Publications

TitleAbstractYear(sorted ascending)
Filter
PMID
Filter
prevalence of leptospira interrogans serovar hardjo antibodies in milk in belgian dairy herds.pooled milk samples were collected from 2000 belgian dairy herds in the autumn of 1989. antibodies against leptospira interrogans serovar hardjo were detected in 9.2% of the herds, with the incidence being higher in the southern part of the country.19911882491
effect of heat or formalin treatment of leptospires on antibody response detected by immunoblotting.leptospira interrogans serovar icterohaemorrhagiae rga (rga), live or heated at 56 degrees c for 15 min or treated with formalin, was injected into rabbits to prepare hyperimmune serum. the pathogens l. interrogans serovars icterohaemorrhagiae rga, icterohaemorrhagiae 1, canicola moulton, grippotyphosa andaman, hardjo hardjoprajitno, and pomona pomona and the nonpathogen leptospina biflexa serovar patoc patoc 1 were processed for sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and aft ...19911885754
detection and characterization of leptospiral antigens using a biotin/avidin double-antibody sandwich enzyme-linked immunosorbent assay and immunoblot.a biotin/avidin double-antibody sandwich enzyme-linked immunosorbent assay (elisa) for the detection of antigens of leptospira interrogans serovars in experimentally inoculated bovine urine samples was evaluated. immunoglobulin g (igg) from rabbits immunized with l. interrogans serovar hardjo type hardjobovis sonicated, whole cell, and formalinized-heated antigen preparations were purified by a protein a-superose column coupled to fast protein liquid chromatography, and evaluated for species spe ...19911889035
serological follow-up of patients involved in a localized outbreak of leptospirosis.eighteen patients involved in a localized outbreak of leptospirosis were subjected to a serological follow-up study over a 5-year period. four distinct sets of sera from all patients and a fifth sample obtained from 10 of them were examined by the microscopic agglutination test (mat) for demonstration of leptospiral antibodies. the test was carried out by using live leptospires from reference strains of 17 leptospira interrogans serovars known to occur in italy. in all cases, the highest titers ...19911890181
diagnosis and prevalence of leptospira infection in aborted and stillborn horses.a study was conducted to evaluate a recently available fluorescent antibody test (fat) conjugate for the detection of leptospires in tissues of aborted and stillborn horses, to determine the leptospira antibody titers and compare serologic test results with fat results, and to determine the prevalence of leptospira-induced abortions and stillbirths in the equine population of central kentucky. from july 1, 1988 through june 30, 1989, 15 (2.5%) of 594 submissions (fetuses, stillborn foals, and/or ...19911892931
reproductive failure associated with leptospira interrogans serovar bratislava infection of swine.specimens from 17 swine herds experiencing reproductive failure were examined for leptospira interrogans serovar bratislava. clinical signs observed in these herds included stillborn pigs, weak neonatal pigs, and abortion. diagnostic tests used to determine l. interrogans serovar bratislava infection were bacteriologic culture, serologic assays to detect antibodies, and immunofluorescence. examination of fetal serum for antibodies against serovar bratislava and a fluorescent antibody test were t ...19911892932
characterization of outer membrane and secreted proteins of leptospira interrogans serovar pomona.outer membrane and secreted proteins were isolated from leptospira interrogans serovar pomona and characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis, immunoblot and radioimmunoprecipitation techniques. the l. interrogans outer membranes were extracted with triton x-114 and contained several proteins. the major cellular protein with a molecular mass of 31 kda was associated exclusively with the l. interrogans outer membrane. using a whole cell immunoprecipitation method, f ...19911895930
experimental lethal infection of leptospira interrogans in mice treated with cyclophosphamide.after preadministration of cyclophosphamide (300 mg/kg), balb/c mice were lethally infected with leptospira interrogans serovar lai and a virulent strain of leptospira interrogans serovar copenhageni, and leptospiral cells were detected in both kidneys of infected mice by indirect immunofluorescent assay. nonpathogenic leptospirae, leptospira biflexa serovar patoc, leptonema illini, and an avirulent strain of l. interrogans serovar copenhageni, were not parasitic to the mice treated with cycloph ...19911913341
the use of methanol extract of leptospira interrogans in complement fixation tests for leptospirosis.methanol extracts were obtained from l. interrogans serovars icterohaemorrhagiae and canicola and l. biflexa serovar patoc. human sera from 167 normal individuals and 40 patients with different infectious diseases tested by complement fixation tests showed negative reactions. sera from 100 patients with a suspicion of leptospirosis were tested by complement fixation tests and microscopic agglutination reactions. agreement of 84% was found for those two reactions. positive microscopic agglutinati ...19911913350
leptospira interrogans serovar bratislava infection in two dogs.two dogs with clinical histories suggestive of leptospirosis were examined serologically and culturally for evidence of leptospiral infection. antibodies to leptospira interrogans serovar bratislava were detected in serum from one dog, and the organism was isolated from urine of that dog. in a serologic survey of dogs in the state of illinois, reactor rates to bratislava were higher than those to canicola or icterohaemorrhagiae. in cases of suspect canine leptospirosis, serovars such as bratisla ...19911917641
phylogenetic analysis of the spirochetes.the 16s rrna sequences were determined for species of spirochaeta, treponema, borrelia, leptospira, leptonema, and serpula, using a modified sanger method of direct rna sequencing. analysis of aligned 16s rrna sequences indicated that the spirochetes form a coherent taxon composed of six major clusters or groups. the first group, termed the treponemes, was divided into two subgroups. the first treponeme subgroup consisted of treponema pallidum, treponema phagedenis, treponema denticola, a thermo ...19911917844
a comparative investigation and identification of leptospira interrogans serogroup icterohaemorrhagiae strains by monoclonal antibody and dna fingerprint analyses.the identification of leptospira interrogans icterohaemorrhagiae strains from a number of reference laboratories were confirmed using monoclonal antibody (moab) and dna restriction endonuclease (ecor1) analyses. with a few exceptions, strain fidelity was demonstrated. three clinical isolates and one isolate from a rat (rattus norvegicus) were identified on dna fragment patterns and found to be similar to the reference strains, icterohaemorrhagiae copenhageni, i. "icterohaemorrhagiae" ictero i an ...19911930573
genome conservation in isolates of leptospira interrogans.reference strains for each of the 23 serogroups of leptospira interrogans yielded different pulsed-field gel electrophoresis patterns of noti digestion products. this was also the case for the 14 serovars belonging to serogroup icterohaemorrhagiae (with one exception). the noti restriction patterns of 45 clinical leptospiral isolates belonging to serovar icterohaemorrhagiae were analyzed and compared with those of type strains. no differences were observed between isolates from countries of diff ...19911938954
identification of related dna sequences in borrelia burgdorferi and two strains of leptospira interrogans by using polymerase chain reaction.the suitability of a polymerase chain reaction assay for borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of leptospira interrogans and lysates of fixed adult ixodes tick tissues. two false positives representing leptospires were differentiated from b. burgdorferi by using an oligonucleotide probe.19911939594
the role of the common vole (microtus arvalis) in the epidemiology of bovine infection with leptospira interrogans serovar hardjo.control of leptospirosis in cattle depends on the presence of other possible maintenance hosts, with which cattle may have contact. twenty-seven common voles (microtus arvalis) were trapped on a dairy farm where the cattle were infected with leptospira interrogans serovar hardjo (hardjo). in the sera of 11 voles, titres greater than or equal to 100 against serogroup grippotyphosa were measured with the microscopical agglutination test (mat). from 8 of these 11 voles, which also showed interstiti ...19911949549
the influence of maternal antibody and age of calves on effective vaccination against leptospira interrogans serovar hardjo.twelve seronegative cows were vaccinated with an experimental bivalent leptospira interrogans serovars hardjo and pomona vaccine late in their first pregnancy. calves born of these dams were divided into 4 equal groups that received this vaccine at 4, 6, 10 and 18 weeks of age, respectively. before vaccination the group geometric mean titres of maternally-derived circulating antibodies ranged from 2 to 25 for the microscopic agglutination (ma) test and 3 to 35 for enzyme-linked immunosorbent ass ...19911953564
potency of leptospiral vaccines and protection against chronic infection in golden hamsters.seven vaccines prepared from pathogenic strains of different origin of leptospira interrogans [serovars icterohaemorrhagiae (one strain) and copenhageni (6 strains)] were examined in protection tests on golden hamsters. two of the copenhageni strains were used for challenge. the organs (kidneys, spleen, liver) in the vaccinated animals surviving challenge were protected to a varying degree. low rates of survival were associated with a high incidence of leptospira-positive findings, partly connec ...19911959318
biotinylated probes to detect leptospira interrogans on dot blot hybridization or by in situ hybridization.total genomic biotinylated probes which can identify leptospires by hybridization on filters or by in situ hybridization are described in this study. according to the weak g + c content of the strains studied (35-39%) and owing to the decreasing melting temperature (tm) due to overbiotinylation, hybridization and wash temperatures were optimized at 33 degrees c and at 42 degrees c respectively. fourteen serovars of leptospira interrogans belonging to 11 different serogroups and three serovars of ...19911367181
pulsed-field gel electrophoretic analysis of leptospiral dna.the genomic structures of spirochete species are not well characterized, and genetic studies on these organisms have been hampered by lack of a genetic exchange mechanism in these bacteria. in view of these observations, pulsed-field gel electrophoresis was used to examine the genomes of leptospira species. live cells, prepared in agarose plugs, were lysed in situ, and the dna was analyzed under different electrophoretic conditions. pulsed-field gel electrophoresis of dna digested with infrequen ...19911987046
changes in the surface of leptospira interrogans serovar grippotyphosa during in vitro cultivation.surface components of virulent and attenuated leptospira interrogans serovar grippotyphosa were compared by using triton x-114 solubilization and phase partitioning, immunoprecipitation of intact organisms, and freeze-fracture electron microscopy. removal of the leptospiral outer membrane by using 0.1% triton x-114 was demonstrated by whole-mount electron microscopy and by essentially complete solubilization of a lipopolysaccharidelike substance (lls) from the outer membrane. triton x-114 (0.1%) ...19911997416
heat shock response of spirochetes.we examined the heat shock response of the pathogenic spirochetes treponema pallidum, borrelia burgdorferi, and leptospira interrogans and certain saprophytic spirochetes. cellular proteins synthesized after shifts to higher temperatures were [35s]methionine labeled and analyzed by gel electrophoresis and fluorography. only t. pallidum failed to exhibit an obvious heat shock response. groel and dnak homologs were identified in the various species, although these proteins were not thermoinducible ...19912004832
[leptospirosis in swine; observations on the serological diagnosis of leptospira interrogans serotype bratislava].leptospirosis is considered to be an important cause of porcine reproductive failure. in this respect recently attention is paid to the possible role of leptospira interrogans serotype bratislava (bratislava). in the present paper the results of serotype bratislava serology conducted on three farms are presented and discussed. on two of the farms no reproductive failure was observed. on the third farm with a high percentage of return to service a longitudinal search was done. no relation could b ...19912008705
protein and antigen profiles of prevalent serovars of leptospira interrogans.whole-cell and detergent-soluble proteins, enriched for outer membrane antigens, of the leptospira interrogans serovars present in commercially available pentavalent vaccines (hardjo, pomona, icterohaemorrhagiae, grippotyphosa, and canicola) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blotting (immunoblotting). protein and antigenic profiles of these serovars, representing several serogroups, were compared with similar profiles of the most common north ...19912019441
serologic survey for bovine pathogens in free-ranging european bison from poland.from 1980 to 1983, blood was taken from 60 selected european bison (bison bonasus) in poland. serum samples were tested for the presence of antibodies against brucella abortus, 14 serovars of leptospira interrogans, chlamydia spp., coxiella burnetti; foot and and mouth disease virus, bovine leukemia virus and bovine herpes virus-1. in addition, an attempt was made to isolate bovine herpes virus-1 from the prepuce of selected bulls. serological tests suggested chlamydial infection in 28 bison, su ...19912023316
the serological response of calves to leptospira interrogans serovar hardjo vaccines and infection as measured by the microscopic agglutination test and anti-igm and anti-igg enzyme-linked immunosorbent assay.the microscopic agglutination test (mat) and the anti-igm and anti-igg enzyme-linked immunosorbent assays (elisa) were used to examine sera taken over the course of 16 weeks from 35 calves vaccinated and/or infected with leptospira interrogans serovar hardjo. the relationship between the igm and igg responses to vaccination and infection were determined. the rapid and high rise in igm levels following challenge made the anti-igm elisa a potentially good indicator of recently established infectio ...19912024440
differential susceptibility of two stocks of mongolian gerbils (meriones unguiculatus) to leptospira.mongolian gerbils (meriones unguiculatus) of tumble blook (tum) and japan medical science (jms) stocks were compared with regard to susceptibility to leptospira interrogans serovar copenhageni. the tum gerbil died 6 to 9 d after intraperitoneal inoculation with 10 organisms, showing jaundice and systemic hemorrhage. however, 25% of the jms gerbils survived infection with 10(3) or 10(4) organisms and there was no fatal case after infection with 10(2) organisms.19912025654
serological and cultural examination for human leptospirosis in plateau state, nigeria.in a serological examination of 710 serum samples collected from human volunteers in plateau state, nigeria, 128 (18.0pc) had leptospiral antibody titres of 1:100 and above. the prevalence of antibodies to individual serovars were: hardjo 28 (21.9pc), pomona 18 (14.1pc), canicola 17 (13.3pc), grippotyphosa 15 (11.7pc), pyrogenes 13 (10.2pc), icterohaemorrhagiae 12 (0.4pc) and autumnalis 8 (6.3pc). there was no statistical difference in the prevalence rate of leptospirosis in the different local ...19912060002
seroepidemiology of leptospirosis in minnesota wolves.serum samples (n = 457) from wolves (canis lupus) in northern minnesota were collected from 1972 through 1986 and were tested for antibodies against leptospira interrogans using a microtiter agglutination test. twelve serovars included in the study were: australis, autumnalis, ballum, bataviae, bratislava, canicola, copenhageni, grippotyphosa, hardjo, pomona, pyrogenes, and tarassovi. fifty-two (11%) sera had antibody titers of greater than or equal to 1:50 against one or more serovars of l. int ...19912067045
restriction endonuclease analysis as a taxonomic tool in the study of pig isolates belonging to the australis serogroup of leptospira interrogans.restriction endonuclease analysis was performed on dnas from the type strains of the australis serogroup of leptospira interrogans by using 20 restriction enzymes, and the electrophoretic patterns obtained were compared with patterns obtained from 162 australis serogroup isolates from pigs. it proved to be a quick and reliable method for typing such strains. all of the pig isolates were identified as either serovar bratislava or muenchen. it also showed differences at the subserovar level which ...19911647408
nucleotide sequence of a repetitive element isolated from leptospira interrogans serovar hardjo type hardjo-bovis.a repetitive element from the genome of leptospira interrogans serovar hardjo type hardjo-bovis ('l. hardjo-bovis') was identified, cloned and sequenced. similar sequences were shown by hybridization to be encoded by a further eight of 32 other leptospiral serovars tested. an undefined number of repetitive elements were located in the l. hardjo-bovis genome; sequence degeneracy of the elements was observed and no significant open reading frames were identified within the at-rich (60%) 1467 bp re ...19911650813
prevalence of pseudorabies virus infection and associated infections in six large swine herds in illinois.sera were collected from 6 large farrow-to-finish swine herds infected with pseudorabies virus (prv) in illinois. all herds were participating in the large herd cleanup study, a usda-initiated project to evaluate the feasibility of eradicating pseudorabies from large farms (greater than 400 sows) by use of a combination of vaccination and management changes. herd size ranged between 425 and 1,500 breeding females. between april and july 1990, sera for measurement of prv antibodies were obtained ...19911651912
serologic survey for selected microbial pathogens in bison from kansas.a serologic survey was conducted on an american bison (bison bison) herd in kansas for antibodies against brucella spp., leptospira interrogans serovar canicola, pomona, grippotyphosa, icterohaemorrhagiae, and hardjo, anaplasma spp., bluetongue virus, infectious bovine rhinotracheitis virus and bovine viral diarrhea virus. there was an increase in prevalence of bluetongue antibodies from 38% in 1987 to 100% in 1989 in animals greater than or equal to 24-mo-old. prevalences of antibodies against ...19911656107
physical map of chromosomal and plasmid dna comprising the genome of leptospira interrogans.the size and physical structure of the leptospira interrogans genome was characterized using contour-clamped homogenous electric field (chef) gel electrophoresis. the l. interrogans genome is approximately 4750 kb in size and is composed of two molecular species of dna: a 4400 kb chromosome; and a 350 kb plasmid, plin1. a physical map of the chromosome was constructed with the restriction enzymes noti and sfii. a physical map of plin1 was constructed with apai, noti, sse83871, sgrai, and smai. b ...19911656379
prevalence of antibodies to five selected zoonosis agents in monkeys.the prevalence of antibodies against 5 zoonosis agents was determined in serum samples of 443 breeding monkeys. of the monkeys, 296 were bred or kept for a long time at r institute, and the remaining 147 were newly imported from the philippines and kept at s institute for quarantine. antibodies to simian virus 40 were highly prevalent at 89.1% among monkeys of r institute, whereas no antibody could be detected in those of s institute. antibodies to chlamydia psittaci and yersinia pseudotuberculo ...19911657210
detection of leptospiraceae by amplification of 16s ribosomal dna.the polymerase chain reaction (pcr) was developed to detect leptospiraceae. primers were used to amplify 1 631 base-pair (bp) 5'-region of 16s rdna. representative strains from the species, leptospira interrogans sensu stricto, l. borgpetersenii, l. noguchii, l. santarosai, l. weilii, l. inadai, l. meyeri and the single member strain of leptonema were amplified. in contrast, strains representing the saprophytic species. l. biflexa, l. wolbachii and l. parva were not amplified. there was no pcr p ...19921372872
specific immunofluorescent staining of pathogenic treponemes with a monoclonal antibody.two hybrid cell lines which produced mouse monoclonal antibody to the dal-1 street strain of treponema pallidum subsp. pallidum were established. these monoclonal antibodies strongly reacted with t. pallidum subsp. pallidum (nichols strain, dal-1, and two other street strains, strains mn-1 and mn-3) and t. pallidum subsp. pertenue by indirect microimmunofluorescent antibody and enzyme-linked immunosorbent assay techniques, but they did not react with normal rabbit testicular tissue. these monocl ...19921374079
comparison of flanking regions of the 5s ribosomal ribonucleic acid genes in leptospira biflexa and leptospira interrogans.one of the genes encoding the 5s ribosomal ribonucleic acid (rrna) for the leptospira biflexa strain patoc i was isolated and sequenced. the physical maps of the 5s rrna genes in leptospira were constructed. the strains of leptospira biflexa had two genes on their chromosome; these two 5s rrna genes were located several kb apart and sequences flanking these genes were divergent. in contrast to saprophytic leptospires, maps in parasitic leptospires that had only one gene for 5s rrna on their geno ...19921376643
[homology study of leptospires by molecular hybridization].nick translation and random primer labelling method were applied to prepare three genomic dna probes from leptospira interrogans strain 017, leptospira biflexa strain patoc i and leptonema illini strain 3055, and then hybridized with dna of 17 strains leptospires from different genus, species, serogroup and serovar. the results showed no homology between leptospira and leptonema, and only a low degree of homology between l. interrogans and l. biflexa but it showed a high degree of homology among ...19921398616
polymerase chain reaction for detection of leptospira spp. in clinical samples.a sensitive assay for leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (pcr). a 331-bp sequence from the leptospira interrogans serovar canicola rrs (16s) gene was amplified, and the pcr products were analyzed by dna-dna hybridization by using a 289-bp fragment internal to the amplified dna. specific pcr products also were obtained with dna from the closely related nonpathogenic leptospira biflexa but not with dna from other spiro ...19921400983
renal dysfunction associated with infection of leptospira interrogans in a horse.renal failure associated with infection of leptospira interrogans was detected in a horse. fever, leukocytosis, pyuria, isosthenuria, and azotemia were suggestive of an inflammatory urinary tract disease. despite persistent pyuria, no bacteria were found during routine microscopic examinations or bacteriologic culturing of urine. a fluorescent antibody examination of the urine was positive for l interrogans. serologic testing during a 6-month period, supported an acute infection with l interroga ...19921429185
experimental infection of pregnant gilts with leptospira interrogans serovar mozdok.three pregnant gilts were experimentally infected with leptospires of the serovar mozdok, isolated from an aborted pig fetus from a portuguese pig farm with abortion problems. all the gilts aborted dead or dying piglets on days 105 or 106 of pregnancy. serovar mozdok was isolated from 12 of the 22 piglets in the three litters. histological examination of the livers and kidneys of the gilts at the end of the experiment revealed evidence of disease, and leptospires were isolated from their kidneys ...19921441176
c3 fixed in vivo to cornea from horses inoculated with leptospira interrogans.c3 was detected bound in vivo to the opaque cornea of horses inoculated with killed leptospira interrogans. employing epithelial corneal cells isolated from a monolayer in tissue culture, we proved that c3 is fixed in vitro to the intact cell surface after incubation with a fresh equine anti-leptospira serum. these findings, in addition to the infiltration of cornea with neutrophils and lymphocytes, may explain the mechanisms of tissue damage in recurrent uveitis of horses with leptospirosis.19921441226
scattering of the rrna genes on the physical map of the circular chromosome of leptospira interrogans serovar icterohaemorrhagiae.leptospira interrogans is a pathogenic bacterium with a low g+c content (34 to 39%). the restriction enzymes noti, asci, and srfi cut the chromosome of l. interrogans serovar icterohaemorrhagiae into 13, 3, and 5 fragments separable by one- and two-dimensional pulsed-field gel electrophoresis (pfge). the genome is composed of a circular 4.6-mbp chromosome and a 0.35-mbp extrachromosomal element. a physical map of the chromosome was constructed for noti, asci, and srfi by using single and double ...19921447129
[investigation of microbicidal activity of neutrophil defensins against leptospires].defensins play an important role in oxygen-independent microbicidal mechanisms of neutrophils. they are effective against many bacteria, fungi and enveloped viruses. however, the effect of defensins upon leptospires has not been studied. in the present report, human defensins (i.e. hnp, a mixture of hnp1, hnp2 and hnp3 were prepared from human polymorphonuclear neutrophils by chromatography on sephadex g-100 and then on biogel p-10. rabbit defensin np1 was purified from rabbit peritoneal granulo ...19921452139
duration of urinary excretion of leptospires by cattle naturally or experimentally infected with leptospira interrogans serovar hardjo.the excretion of leptospira interrogans serovar hardjo in the urine of cattle was studied in naturally and experimentally infected animals. five of 15 naturally infected animals with microscopic agglutination test titres of > or = 1:300 shed leptospires for between 28 and 40 weeks. twenty yearling heifers, experimentally infected by either the supraconjunctival or intrauterine routes, shed leptospires for from eight to 60 weeks; the 10 infected via the uterus shed l interrogans serovar hardjo fo ...19921455593
immunoblotting study of the antigenic relationships among eight serogroups of leptospira.seven strains of leptospira interrogans belonging to seven different serogroups, and one strain of leptospira biflexa were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) with gradient gels and immunoblotting with hyperimmune rabbit sera raised against each strain. the molecular masses of the proteins were calculated with a polynomial regression model. the sds-page patterns of the l. interrogans strains were similar and characterized by 24 common bands. this prof ...19921455625
diseases, parasites and survival of coyotes in south-central georgia.serologic testing, radio-telemetry and post-mortem diagnostic evaluations were used to investigate survival and causes of mortality among 17 coyotes (canis latrans) in south-central georgia (usa). prevalence of canine heartworm (dirofilaria immitis) microfilariae was lower (p = 0.057) among fall-captured (22%) than among winter-captured (75%) coyotes. prevalence of heartworm was higher among adults than juveniles in the fall, but no significant difference was detected between animals captured in ...19921474655
the chemiluminescent detection of leptospiral antigen.the aim of this study was to investigate the feasibility of using enhanced chemiluminescence for the rapid detection of leptospiral antigen (l. interrogans serovar hardjo) in biological fluids, and to assess the suitability of such an assay for the early diagnosis of human leptospiral infections. the limit of detection for homologous antigen in phosphate buffered saline was 9 x 10(4) leptospires/ml. in human blood the sensitivity remained unchanged throughout the sampling time, (1.8 x 10(5) lept ...19921486231
antigens involved in the human antibody response to natural infections with leptospira interrogans serovar copenhageni.serum samples from patients with leptospirosis were screened by the microscopic agglutination test (mat), elisa and by immunoblotting. the latter two tests were performed with l. interrogans serovar copenhageni isolated from human blood culture. immunoblotting with patients' sera revealed antibodies recognizing several leptospiral components in the molecular weight range 14.5-105 kda of both igm and igg response. all patients' serum samples presented igm antibodies reacting with a diffuse band o ...19921495119
comparative analysis of lipopolysaccharide and lipid antigens of leptospira interrogans serovars.lipopolysaccharide (lps) or glycolipid antigens of leptospira interrogans have been candidates as serogroup or serotype specific antigen. in this study, therefore, we prepared the lps and lipid antigens from l. interrogans serovars lai, icterohaemorrhagiae, copenhageni, canicola, pomona, grippotyphosa, and a korean isolate 30r. the lps antigens were analyzed by a polyacrylamide gel electrophoresis and lipid antigens by thin-layer chromatography, respectively. the seroreactivity of the antigens w ...19921502827
[infection with leptospira interrogans, serovar mozdok, in cattle].in east germany the same serovar, leptospira mozdok, of the pomona serogroup is found in cattle as well as in swine populations (zieris 1989). nowadays cases of bovine leptospirosis caused by infection with l. pomona have no significance. there are marked epizoological differences between infection with l. mozdok and l. pomona. the main source of infection with l. mozdok for cattle is the black striped field mouse (apodemus agrarius). secondary homonomous transmission occurs among the cattle. th ...19921509476
prevalence of antibody titers to leptospira spp. in minnesota white-tailed deer.serum samples (n = 204) from 124 white-tailed deer (odocoileus virginianus) in northeastern minnesota (usa) were collected from 1984 through 1989 and tested for antibodies to six serovars of leptospira interrogans (bratislava, canicola, grippotyphosa, hardjo, icterohemorrhagiae, and pomona) using a microtiter agglutination test. eighty-eight (43%) sera were positive at greater than or equal to 1:100 for antibodies against serovars pomona and/or bratislava; none was positive for any of the other ...19921512878
immunodominant antigens recognized by the human immune response to infection by organisms of the species leptospira interrogans serogroup australis.serum samples from patients infected by organisms of leptospira interrogans serogroup australis were tested by western blot to determine the nature of major antigens that are involved in the immune response. although there was some patient-to-patient variability, immunodominant genus-specific antigens were found to be proteins of apparent molecular ratio 68, 46 and 35-kda, and lipopolysaccharide (lps) sub-units in the 35-14-kda region. serogroup epitopes specific for australis were exclusively s ...19921515158
prevalence and serovars of leptospira involved in equine abortions in central kentucky during the 1990 foaling season.a study to determine the prevalence of leptospira-induced abortions in the central kentucky equine population during the 1990 foaling season and to determine the leptospira serovars responsible was conducted. from july 1, 1989 through june 30, 1990, 32 (4.4%) of 726 submissions (fetuses, stillborn foals, and/or placentas) were diagnosed as leptospirosis by the fluorescent antibody test and/or microscopic agglutination test. attempts were made to isolate leptospires from the fetal tissues and/or ...19921515489
the isolation and identification of leptospira interrogans serovar bratislava from a pig in germany.during a study on the improvement of selective media for the isolation of leptospires from clinical material, leptospires were isolated from the kidneys of a pig. test material was cultured in emjh-medium containing 0.4% rabbit serum and 3 inhibitory substances (rifampicin 10 micrograms/ml, amphotericin b 2 micrograms/ml, 5-fluorouracil 100 micrograms/ml). the cultured leptospira-strain (berlin 406) was identified to serogroup level using the cross agglutination method and it was further typed t ...19921519413
canine leptospirosis. a retrospective study of 17 cases.seventeen dogs were diagnosed with leptospirosis on the basis of clinical findings, laboratory abnormalities, and serology. this article summarizes and characterizes the historical and physical findings, laboratory data, serology, treatment, and outcome of these dogs. all of the dogs had serologic evidence of infection with interrogans serovars pomona and grippotyphosa. these findings are compared with previous reports of canine infection with leptospira interrogans serovars icteroaemorrhagiae a ...19921522555
leptospirosis in the seychelles.to ascertain the incidence of leptospirosis in the seychelles, identify its sources, review diagnostic features and assess complications.19921545718
analysis of leptospira spp., leptonema illini, and rickettsia rickettsii for the 39-kilodalton antigen (p39) of borrelia burgdorferi.five serovars of leptospira interrogans, leptospira biflexa, leptonema illini, and rickettsia rickettsii were examined and found not to contain the 39-kda antigen (p39) of borrelia burgdorferi, the lyme disease spirochete. the specificity of this antigen and its reactivity with human lyme disease sera should exclude the possibility of false-positive serum samples from patients having had either leptospirosis or rocky mountain spotted fever, as well as tick-borne relapsing fever and syphilis, as ...19921551994
isolation of leptospira interrogans serovars bratislava and hardjo from swine at slaughter. 19921554777
identification of the tick-borne relapsing fever spirochete borrelia hermsii by using a species-specific monoclonal antibody.borrelia hermsii causes a relapsing fever in humans and is one of several species of tick-borne spirochetes known to occur in the western united states. spirochetes observed in the peripheral blood of patients acutely ill have been presumptively identified in the past by the geographic location of exposure and the probable species of tick vector. we describe a monoclonal antibody (h9826) that bound to the flagellar protein of b. hermsii but not to those of any of the other species tested, which ...19921572965
repetitive sequences cloned from leptospira interrogans serovar hardjo genotype hardjoprajitno and their application to serovar identification.we selected, from a genomic library of leptospira interrogans serovar hardjo genotype hardjoprajitno, two probes containing repetitive sequences (pl1 and pl590). the hybridization patterns of these probes to dna isolated from a variety of leptospira serovars were examined and their ability to detect subtle differences at the genomic organization level was established. we identified the dna fragments within pl1 and pl590 which are sufficient to yield polymorphic hybridization patterns; these resu ...19921583126
cross-reactive proteins of borrelia burgdorferi.the specificity of serological tests for lyme borreliosis is impaired by cross-reacting antibodies. in order to select antigens for more specific tests, specific and cross-reactive proteins of borrelia burgdorferi must be identified. therefore, to analyze cross reactions of borrelia burgdorferi with other bacteria, rabbit immune sera against heterologous bacteria (borrelia hermsii, treponema pallidum, treponema phagedenis, leptospira interrogans (serogroup grippotyphosa), neisseria meningitidis, ...19921597198
occurrence of severe leptospirosis in a breeding colony of squirrel monkeys.although experimental leptospirosis has been studied in various species of monkeys, the occurrence of acute leptospirosis in a population of nonhuman primates is uncommon. we report on a number of severe cases of icterohemorrhagic leptospirosis that appeared in the squirrel monkey (saimiri sciureus) colony of 109 animals at the institute pasteur in french guiana. initially, 11 animals had acute illness, with jaundice and a hemorrhagic syndrome, leading to 10 deaths. two leptospira interrogans st ...19921599047
isolation and biological activities of endotoxin from leptospira interrogans.endotoxins extracted with ethylenediaminetetraacetate (edta) from leptospira interrogans serovars icterohaemorrhagiae and canicola and leptospira biflexa serovar patoc were tested for various biological activities characteristic of endotoxins. the presence of lipopolysaccharide biological activity was demonstrated by the limulus amoebocyte lysate test, pyrogenicity in rabbits, complement interaction inhibiting the erythrocyte lysis, and chicken-embryo lethality. the lipopolysaccharides did not i ...19921611553
serodiagnosis of leptospirosis in pigs using an axial filament enzyme-linked immunosorbent assay.the axial filament (af) from leptospira interrogans serovar canicola was isolated by cesium chloride density gradient centrifugation of 2% sarcosyl treated whole cells. isolation of af was confirmed by electron microscopic examination, by protein-a immunogold labelling, sodium dodecyl sulphate polyacrylamide gel electrophoresis (sds-page), and immunoblotting. analysis by sds-page of the purified preparation showed relatively weak bands of molecular size 41 kda and 21 kda, and strong bands of 35 ...19921615635
isolation of leptospira interrogans from kidneys of zimbabwe beef cattle.four hundred and eighty bovine kidneys were collected from an abattoir near harare between december 1987 and november 1988, and leptospires were recovered from 50 (10.4 per cent) of them. the isolates were identified to serogroup level by the microscopic agglutination test; 32 belonged to serogroup sejroe, seven were pyogenes, four hebdomadis, two tarassovi, and one isolate each belonged to serogroups australis, bataviae, grippotyphosa, icterohaemorrhagiae and pomona.19921621343
characterization of the periplasmic flagellum proteins of leptospira interrogans.the structure and composition of periplasmic flagella (pf) from leptospira interrogans serovar pomona type kennewicki were characterized. electron microscopic observations showed that leptospiral pf were complex structures composed of an 11.3-nm-diameter core surrounded by two sheath layers with 21.5- and 42-nm diameters. two-dimensional gel electrophoresis of isolated pf showed the presence of seven different proteins ranging in mass from 31.5 to 36 kda. rabbit polyclonal and mouse monoclonal a ...19921624463
leptospira serology in small ruminants on st. croix, u.s. virgin islands.a serological survey of 16 serovars of leptospira interrogans, previously reported in tropical small ruminants, was undertaken to determine the serovars involved and the prevalence of these antibodies in sheep and goats on st. croix, u. s. virgin islands (usvi). seven of eight goat herds (108 animals) had at least two seropositive animals in each herd with an individual animal seroprevalence of 26%. the 53 sheep tested (one flock only) showed a 32% seroprevalence. antibodies against seven serova ...19921626866
serological evidence for the presence of leptospira interrogans serovar bratislava in australian pigs. 19921627090
biochemical analysis by sds-page and western blotting of the antigenic relationship between leptospira and equine ocular tissues.the antigenic relationship between leptospira interrogans, equine cornea and lens was previously noted in our studies. serum antibodies from horses inoculated with serovars wolffi, pomona, icterohaemorrhagiae, and tarassovi, were able to bind to five antigenic fractions from both cornea and lens, as demonstrated by immunoblotting. these antigens seem to be made up of protein and carbohydrates. after treatment with periodate for cleavage of glycoside ring structures, those fractions kept their co ...19921632080
genetic diversity among australian and new zealand isolates of leptospira interrogans serovar pomona.restriction endonuclease analysis of 16 australian and 4 new zealand isolates of leptospira interrogans serovar pomona showed that they could be divided into 3 genetic groups. most of the isolates closely resembled the serovar kennewicki reference strain, and they all differed from the reference strain of serovar pomona. based on these findings, it is suggested that vaccine manufacturers re-evaluate their choice of serovar pomona vaccine strain.19921632725
[the detection and analysis of leptospiral dna in patients' serum of early leptospirosis by polymerase chain reaction and dna hybridization with digoxigenin-amppd].we have detected and analysed the leptospiral dna in serum of patients with early leptospirosis from the epidemic area of china by pcr and dna hybridization with digoxigenin (dig)-3-(2'-spiroadamantane)-4-methoxy-4-(3"-phosphoryloxy)- phenyl-1,2-dioxetane (amppd) to develop a sensitive, specific and reliable technique for the early diagnosis of leptospirosis, and full satisfactory results have obtained. fourteen serum specimens from patients with leptospirosis proven by blood culture and serolog ...19921298711
[detection of leptospiral dna in the serum of 175 patients with early leptospirosis by polymerase chain reaction].we have developed a sensitive assay for leptospira, using the polymerase chain reaction (pcr). on the basis of the published nucleotides sequence of 23s rrna gene from leptospira interrogans serovar canicola strain moulton, primers were chosen to produce an amplified fragment of 123 bp. primer a: 5'gat cta att cgc tgt agc agg3' and primer b: 5'act ttc acc ctc tat ggt cgg3' eight different svs. of leptospira interrogans could all be detected by pcr, but the dnas from l. biflexa. leptonema bacteri ...19921298712
[the immunochemical and biological properties of leptospira membranes].the immunochemical and biological properties of purified membrane fractions obtained from leptospira interrogans, serovar copenhageni, strain rat 2, and leptospira biflexa, strain patoc 1, were studied. the presence of genus-specific and group-specific antigens in leptospiral membranes was established by the methods of immunodiffusion analysis, the microagglutination (ma) and lysis tests. in animal experiments cell membrane preparations produced no toxic and allergic effects. leptospiral membran ...19921301663
[marking and detection of dna of leptospires in the dot-blot and situ hybridization with digoxigenin-labelled probes].dna of leptospira interrogans sv. lai strain 017 was labelled with digoxigenin or alpha 32p or biotin and used as probes to detect dna of leptospires. probes labelled with digoxigenin were able to detect 0.1-1 pg of homologous dna and 10(2) of l. interrogans sv. lai strain 017. probes alpha 32p and biotin detected 1 pg and 10 pg of homologous dna and 10(3), 5 x 10(3) of l. interrogans sv. lai strain 017 respectively. these three probes couldn't detect l. biflexa sv. patoc strain patoc i, l. illi ...19921304535
assay for measuring relative potency of leptospiral bacterins containing serovar pomona.an enzyme-linked immunosorbent assay (elisa) was developed for the quantitation of leptospiral antigen in bacterins containing leptospira interrogans serovar pomona type kennewicki. a monoclonal antibody (mab), 2d7, which is directed against a surface antigen on whole cells of l. interrogans serovar pomona type kennewicki, was used in the assay. the capture of antigen in bacterins by a polyclonal antiserum was followed by the addition of the 2d7 ascites fluid, an anti-mouse conjugate and substra ...19921305402
muskrats as carriers of pathogenic leptospires in the netherlands.leptospires were isolated from 24 of 327 (7%) muskrats (ondatra zibethicus) caught in the netherlands. all isolates were identified as leptospira interrogans. one isolate was typed as serovar copenhageni in the icterohaemorrhagiae serogroup, one as serovar lora in the australis serogroup. twenty-one isolates showed a close relationship with serovars grippotyphosa, valbuzzi, muelleri and ratnapura from the grippotyphosa serogroup. one isolate was lost. sera from 196 muskrats were examined by the ...19921315497
[the serovars of leptospira interrogans isolated from cases of human leptospirosis in são paulo, brazil].eighteen strains of l. interrogans isolated from human cases were serotyped by the agglutinin-absorption test at instituto adolfo lutz in são paulo, brazil. fourteen were identified as serovar copenhageni (icterohaemorrhagiae serogroup), 2 as canicola (canicola serogroup), 1 as castellonis (ballum serogroup) and 1 as pomona serogroup (serovar not yet defined). the frequency of serovar copenhageni in 100% of the isolates in icterohaemorrhagiae serogroup is emphasized and more studies to verify th ...19921342073
chemical and biological properties of endotoxin from leptospira interrogans serovars canicola and icterohaemorrhagiae.1. endotoxin-like activity was extracted with phenol-chloroform-petroleum either (pcp) from leptospira interrogans serovars icterohaemorrhagiae and canicola. chemical analysis of leptospiral cells obtained from the pcp extract indicated the following distribution of lipopolysaccharide (lps), protein and polysaccharide in mg/ml: 3.0, 4.5 and 1.0 for icterohaemorrhagiae and 3.3, 5.6 and 1.5 for canicola. 2. the preparations presented several biological activities: positive limulus test (1.0 pg/ml) ...19921342222
[the identification of leptospira strains of different origins].leptospirosis is at present an ever-increasing problem in human and animal health. by means of the korthof medium, 43 leptospira strains were isolated from samples of human blood, water and soil. for their identification the microagglutination technique was used. the strains corresponded to the species leptospira biflexa and leptospira interrogans.19921344685
cloning of dapd, arod and asd of leptospira interrogans serovar icterohaemorrhagiae, and nucleotide sequence of the asd gene.metabolites such as diaminopimelate and some aromatic derivatives, not synthesized in mammalian cells, are essential for growth of bacteria. as a first step towards the design of a new human live vaccine that uses attenuated strains of leptospira interrogans, the asd, arod and dapd genes, encoding aspartate beta-semialdehyde dehydrogenase, 3-dehydroquinase and tetrahydrodipicolinate n-succinyltransferase, respectively, were cloned by complementation of escherichia coli mutants. the complete nucl ...19921348268
genome structure of spirochetes.the genome structures of several pathogenic spirochetes have recently been determined. the genomes of borrelia species consist of a linear chromosome of approximately one million base pairs (mb) and various linear and circular plasmids. analysis of restriction fragment length polymorphisms and 16s ribosomal rna sequence data indicate the division of borrelia burgdorferi into at least three distinct genetic groups. leptospira interrogans has a circular chromosome 5 mb in size and a 0.35 mb extrac ...19921362002
antibodies in dogs against leptospira interrogans serovars copenhageni, ballum and canicola.in a nationwide survey carried out during 1990-91 of more than 5800 dogs to detect antibodies against leptospira interrogans serovars copenhageni, ballum and canicola, only one weak reactor against serovar canicola was found. reactors of varying titre were found against serovar ballum in 0.7% of dogs tested, indicating sporadic infection with this serovar. reactors (0.9%) to serovar copenhageni came mainly from the waikato, northland and the auckland region. this was in agreement with the report ...199216031675
a survey of house mice from iowa swine farms for infection with leptospira interrogans serovar bratislava. 199217424117
[return to estrus following first insemination in sow herds (incidence and association with reproductivity and various blood parameters)].as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics to get an impression of the economic importance. these objectives wer ...19937505958
[pcr amplification of the leptospiral dnas from different genus and species with the variable sequences of 16s rrna gene].we designed a pair of primers from the variable regions (v2 and v4) of 16s rrna gene of leptospira interrogans, i. e. pi: 5'ggg aac cta ata ctg gat gg; pii: 5' aca tag ttt caa gtg gag gc, and amplified the leptospiral dnas from different genus and species. when denaturing with 55 degrees c, all dnas of l. interrogans had the same products not only in length but also with kpn i-digested pattern. the dna of l. biflexa could be amplified with a c. a. 280 bp-band but not digested by kpn i, while the ...19938150433
[restriction endonuclease analysis of pomona serogroup of leptospira interrogans].restriction endonuclease analysis (rea) was performed on dnas from the type strains of the pomona serogroup of leptospira interrogans by using ecori and hhai restriction enzyme, and the electrophoretic patterns obtained were compared with patterns obtained from 27 isolates from pig kidneys collected at abattoirs in victoria, which belong to pomona serogroup previous identified by mat. all of the isolates were identified as serovar pomona.19938178514
leptospirosis in equine fetuses, stillborn foals, and placentas.leptospirosis was diagnosed in 51 equine fetuses and 16 stillborn foals with gestational ages from 3 1/2 to 11 months. diagnosis was based on one or more of the following: positive fetal antibody titer, positive fluorescent antibody test, demonstration of spirochetes in kidney and/or placental sections stained by the warthin-starry technique, high leptospiral titers in aborting mares, or isolation of leptospira spp. from fetal organs. gross lesions were observed in 80.3% of the fetuses, stillbor ...19938212458
[the use of nonpathogenic leptospira as diagnostic antigens for the diagnosis of leptospira infections in cattle].the seroprevalence of leptospira antibodies was determined in 4377 bovine sera by microagglutination assay using 11 leptospira interrogans serovars. in 10% (439 samples) of the sera, a positive reaction was detected. these included 275 sera (62.6%) with reaction to l. grippotyphosa, 159 (36.2%) to l. saxkoebing and 5 (1.1%) sera with reactions to other serovars. multiple reactions were found in 9.8% of the 439 positive sera, whereby the sejroe group dominated (65%) within the possible combinatio ...19938216195
association between cessation of leptospiruria in cattle and urinary antibody levels.the shedding of leptospira interrogans serovar hardjo in the urine of cattle and the local and systemic response to these organisms was monitored in experimentally and naturally infected animals. twenty yearling heifers, 10 infected by the instillation of leptospires into the conjunctival sac (supraconjunctival route) and 10 infected intrauterinely, shed leptospires for up to 60 weeks after infection. five of 15 naturally infected pregnant heifers with microscopic agglutination test titres > or ...19938235087
cross-reactivity between b. burgdorferi and other spirochetes affects specificity of serotests for detection of antibodies to the lyme disease agent in dogs.western immunoblots, the kinetics-based enzyme-linked immunosorbent assay (kela), and the microagglutination test were used to evaluate cross-reactivity among antibodies to serovars of leptospira interrogans (leptospiral serovars), and b. burgdorferi from naturally infected dogs, and to serpulina (treponema) hyodysenteriae from vaccinated rabbits. whole-cell lysates from borrelia spp., leptospiral serovars, and serpulina spp. were used for sds-page, western blots, and kela. crossreactivity occur ...19938236777
[antigen analysis of mcab e4b7d5 directed against outer envelope of leptospira interrogans serovar lai by sds-page and immunoblot].mcab e4b7d5 was prepared by hybridoma technology in balb/c mice immunized to outer envelope of leptospira interrogans serovar lai. this mcab agglutinated specifically with all the 13 serovars of icterohaemorrhagiae serogroup in mat test at high titres and protected the guinea pigs against the attack of virulent strain (017) of serovar lai. sds-page and immunoblot were used to analyse the reaction of the outer envelopes of the five strains of leptospira (leptospira interrogans icterohaemorrhagiae ...19938244286
isolation of leptospira interrogans serovars hardjo and zanoni from a dairy herd in north queensland. 19938257323
serologic survey for leptospirae in european brown bears (ursus arctos) in croatia.from 1981 to 1991, sera of 42 european brown bears (ursus arctos) from three areas in croatia were tested for antibodies against 12 leptospira interrogans serovars: grippotyphosa, sejroe, australis, pomona, canicola, icterohaemorrhagiae, tarassovi, saxkoebing, ballum, bataviae, poi, and hardjo. diagnostic levels of antibody were found in 17 (40%) of 42 sera. evidence of exposure to at least one of the serovars was found in seven of 14 free-ranging bears from the lika region, four of 12 free-rang ...19938258865
identification of leptospira interrogans strains by monoclonal antibodies and genomic analysis.a recombinant probe derived from a genomic library of serovar hardjo strain hardjoprajitno, and a panel of serovar specific monoclonal antibodies (mabs) were used for the characterization of 31 leptospira isolates from cattle and swine. the two methods performed equally well in serovar identification except for the distinction of the genotypes hardjoprajitno and hardjobovis within serovar hardjo which could only be obtained by genomic analysis. the combination of immunological and genetic inform ...19938264422
[amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr].based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ...19938288193
isolation of leptospira interrogans serovar grippotyphosa from the skin of a dog.leptospira interrogans serovar grippotyphosa was isolated from the skin of a 14-year-old male dog with deteriorating health. necropsy revealed numerous lesions characteristic of aged dogs, but no evidence of acute hepatitis or nephritis, which are common features of pathogenic leptospira infections. antibody to leptospira was not detected in the dog's serum by microagglutination. leptospires grew slowly in barbour-stoenner-kelly medium, a medium commonly used to isolate borrelia, but then grew a ...19938288477
cloning and analysis of the leub gene of leptospira interrogans serovar pomona.the leub gene of leptospira interrogans serovar pomona strain kenniwicki has been cloned on a 9.5 kb plasmid, pwvl1, by complementation of escherichia coli leub mutants. subcloning and tn5 mutagenesis showed that the region required for complementation was approximately 1.2 kb in length. enzyme assays showed that the product of the cloned gene was a beta-isopropylmalate dehydrogenase. defects in the leua, leuc and leud genes of e. coli were not complemented by pwvl1. the nucleotide sequence of t ...19938336106
antimicrobial effects of a new carboxyquinolone drug, q-35, on five serogroups of leptospira interrogans.new carboxyquinolone drugs, including the recently developed q-35, were evaluated for their in vitro potency against five serogroups of leptospira interrogans. q-35, ofloxacin, ciprofloxacin, and tosufloxacin showed mics (0.05 to 0.20 microgram/ml) comparable to those of tetracycline. however, mbcs of these drugs varied between 10- and 100-fold above the mic for most strains tested. q-35 was shown to be active against l. interrogans in vitro as judged by the mics obtained.19938388204
[a severe course of leptospirosis with acute kidney failure and extensive icterus (weil disease)].a 77-year-old man developed a fever up to 38.4 degrees c, with diarrhoea, acute renal failure (creatinine up to 8.7 mg/dl; urea up to 308 mg/dl) and marked jaundice (total bilirubin up to 24.3 mg/dl). in addition there was thrombocytopenia, conjunctivitis and epistaxis, as well as cerebral symptoms with somnolence and general slowing up. at first he was thought to have cholangitis resulting from previously diagnosed gall-stones, and he was therefore treated with ampicillin, 2 g two times daily, ...19938404498
Refresh
firstprev
12345678910...
nextlast
Displaying items 501 - 600 of 2728