as an enantiomeric mixture. gossypol and related terpenoids protect the plant from some insect herbivores. cottonseed has a high protein content, but it is underutilized because (-)-gossypol, which is toxic to nonruminants, occurs in the seed along with (+)-gossypol. commercial upland cottons usually have an approximate 3:2 (+)- to (-)-gossypol ratio in the seed, but plants can be bred with <8% (-)-gossypol using acc ... | 2006 | 16506812 |
xenia effect on seed and embryo size in cotton (gossypium hirsutum l.). | the term xenia was coined to describe the effect of foreign pollen on the development and characters of the seed. to study its importance and consequences for various seed traits in cotton (gossypium hirsutum l.), the effect of pollen genotype on seed and embryo weight was studied with seeds from 15 f1 hybrids. cross-fertilization changed seed weight by up to 7.0% in relation to self-fertilization. xenia effect significantly increased embryo weight of cross-fertilized seeds, by up to 14.4% in co ... | 2006 | 17132897 |
[spectral characteristics and the structure of chloroplasts upon blocking the early stages of chlorophyll biosynthesis]. | the cotton mutant xantha (gossypium hirsutum l.) with the blocked synthesis of 5-aminolevulinic acid in the light has been shown to accumulate chlorophyll 30 times less than the parent type. in chloroplasts of the mutant xantha, the formation of the membrane system is blocked at the earliest stages, mainly at the stage of bubbles and single short thylakoids. only light-harvesting chlorophyll-a/b-protein complexes i and ii with chlorophyll fluorescence maxima at 728 and 681 nm, respectively, are ... | 2006 | 16909851 |
cotton genome mapping with new microsatellites from acala 'maxxa' bac-ends. | fine mapping and positional cloning will eventually improve with the anchoring of additional markers derived from genomic clones such as bacs. from 2,603 new bac-end genomic sequences from gossypium hirsutum acala 'maxxa', 1,316 pcr primer pairs (designated as musb) were designed to flank microsatellite or simple sequence repeat motif sequences. most (1164 or 88%) musb primer pairs successfully amplified dna from three species of cotton with an average of three amplicons per marker and 365 marke ... | 2006 | 16501995 |
effect of monosodium methanarsonate application on cuticle wax content of cocklebur and cotton plants. | leaf cuticle waxes were extracted from monosodium methanearsonate (msma)-resistant (r) and -susceptible (s) common cocklebur (xanthium strumarium l.) and cotton (gossypium hirsutum l.) plants at 0, 3, 5, and 7 days after treatment (dat) following 1x and 2x msma applications. wax constituents were analyzed by gas chromatography (gc) with flame ionization detection and compared to alkane and alcohol standards of carbon lengths varying from c21 to c30. differences in waxes were calculated and repor ... | 2006 | 16893783 |
a global assembly of cotton ests. | approximately 185,000 gossypium est sequences comprising >94,800,000 nucleotides were amassed from 30 cdna libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. these libraries were derived from allopolyploid cotton (gossypium hirsutum; a(t) and d(t) genomes) as well as its two diploid progenitors, gossypium arboreum (a genome) and gossypium raimondii (d genome). ests were assembled using the program for assembli ... | 2006 | 16478941 |
transcriptome profiling, molecular biological, and physiological studies reveal a major role for ethylene in cotton fiber cell elongation. | upland cotton (gossypium hirsutum) produces the most widely used natural fibers, yet the regulatory mechanisms governing fiber cell elongation are not well understood. through sequencing of a cotton fiber cdna library and subsequent microarray analysis, we found that ethylene biosynthesis is one of the most significantly upregulated biochemical pathways during fiber elongation. the 1-aminocyclopropane-1-carboxylic acid oxidase1-3 (aco1-3) genes responsible for ethylene production were expressed ... | 2006 | 16461577 |
developmental and gene expression analyses of a cotton naked seed mutant. | cotton fiber development is a fundamental biological phenomenon, yet the molecular basis of fiber cell initiation is poorly understood. we examined molecular and cellular events of fiber cell development in the naked seed mutant (n1n1) and its isogenic line of cotton (gossypium hirsutum l. cv. texas marker-1, tm-1). the dominant mutation not only delayed the process of fiber cell formation and elongation but also reduced the total number of fiber cells, resulting in sparsely distributed short fi ... | 2006 | 16254724 |
soil organic carbon sequestration in cotton production systems of the southeastern united states: a review. | past agricultural management practices have contributed to the loss of soil organic carbon (soc) and emission of greenhouse gases (e.g., carbon dioxide and nitrous oxide). fortunately, however, conservation-oriented agricultural management systems can be, and have been, developed to sequester soc, improve soil quality, and increase crop productivity. our objectives were to (i) review literature related to soc sequestration in cotton (gossypium hirsutum l.) production systems, (ii) recommend best ... | 2006 | 16825457 |
[nucleotide sequence of internal transcribed spacers and 5.8s rdna for the ribosomal operon from alfalfa medicago sativa and cotton gossypium hirsutum l]. | the 708- and 769-bp fragments from alfalfa and cotton containing the 3'-end of the 18s gene, the internal transcribed spacer. 1 (its1) the 5.8s gene, its2, and the 5'-end of the 28s gene were obtained using primers to the 18s and 28s ends of rdna from tomato by a polymerase chain reaction. these sequences were cloned into ptz19r. the 5.8s rdna, its1 and its2 nucleotide sequences of alfalfa and cotton were determined. comparative analysis of nucleotide sequences of alfalfa and cotton showed large ... | 2006 | 8145750 |
[molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. | using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to c-terminal peptides ggaactcccttttctggatagctcacc and cctggtccgaacccaaacaggacgcccc, were used to amplify, via polymerase chain reaction, genomic sequences from two gossypium species, a diploid gossypium herbaceum, and a tetraploid gossypium hirsutum cv. 108f. amplified dna was separated into individual sequences by cloning into an m13 vector. six diff ... | 2006 | 1339958 |
selectivity of pesticides used on cotton (gossypium hirsutum) to trichogramma pretiosum reared on two laboratory-reared hosts. | the side-effects of pesticides (insecticides, fungicides, herbicides and plant growth regulators) used on cotton were tested on adults and pupae of trichogramma pretiosum riley reared in the laboratory on two different hosts, the angoumois grain moth (sitotroga cerealella olivier) and the mediterranean flour moth (ephestia kuehniella (zeller)). the eggs of the host enclosing the parasitoid pupae received direct pesticide sprays, while the adults of the parasitoid were exposed to the pesticides t ... | 2006 | 16308868 |
enzyme activities and arylsulfatase protein content of dust and the soil source: biochemical fingerprints? | little is known about the potential of enzyme activities, which are sensitive to soil properties and management, for the characterization of dust properties. enzyme activities may be among the dust properties key to identifying the soil source of dust. we generated dust (27 and 7 microm) under controlled laboratory conditions from agricultural soils (0-5 cm) with history of continuous cotton (gossypium hirsutum l.) or cotton rotated with peanut (arachis hypogaea l.), sorghum [sorghum bicolor (l. ... | 2006 | 15356225 |
comparative study of the five biological parameters of cotton whitefly bemisia tabaci and silverleaf whitefly b. argentifolii bellows and perring reared on cotton under laboratory condition. | the five biological parameters of sweetpotato whitefly, bemisia tabaci (genn.) and silverleaf whitefly bemisia argentifolii bellows and perring (hom: aleyrodidae) as an important pest of cotton were compared on cotton in laboratory condition. the infested leaves containing nymphs and pupae were collected from cotton fields in iran. experiments were conducted in a growth chamber under 24+/-2 degrees c, 55+/-3% rh and 16:8 (l:d) photoperiod on cotton, gossypium hirsutum l. the newly emerged popula ... | 2006 | 17385531 |
the gh3 family in plants: genome wide analysis in rice and evolutionary history based on est analysis. | the gh3 gene family in arabidopsis, implicated in hormonal homeostasis through the conjugation of indolacetic and jasmonic acids to amino acids, is involved in a broad range of plant growth and development processes. in this work, the analysis of the gh3 family in the genome of oryza sativa identified 13 hypothetical orfs. est analysis and rt-pcr assays demonstrated that 12 of them were active genes. an extensive est analysis of the gh3 family performed on 26 plant species was used to estimate t ... | 2006 | 16488558 |
how do leaf hydraulics limit stomatal conductance at high water vapour pressure deficits? | a reduction in leaf stomatal conductance (g) with increasing leaf-to-air difference in water vapour pressure (d) is nearly ubiquitous. ecological comparisons of sensitivity have led to the hypothesis that the reduction in g with increasing d serves to maintain leaf water potentials above those that would cause loss of hydraulic conductance. a reduction in leaf water potential is commonly hypothesized to cause stomatal closure at high d. the importance of these particular hydraulic factors was te ... | 2006 | 16898024 |
qtl mapping for resistance to root-knot nematodes in the m-120 rnr upland cotton line (gossypium hirsutum l.) of the auburn 623 rnr source. | root-knot nematodes meloidogyne incognita (kofoid and white) can cause severe yield loss in cotton (gossypium hirsutum l.). the objectives of this study were to determine the inheritance and genomic location of genes conferring root-knot nematode resistance in m-120 rnr, a highly resistant g. hirsutum line with the auburn 623 rnr source of resistance. utilizing two interspecific f(2) populations developed from the same m-120 rnr by gossypium barbadense (cv. pima s-6) cross, genome-wide scanning ... | 2006 | 16960714 |
phenotypic expression of rkn1-mediated meloidogyne incognita resistance in gossypium hirsutum populations. | the root-knot nematode meloidogyne incognita is a damaging pest of cotton (gossypium hirsutum) worldwide. a major gene (rkn1) conferring resistance to m. incognita was previously identified on linkage group a03 in g. hirsutum cv. acala nemx. to determine the patterns of segregation and phenotypic expression of rkn1, f(1), f(2), f(2:3), bc(1)f(1) and f(2:7) recombinant inbred lines (ril) from intraspecific crosses between acala nemx and a closely related susceptible cultivar acala sj-2 were inocu ... | 2006 | 19259455 |