Publications

rhizobium meliloti nodulation genes allow agrobacterium tumefaciens and escherichia coli to form pseudonodules on alfalfa.	regions of the rhizobium meliloti symbiotic plasmid (20 to 40 kilobase pairs long) containing nodulation (nod) genes were transferred to agrobacterium tumefaciens or escherichia coli by conjugation. the a. tumefaciens and e. coli transconjugants elicited root hair curling and the formation of ineffective pseudonodules on inoculated alfalfa plants. a tumefaciens elicited pseudonodules formed at a variable frequency, ranging from 15 to 45%, irrespective of the presence of the ti plasmid. these pse ...	1984	6327629
isolation and expression of rhizobium japonicum cloned dna encoding an early soybean nodulation function.	a first visible step in the nodulation of legumes by rhizobium spp. is the deformation and curling of root hairs. we have identified and cloned dna sequences encoding this function from two strains of rhizobium japonicum (usda 122 and usda 110) with a weakly homologous probe from rhizobium meliloti. root hair curling encoded by the cloned dna fragments was examined on soybeans (glycine soja ) after conjugative transfer of these sequences in broad-host-range vectors to various bacterial genera. p ...	1984	6327649
t-dna fragments of hairy root plasmid pri8196 are distantly related to octopine and nopaline ti plasmid t-dna.	agrobacterium ti (tumor-inducing) and ri (root-inducing) plasmids transform dicot plant cells by insertion of a specific plasmid sector called t-dna (transferred dna) into host plant nuclear dna. the mannopine -type ri plasmid pri8196 contains four bamhi fragments that encompass core t-dna. we report southern hybridization studies that show that these four fragments have no strong homology to octopine-, nopaline-, or agropine -type ti plasmids. we detected and mapped very weak homology regions, ...	1984	6328555
a simple method to transfer, integrate and study expression of foreign genes, such as chicken ovalbumin and alpha-actin in plant tumors.	a simple method for inserting foreign genes into the t-region of agrobacterium ti-plasmids is described. a modified cosmid (phc 79) was introduced into a predetermined site of the t-region of pti c58. an agrobacterium strain harboring this modified ti-plasmid was used as an acceptor strain into which genes, cloned in pbr322, can be introduced by mobilization from escherichia coli. pbr322-derived plasmids cannot replicate in agrobacterium, but can be maintained by integration into the t-region of ...	1984	6329731
characterization of transposon tn5-facilitated donor strains and development of a chromosomal linkage map for agrobacterium tumefaciens.	we have further characterized the transposon tn5-facilitated chromosomal gene transfer system developed for agrobacterium tumefaciens 15955. using a strain whose chromosome contained tn5, we compared the chromosome-mobilizing ability of plasmid pdp37 (containing tn5) with that of its parent plasmid r68.45. for r68.45, we observed nonpolar transmission from multiple origins. for pdp37 we found polarized transmission from a single origin near ilv. when we examined the transmission gradients of a n ...	1984	6330023
general transduction in rhizobium meliloti.	general transduction by phage phi m12 in rhizobium meliloti su47 and its derivatives is described. cotransduction and selection for tn5 insertions which are closely linked to specific loci were demonstrated. a derivative of su47 carrying the reca::tn5 allele of r. meliloti 102f34 could be transduced for plasmid r68.45 but not for chromosomally located alleles. phage phi m12 is morphologically similar to escherichia coli phage t4, and restriction endonuclease analysis indicated that the phage dna ...	1984	6330024
generalized transduction in rhizobium meliloti.	generalized transduction of rhizobium meliloti 1021 was carried out by bacteriophage n3. genetic markers on the chromosome and the psym megaplasmid were transduced, along with markers on several incp plasmids. cotransduction between transposon tn5 insertions and integrated recombinant plasmid markers permitted correlation of cotransductional frequencies and known physical distances. bacteriophage n3 was capable of infecting several commonly used strains of r. meliloti.	1984	6330025
transposon tn5-induced mutagenesis of rhizobium japonicum yielding a wide variety of mutants.	when the "suicide" vector psup1011, which carries transposon tn5 (kmr), was introduced into rhizobium japonicum usda 110, kanamycin-resistant (kmr) colonies were detected at a frequency (4.2 x 10-6) ca. 30 times greater than the spontaneous kanamycin resistance frequency (1.4 x 10-7). ten thousand kmr mutants were isolated and tested for nutritional auxotrophy. auxotrophs were detected at a frequency of 0.5%. the following classes of auxotrophs were identified: adenine- (three), histidine- (thre ...	1984	6330038
transposon tn5 encodes streptomycin resistance in nonenteric bacteria.	strains of caulobacter crescentus, pseudomonas putida, acinetobacter calcoaceticus, rhizobium meliloti, and rhodopseudomonas sphaeroides carrying the kanamycin resistance-encoding transposon tn5 were 15 to 500 times more resistant to streptomycin than transposon-free strains. the streptomycin resistance determinant, which is separable from the kanamycin resistance determinant of tn5, was not expressed in escherichia coli or klebsiella aerogenes.	1984	6330041
host-dependent transposon tn5-mediated streptomycin resistance.	transposon tn5 encodes streptomycin resistance in addition to kanamycin-neomycin resistance. this resistance was not detectable in escherichia coli but was efficiently expressed in rhizobium meliloti and certain other strains. by analysis of cloned tn5 restriction endonuclease fragments, the streptomycin resistance (str) gene was located in the right-hand side of the central region as the transposon is conventionally drawn. transcription of str appeared to originate at pl, the promoter for the n ...	1984	6330042
nucleotide sequence and transcript mapping of the tmr gene of the ptia6nc octopine ti-plasmid: a bacterial gene involved in plant tumorigenesis.	the nucleotide sequence of a tumor morphology gene, tmr, from the agrobacterium tumefaciens ti-plasmid, ptia6nc, and its flanking 5' region was determined by m13 "dideoxy" procedures. the dna sequence reveals an open reading frame capable of encoding a 240 amino acid protein. we have identified the polyadenylated transcript initiation and termination sits by s1 nuclease mapping. the extent of the sequence required for transcription 5' to the start of transcription has been delimited by two trans ...	1984	6330262
molecular cloning and functional characterization of rhizobium leguminosarum structural nif-genes by site-directed transposon mutagenesis and expression in escherichia coli minicells.	in order to study the structural organization and regulation of the expression of the nitrogenase gene cluster in rhizobium leguminosarum pre we selected relevant subfragments of the sym-plasmid from clone banks by homology with r. meliloti nif-genes. site-directed tn5 mutagenesis was applied to a nif dh-specific clone and subsequently the transposon insertions were transferred back into the wild-type rhizobial genome by homologous recombination. phenotypic effects of tn5 mutations in the region ...	1984	6330264
light-inducible and chloroplast-associated expression of a chimaeric gene introduced into nicotiana tabacum using a ti plasmid vector.	a chimaeric gene, consisting of the 5'-flanking region of a member of the pisum sativum gene family encoding ribulose 1,5-bisphosphate carboxylase linked to the coding region of a bacterial chloramphenicol acetyltransferase gene, has been introduced into the genome of the plant nicotiana tabacum using a ti plasmid of agrobacterium tumefaciens. the expression of the chimaeric gene is light-inducible in chloroplast-containing transformed tissue.	1984	6330570
nucleotide sequence of the tmr locus of agrobacterium tumefaciens pti t37 t-dna.	the nucleotide sequence of the tmr locus from the nopaline-type pti t37 plasmid of agrobacterium tumefaciens was determined. examination of this sequence allowed us to identify an open reading frame of 720 nucleotides capable of encoding a protein with a derived molecular weight of 27025 d. comparison of the pti t37 tmr sequence with the published sequence of the pti ach5 tmr locus shows over 88% homology in the 240 bases 5' to the translational initiation codon and over 91% homology in the codi ...	1984	6330678
nucleotide sequence of rhizobium meliloti nodulation genes.	a rhizobium meliloti dna region, determining nodulation functions common in different rhizobium species, has been delimited by directed tn5 mutagenesis and its nucleotide sequence has been determined. the sequence data indicates three large open reading frames with the same polarity coding for three proteins of 196, 217 and 402 (or 426) amino acid residues, respectively. we suggest the existence of three nod genes on this region, which were designated as noda, b and c, respectively. comparison o ...	1984	6336331
regulation of nitrogen fixation genes.		1984	6373013
trans-acting virulence functions of the octopine ti plasmid from agrobacterium tumefaciens.	all ti plasmid-encoded virulence functions that were studied act in trans. an octopine ti plasmid-specific vir operon, called vir-o, located on an ecori restriction fragment has been characterized. sequences with promoter activity in escherichia coli were identified for a second vir operon, called vir-c, which was located close to the position of vir-o.	1984	6373732
thioredoxin system of the photosynthetic anaerobe chromatium vinosum.	chromatium vinosum, an anaerobic photosynthetic purple sulfur bacterium, resembles aerobic bacterial cells in that it has an nadp-thioredoxin system composed of a single thioredoxin which is reduced by nadph via nadp-thioredoxin reductase. both protein components were purified to homogeneity, and some of their properties were determined. chromatium vinosum thioredoxin was slightly larger than other bacterial thioredoxins (13 versus 12 kilodaltons) but was similar in its specificity (ability to a ...	1984	6373736
changes in properties of phytopathogenic bacteria effected by plasmid prd1.	transfer of plasmid prd1 from escherichia coli k 12j62 -1 to phytopathogenic bacteria, agrobacterium tumefaciens, xanthomonas beticola and erwinia carotovora subsp. carotovora caused changes in conjugant properties not determined by the plasmid and the emergence of the properties not present in the parent strains. clones have been obtained with intermediate properties between donor and recipient, including those with altered or lost virulence. in transconjugants of a. tumefaciens virulence incre ...	1984	6375619
development and trifoliin a-binding ability of the capsule of rhizobium trifolii.	the age-dependent lectin-binding ability of rhizobium trifolii 0403 capsular polysaccharide (cps) was examined by following the development of the capsule and its ability to interact with the white clover lectin trifoliin a. bacteria grown on agar plates for 3, 5, 7, 14, and 21 days were examined by electron microscopy and immunofluorescence microscopy with antibodies prepared against either r. trifolii 0403 cps or trifoliin a after pretreatment with the lectin. the capsule began to develop at o ...	1984	6376470
preservation of rhizobium viability and symbiotic infectivity by suspension in water.	three rhizobium japonicum strains and two slow-growing cowpea-type rhizobium strains were found to remain viable and able to rapidly modulate their respective hosts after being stored in purified water at ambient temperatures for periods of 1 year and longer. three fast-growing rhizobium species did not remain viable under the same water storage conditions. after dilution of slow-growing rhizobium strains with water to 10(3) to 10(5) cells ml-1, the bacteria multiplied until the viable cell coun ...	1984	6378090
some properties of the nickel-containing hydrogenase of chemolithotrophically grown rhizobium japonicum.	the uptake hydrogenase of chemolithotrophically grown rhizobium japonicum was purified to apparent homogeneity with a final specific activity of 69 mumol of h2 oxidized per min per mg of protein. the procedure included triton extraction of broken membranes and deae-cellulose and sephacryl s-200 chromatographies. the purified protein contained two polypeptides separable only by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. they comigrated on native polyacrylamide gels and sucrose den ...	1984	6384183
coordinate expression of hydrogenase and ribulose bisphosphate carboxylase in rhizobium japonicum hupc mutants.	in contrast to the wild type, h2 uptake-constitutive mutants of rhizobium japonicum expressed both hydrogenase and ribulose bisphosphate carboxylase activities when grown heterotrophically. however, as bacteroids from soybean root nodules, the h2 uptake-constitutive mutants, like the wild type, did not express ribulose bisphosphate carboxylase activity.	1984	6384199
mobilization of a sym plasmid from a fast-growing cowpea rhizobium strain.	a large sym plasmid from a fast-growing cowpea rhizobium species was made mobilizable by cointegration with plasmid psup1011, which carries the orit region of rp4. this mobilizable sym plasmid was transferred to a number of rhizobium strains, in which nodulation and nitrogen fixation functions for symbiosis with plants of the cowpea group were expressed.	1984	6384201
[degradation and utilization of 2,4-dioxohexahydro-1,3,5-triazine (dht) by soil microorganisms].	the biodegradation and utilization of the antiphytoviral substance 2,4-dioxohexahydro-1,3,5-triazine (dht) by soil microorganisms was investigated. mixed cultures of microorganisms deriving from different soils diminish in nutrient broth the content of dht with increasing duration of culture. microorganisms from an egyptian garden soil fully degrade 10(-3) mol/1 dht in a culture without additional aeration within 28 days. also in deficient media the mixed microorganisms reduce the amount of dht, ...	1984	6388190
specific phases of root hair attachment in the rhizobium trifolii-clover symbiosis.	the time course and orientation of attachment of rhizobium trifolii 0403 to white clover root hairs was examined in slide cultures by light and electron microscopy. inocula were grown for 5 days on defined biii agar medium and represented the large subpopulation of fully encapsulated single cells which uniformly bind the clover lectin trifoliin a. when 10(7) cells or more were added per seedling, bacteria attached within minutes, forming randomly oriented clumps at the root hair tips. several ho ...	1984	6393874
reduction of nad+ by uptake hydrogenase from groundnut bacteroids.		1984	6394471
natural variation in symbiotic nitrogen-fixing rhizobium and frankia spp.	a description is given of the natural variation in nitrogen-fixing rhizobium and frankia spp. strains and the ability to form root nodules on compatible host plants. arguments are given for the hypothesis that co-evolution has taken place through mutual interaction of host plants and indigenous rhizobium and frankia populations in the soil leading to most efficient symbiotic associations. the significance of root nodules as selective enrichment cultures of particular strains in natural and culti ...	1984	6397130
hydrogen oxidation and nitrogen fixation in rhizobia, with special attention focused on strain ors 571.	in this survey we describe the influence of hydrogen oxidation on the physiology of rhizobium ors 571. the presence of hydrogen is required for the synthesis of hydrogenase. carbon substrates do not repress the synthesis of hydrogenase. the respiratory system contains cytrochromes of the b- and c-type. cytochrome alpha 600 is present after growth at high oxygen tensions. the nature of the terminal oxidases functioning at low oxygen tensions has not been established yet----h+/o values with endoge ...	1984	6397131
induced plasmid-genome rearrangements in rhizobium japonicum.	the p group resistance plasmids rp1 and rp4 were introduced into rhizobium japonicum by polyethylene-glycol-induced transformation of spheroplasts. after cell wall regeneration, transformants were recovered by selecting for plasmid determinants. plant nodulation, nitrogen fixation, serological, and bacterial genetics studies revealed that the transformants were derived from the parental strains and possessed the introduced plasmid genetic markers. agarose gel electrophoresis, restriction enzyme ...	1984	6360996
the t-region of ti plasmids codes for an enzyme synthesizing indole-3-acetic acid.	gene 2 from the t region of ti plasmids appears to be expressed both in eucaryotic and in procaryotic systems. in transformed plant cells it participates in auxin-controlled growth and differentiation, and in bacteria it is expressed into a defined protein of mr 49000. we investigated the possibility that it codes for an enzyme involved in auxin biosynthesis. only extracts from escherichia coli cells expressing gene 2 hydrolyzed indole-3-acetamide into a substance which was unambiguously identif ...	1984	6365544
the sequence of the tms transcript 2 locus of the a. tumefaciens plasmid ptia6 and characterization of the mutation in ptia66 that is responsible for auxin attenuation.	the incorporation of ti plasmid sequences, the t-dna, into the genomes of dicotyledenous plants causes the formation of tumors. here we report the nucleotide sequence of one of the t-dna "oncogenes", the transcript 2 gene of ptia6 and we further characterize the 2.7 kb element that has spontaneously inserted into this gene in plasmid ptia66. the results indicate that the transcript 2 portion of the t-dna has an open reading frame that could encode a polypeptide of 49.8 kd. the open reading frame ...	1984	6366736
characterization of the replication and stability regions of agrobacterium tumefaciens plasmid ptar.	a 5.4-kilobase region containing the origin of replication and stability maintenance of the 44-kilobase agrobacterium tumefaciens plasmid ptar has been mapped and characterized. within this region is a 1.3-kilobase segment that is capable of directing autonomous replication. the remaining segment contains the stability locus for maintenance of ptar during nonselective growth. approximately 35% of ptar shares sequence homology with pag119, a 44-kilobase cryptic plasmid in grapevine strain 1d1119. ...	1984	6321432
generation of a tn5 promoter probe and its use in the study of gene expression in caulobacter crescentus.	a promoter probe, tn5-vb32, was constructed and placed in a p group r plasmid containing bacteriophage mu sequences, allowing transfer of the transposon to bacteria such as caulobacter, rhizobium, and agrobacterium without retention of the plasmid. the probe carries an altered tn5 transposon that allows detection of chromosomal promoter regions by virtue of acquired kanamycin resistance. a fragment of dna containing the neomycin phosphotransferase ii (npt ii) gene from tn5, lacking its promoter ...	1984	6322183
studies on tn951 (lac+) expression in agrobacterium.	none of the agrobacterium tumefaciens and a. rubi strains tested produces detectable amounts of beta-galactosidase although they are capable of utilizing lactose as sole source of carbon. this opportunity was taken to investigate the expression of lac transposon tn951 (cornelis et al. 1978) in agrobacterium with the ultimate goal of using this system to investigate alien gene expression. when the transposon was introduced with the help of a broad-host range plasmid, rp1, the transconjugants prod ...	1984	6323925
dna sequence analysis of crown gall tumor t-dna encoding the 0.7 kb transcript.	crown gall tumor formation involves integration into the plant genome of dna sequences (the t-region) of tumor-inducing (ti) plasmids present in agrobacterium tumefaciens. the t-dna of the tumor expresses several gene products. little is known about the function or regulation of expression of the 0.7kb transcript, which represents a relatively abundant t-dna transcript in octopine-type tumors. in this report, a detailed structural analysis of the gene encoding the 0.7 kb transcript has been obta ...	1984	6324113
physical map of the agrobacterium rhizogenes strain 8196 virulence plasmid.	virulence of agrobacterium rhizogenes, agent of hairy root disease, is conferred by large plasmids called ri (root-inducing) plasmids. we have determined the bamhi fragment map of pri8196, mw 143 mda, principally by analysis of recombinant plasmids containing overlapping bamhi partial-digest fragments. clones containing solitary bamhi inserts of remaining unmapped fragments were used to probe a series of southern-blotted, pri8196-derived ecori, psti, hindiii, sali, or smai digests. continguous h ...	1984	6324259
h+/atp stoichiometry of cowpea rhizobium sp. strain 32h1 cells grown under nitrogen-fixing and nitrogen-nonfixing conditions.	the obligate aerobe cowpea rhizobium sp. strain 32h1 in axenic culture is able to fix n2 when grown under 0.2% o2 but not when grown under 21% o2. it was, therefore, of interest to investigate atp synthesis in these cells grown under the two conditions. when respiring in buffers having phs ranging from 6 to 8.5, cells grown under either o2 tension maintained an intracellular ph more alkaline than the exterior. the transmembrane chemical gradient of h+ (delta ph) was essentially the same under bo ...	1984	6237099
cloning and expression in escherichia coli of the tl-dna gene 4 of agrobacterium tumefaciens under the control of the pr promoter of bacteriophage lambda.	a plasmid was constructed that directs expression of the tl-dna gene 4 protein in e. coli. the different steps of the construction were as follows: i) a region of gene 4 encoding the amino-terminal portion of the protein was fused in frame to dna encoding an enzymatically active carboxy-terminal fragment of beta-galactosidase. the hybrid gene was poorly expressed from the upstream lambda pl promoter carried by the vector. ii) in order to generate an efficient procaryotic ribosome binding site, a ...	1984	6241481
genetic complementation of agrobacterium tumefaciens ti plasmid mutants in the virulence region.	mutants with tn5 insertions in the vir region of the agrobacterium tumefaciens tic58 plasmid are unable to form crown-gall tumors. complementation tests of these vir region mutants were carried out by constructing merodiploids in a recombination-deficient strain. each merodiploid possessed a mutant tic58 plasmid and a recombinant plasmid containing either the homologous wild-type dna region or the homologous region containing a second tn5 insertion. the analysis identified six complementation gr ...	1984	6318043
succinamopine: a new crown gall opine.	agrobacterium tumefaciens strains can incite plant tumors consisting of transformed cells that synthesize novel metabolites called opines. the pattern of opine synthesis is dictated by plasmid-borne genes in the pathogen; additional plasmid genes confer on the pathogen the ability to catabolize the same pattern of opines synthesized. one group of a. tumefaciens strains, at181, eu6, and t10/73, contains closely related tumor-inducing (ti) plasmids that encode the ability to degrade the opine nopa ...	1984	6319354
nucleotide sequence of the tms genes of the ptia6nc octopine ti plasmid: two gene products involved in plant tumorigenesis.	the nucleotide sequence of the tumor morphology locus, tms, from ptia6nc has been determined. the sequence analysis indicates that each of two polyadenylylated transcripts encoded by this locus contains an open reading frame; the predicted transcript 1 gene product has a molecular size of 83,769 daltons, and the predicted transcript 2 gene product, of 49,588 daltons. the precise start and stop positions of the transcript 2 rna have been mapped with s1 nuclease. several insertion mutations have b ...	1984	6584906
extracellular polysaccharide composition, ex planta nitrogenase activity, and dna homology in rhizobium japonicum.	the composition of the major acidic extracellular polysaccharide (eps) of 25 strains of rhizobium japonicum was determined. eight strains synthesized an acidic eps containing rhamnose and 4-o- methylglucuronic acid and were closely related according to dna homology. these same strains also expressed high levels of ex planta nitrogenase activity. sixteen strains produced an acidic eps containing glucose, mannose, galacturonic acid, and galactose and were also related by dna homology. these strain ...	1984	6586714
the nifh and nifdk promoter regions from rhizobium japonicum share structural homologies with each other and with nitrogen-regulated promoters from other organisms.	in several species of rhizobium the three genes which encode the nitrogenase complex are separated into two operons, nifh and nifdk. we have mapped the transcriptional promoter sites for these two operons from r. japonicum usda strain 110 by s1 protection analyses using bacterial rna isolated from soybean nodules. transcription of the nifdk operon is initiated at a site located 46 nucleotides upstream of the proposed translation initiation codon. nifh transcription initiates predominantly at a s ...	1984	6588133
electron allocation to h+ and n2 by nitrogenase in rhizobium leguminosarum bacteroids.	electron allocation to h+ and n2 by nitrogenase in intact rhizobium leguminosarum bacteroids has been studied. nitrogenase activity was measured in intact cells with succinate and oxygen substrates. when whole cell nitrogenase activity was inhibited by oxygen-limitation or by the addition of the h+-conducting ionophore carbonylcyanide m-chlorophenylhydrazone, both inducing a low intracellular atp/adp ratio, the electron allocation to h+ was favoured over that to n2. when whole cell nitrogenase a ...	1984	6589160
a rhizobium meliloti symbiotic regulatory gene.	we have characterized a rhizobium meliloti regulatory gene required for the expression of two closely linked symbiotic operons, the nitrogenase operon (nifhdk genes) and the "p2" operon. this regulatory gene maps to a 1.8 kb region located 5.5 kb upstream of the nifhdk operon. the regulatory gene is required for the accumulation of nifhdk and p2 mrna and for the derepression of an r. meliloti nifh-lacz fusion plasmid during symbiotic growth. the nifh and p2 promoters can be activated in free-liv ...	1984	6423287
mannityl opine analogs allow isolation of catabolic pathway regulatory mutants.	five virulent agrobacterium spp. strains that can catabolize the mannityl opines mannopine (mop), mannopinic acid ( moa ), and agropinic acid (aga) were tested for their ability to grow on analogs of these compounds. analogs containing alternative amino acids replacing glutamic acid or glutamine were generally refused by these bacteria, but mutants were obtained that catabolized the entire family of analogs. in the case of strain c58c1 (pri 8196), we demonstrated that typical mutants were consti ...	1984	6427182
lactose inhibits the growth of rhizobium meliloti cells that contain an actively expressed escherichia coli lactose operon.	expression of the escherichia coli lactose operon in rhizobium meliloti 104a14 made the cells sensitive to the addition of the beta-galactosides lactose, phenyl-beta-d-galactoside, and lactobionic acid. growth stopped when the beta-galactoside was added and viability decreased modestly during the next few hours, but little cell lysis was observed and the cells appeared normal. protein synthesis was not inhibited. growth was inhibited only when beta-galactosidase expression was greater than 160 u ...	1984	6427192
comparative study of the dna-binding hu-type proteins from slow growing and fast growing strains of rhizobiaceae.	the dna-binding hu-type proteins have been isolated from two very different strains of rhizobiaceae : agrobacterium tumefaciens and rhizobium japonicum. these proteins have been called hat and hrj respectively. their electrophoretic mobility on polyacrylamide gel, amino acid composition and crossed immunoreactivity have been compared to that of the homologous protein isolated from rhizobium meliloti: the protein hrm . the proteins hat and hrm show close similarities whereas the protein hrj diffe ...	1984	6428409
nickel is a component of hydrogenase in rhizobium japonicum.	the derepression of h2-oxidizing activity in free-living rhizobium japonicum does not require the addition of exogenous metal to the derepression media. however, the addition of edta (6 microm) inhibited derepression of h2 uptake activity by 80%. the addition of 5 microm nickel to the derepression medium overcame the edta inhibition. the addition of 5 microm cu or zn also relieved edta inhibition, but to a much lesser extent; 5 microm fe, co, mg, or mn did not. the kinetics of induction and magn ...	1984	6429119
application of immunodiffusion to the identification of rhizobium meliloti strains competing for nodulation on medicago sativa.	the immunodiffusion technique was successfully used to unambiguously recognize four strains of rhizobium meliloti in a study of competition for nodulation with medicago sativa cv. apollo inoculated with two-, three- and four-strain mixtures. the serological reactions of all r. meliloti strains revealed no significant changes following plant passage indicating that the antigens involved in immunodiffusion were stable. r. meliloti 102f70 formed 50% or more of the nodules on m. sativa inoculated wi ...	1984	6431903
role of resistance to starvation in bacterial survival in sewage and lake water.	a study was conducted to determine the significance of starvation resistance to the ability of a species to survive in sewage and lake water. tests were conducted for periods of up to 14 days. rhizobium meliloti and one fluorescent and one nonfluorescent strain of pseudomonas were resistant to starvation because their population sizes did not fall appreciably in buffer and sterile lake water, and the first two maintained high numbers after being added to sterile sewage. cell densities of these b ...	1984	6435525
nature and location of amide-bound (r)-3-acyloxyacyl groups in lipid a of lipopolysaccharides from various gram-negative bacteria.	it has previously been demonstrated [eur. j. biochem. 124, 191-198 (1982) and 137, 15-22 (1983)] that the lipid a component of salmonella and proteus lipopolysaccharides contains amide-linked (r)-3-acyloxyacyl residues. in the present study lipid a of other gram-negative bacteria was analysed for the presence of amide-bound 3-acyloxyacyl residues. it was found that such residues are constituents of all lipid a tested (agrobacterium tumefaciens, chromobacterium violaceum, pseudomonas aeruginosa, ...	1984	6437812
agrocins and the biological control of crown gall.	agrocin 84 is a plasmid-encoded, fraudulent adenine nucleotide antibiotic responsible for the preventative biological control of the plant cancer, crown gall. it has bacteriocin-like selectivity which is dependent on a ti-plasmid-encoded permease in pathogenic agrobacteria. other nucleotide agrocins have been described and partially characterized; more may be confidently predicted.	1984	6444087
structure and synthesis of histopine, a histidine derivative produced by crown gall tumors.	histopine, an unusual amino acid derivative of histidine isolated from crown gall tumors of sunflowers (helianthus annus) inoculated with agrobacterium tumefaciens strain b6, was previously assigned the gross structure n-(1-carboxyethyl) histidine (2). a diastereomeric mixture containing histopine (2a and 2b) was readily prepared by reductive alkylation of (s)-histidine (1) with pyruvic acid and sodium cyanoborohydride. the individual diastereomers were prepared by reaction of (s)-histidine with ...	1984	6466642
right 25 bp terminus sequence of the nopaline t-dna is essential for and determines direction of dna transfer from agrobacterium to the plant genome.	we have determined which sequences at the right border of the t-dna region of the nopaline c58 ti plasmid are required for transfer and/or integration of the t-dna into the plant cell genome. the results indicate that the 25 bp t-dna terminus repeat sequence, tgacaggatatattggcgggtaaac, is directly responsible for t-dna transfer; furthermore, this sequence is directional in its mode of action. a transfer-negative nononcogenic ti plasmid derivative, pgv3852, was constructed, in which 3 kb covering ...	1984	6467373
mapping of promoter-proximal regions by in vitro transcription of two agrobacterium tumefaciens ti-plasmids.	transcription initiation sites were mapped on both the octopine pti ach5 and the nopaline pti c58 plasmids of agrobacterium tumefaciens. transcription ternary complexes were subjected to electrophoresis on agarose gels, prior and/or subsequent to restriction endonuclease digestion of the dna template, evidenced by autoradiography and located on the restriction maps of the two tumor-inducing plasmids. a. tumefaciens rna polymerase promptly recognizes and starts transcription on a few sequences wh ...	1984	6472259
rhizobia are attracted to localized sites on legume roots.	clouds of rhizobium meliloti were attracted to localized sites on the surface of the infectible region of alfalfa roots. this behavior, which required active motility and chemotaxis, was not species specific. correlation between the behavior of various mutants and their competitiveness for nodulation suggests that cloud formation has a role in the infection of host legume roots by rhizobia.	1984	6476827
bacteriophage that can distinguish between wild-type rhizobium japonicum and a non-nodulating mutant.	a bacteriophage (phage tn1) that lyses rhizobium japonicum 3i1b110 was isolated from tennessee soil. structurally, this phage resembles the escherichia coli phage t4, having an icosahedral head (47 by 60 nm) and a contractile tail (17 by 80 nm). an interesting feature of this phage is that it lyses all of the symbiotic defective mutants derived from r. japonicum 3i1b110 that were tested, except one, mutant strain hs123. mutant strain hs123 is a non-nodulating mutant that is defective in attachme ...	1984	6476831
enhanced 3-methoxytyramine levels in crown gall tumours and other undifferentiated plant tissues.	an amine, after dansylation, has been isolated from nicotiana tabacum crown gall tumours for the first time and characterized as 4-hydroxy-3-methoxy-beta-phenylethylamine (3-methoxytyramine). the compound cannot be detected in differentiated n. tabacum tissues but appears in the corresponding callus controls. its concentration is further increased 5-42-fold when n. tabacum is transformed with all strains of agrobacterium tumefaciens so far tested.	1984	6477503
monoclonal antibodies to rhizobium meliloti and surface mutants insensitive to them.	monoclonal antibodies were produced to the surface of the symbiotic nitrogen-fixing bacterium rhizobium meliloti. bacterial lysis in the presence of complement or cycles of agglutination and growth were used to select mutants no longer recognized by the antibodies. the mutants were used to produce new antibodies with different specificities. several mutants had altered sensitivity to one or more bacteriophages. r. meliloti strains from different sources had distinct patterns of sensitivity to mo ...	1984	6480561
crown gall transformation of tobacco callus cells by cocultivation with agrobacterium tumefaciens.	incubation of cells from squashed tobacco callus tissue with virulent agrobacterium tumefaciens leads to the production of cells displaying a crown gall phenotype.	1984	6487297
phosphorylation of chromosomal proteins during the transition of a normal plant cell to a crown gall tumor cell.	the transition of a wounded plant cell to a crown gall tumor cell, which is induced by infection with virulent agrobacterium tumefaciens cells, is accompanied by enhancement of chromatin-bound protein phosphokinase activity. various protein kinases with different substrate specificity (viz. histone, phosvitin, casein phosphokinases) are distinctly more active in tumor cells. the phosphate is introduced into seryl and threonyl residues of proteins and is stable under standard assay conditions, th ...	1984	6489456
division of peribacteroid membranes in root nodules of white clover.	division of peribacteroid membranes in the cytoplasm of root nodules of white clover was found, from a study of serial thin sections prepared for electron microscopy, to accompany division of the bacteroids. it was also observed that the peribacteroid membranes appeared to have adhered to various sites on the surface of the bacteroid envelope outer membranes. wherever peribacteroid membranes were constricted as though undergoing division in the region of the cleft formed by partial division of t ...	1984	6490745
a functional map of the nopaline synthase promoter.	this paper describes the first functional map of a promoter expressed from the plant chromosome. we have constructed a series of overlapping deletion mutants within the region upstream of the ti-plasmid encoded nopaline synthase (nos) gene. by monitoring nos expression in tumour tissue we have inferred a functional map of the nos promoter. the maximum length of sequence upstream of the transcription initiation point required to express wild type levels of nopaline synthase is 88 bp. within this ...	1984	6493982
adsorption of tumorigenic agrobacterium tumefaciens cells to susceptible potato tuber tissues.	cells of tumorigenic agrobacterium tumefaciens strain b6 were labeled with [35s]methionine and used to estimate bacterial adsorption to potato tuber discs. after 10 min at ph 7.2, about 5 x 10(5) bacteria adsorb to each 9.0-mm disc. lengthening the incubation period to 90 min increases adsorption to about 11 x 10(5) bacteria per disc. bacterial adsorption is reduced under both alkaline and acid ph conditions and increases 2.3-fold if the number of bacterial cells in the inoculum is doubled. adso ...	1984	6498639
bacteriophage-induced acidic heteropolysaccharide lyases that convert the acidic heteropolysaccharides of rhizobium trifolii into oligosaccharide units.	acidic heteropolysaccharide lyases from lysates of phages 4s and by15 grown on rhizobium trifolii 4s and r. trifolii 0403, respectively, were used to analyze the capsular and excreted extracellular acidic polysaccharides of r. trifolii 0403. the activities of the enzymes as measured by viscometry were enhanced by the addition of calcium. the oligosaccharide products obtained by depolymerase digestion of the polysaccharides isolated from cells grown on agar plates for 5 days were isolated by gel ...	1984	6501212
stimulation of clover root hair infection by lectin-binding oligosaccharides from the capsular and extracellular polysaccharides of rhizobium trifolii.	a polysaccharide depolymerase isolated from the phage lysate of rhizobium trifolii 4s was used to fragment capsular polysaccharides (cps) and extracellular polysaccharides (eps) of r. trifolii 0403 into oligosaccharides. these products were analyzed for clover lectin (trifoliin a)-binding ability, effect on infection of white clover root hairs, and changes in glycosyl and noncarbohydrate composition with culture age. the oligosaccharides from cps of cultures grown on agar plates for 3, 5, and 7 ...	1984	6501213
glucose-6-phosphate dehydrogenase deficiency in pleiotropic carbohydrate-negative mutant strains of rhizobium meliloti.	several mutant strains of rhizobium meliloti isolated after nitrosoguanidine mutagenesis were selected as unable to grow on mannose. some of them also failed to grow on glucose, fructose, ribose, and xylose but grew on l-arabinose, galactose, and many other carbon sources. biochemical analysis demonstrated that the mutants lacked nad- and nadp-linked glucose-6-phosphate dehydrogenase activities that reside on a single enzyme species. one such mutant was found to accumulate glucose-6-phosphate, a ...	1984	6501224
plant-inducible virulence promoter of the agrobacterium tumefaciens ti plasmid.	agrobacterium tumefaciens is the causative agent of crown gall, a plant tumour that can arise on most species of dicotyledonous plants. the tumour-inducing capacity of the bacterium requires the presence of a large plasmid, designated the ti plasmid, which itself contains two regions essential for tumour formation-the t(umour)-region and the vir(ulence)-region. the t-region is transferred to plant cells by an unknown mechanism, and becomes stably integrated into the plant genome. the vir-region ...	1984	6504164
[optimization of liquid scintillation counting by using multichannel pulse-height analyzer].	the method for determining optimum conditions of a liquid scintillation counter (lsc) for low-level counting of tritium was studied. to compare the lower limit of detection, the figure of merit em/square root b was used. th measurement system is a lsc connected with a multichannel pulse-height analyzer (mca). both of tritium spectra and background spectra were searched for the condition that maximizes the figure of merit. the optimum condition obtained by using the mca was fitted for a single ch ...	1984	6505306
detection of tumor-inducing plasmid dna sequence in agrobacterium tumefaciens by dna-dna hybridization.	absence of plasmid dna sequences in non-tumorigenic (crown gall tumor) strains of agrobacterium tumefaciens was confirmed by dna-dna hybridization between purified tumor-inducing (ti) plasmid dnas isolated from the progenitor tumorigenic strains and 3h-labeled whole cell dnas from tumorigenic strains and their non-tumorigenic derivatives. the genes controlling tumorigenicity in plant and utilizability of nopaline as their sole nitrogen source were confirmed to locate on ti-plasmids.	1984	6505307
dna sequence of the rhizobium leguminosarum nodulation genes nodab and c required for root hair curling.	a 3.2kb fragment of dna cloned from rhizobium leguminosarum has been shown to contain the genes necessary for the induction of root hair curling, the first observed step in the infection of leguminous plants by r. leguminosarum. the dna sequence of this region has been determined and three open reading frames were identified: genes corresponding to these open reading frames have been called noda, nodb and nodc and are transcribed in that order. mutations within the nodc gene completely blocked r ...	1984	6514582
opportunistic peritonitis in continuous ambulatory peritoneal dialysis.		1984	6518678
antioxidant defence system of erythrocytes in relation to agrobacterium tumefaciens lipopolysaccharide administration in mice.		1984	6519684
[growth rate of antibiotic-producing gram-negative bacteria on liquid nutrient media].	glycerol-yeast medium no. 3 may be used as a seed medium in screening of antibiotic-producing strains among acetobacter, gluconobacter, chromobacterium, agrobacterium, and other genera. the medium is transparent. it provides visual instrumental control of the growth rate of the seed material and estimation of biomass augmentation. the period of the exponential phase growth of the strains tested on medium no. 3 was 2-8 hours. when no growth on medium no. 3 is observed media nos. 1 and 2 can be us ...	1984	6524878
role of rhizobitoxine in protecting soybean roots from macrophomina phaseolina infection.	bacterization of soybean seeds or roots with rhizobium japonicum significantly reduced charcoal rot disease caused by macrophomina phaseolina . rhizobium japonicum inhibited the growth of m. phaseolina on both liquid and solid media. replacement of nutrient medium with culture filtrate of r. japonicum significantly reduced mycelial growth of m. phaseolina . whole culture extracts of r. japonicum yielded a toxic substance which was identified as rhizobitoxine after chromatographic, ultraviolet, a ...	1984	6539157
mode of infection, nodulation specificity, and indigenous plasmids of 11 fast-growing rhizobium japonicum strains.	eleven fast-growing strains of rhizobium japonicum were characterized with respect to indigenous plasmids and abilities to infect (inf+) and nodulate (nod+) cowpea, siratro, wild soybean, and three commercial cultivars of soybean. all strains caused infection via infection threads in root hairs and consistently nodulated cowpea, siratro, and wild soybean in growth pouches. interactions with commercial cultivars of soybean were strikingly strain specific. some combinations were nod-, and infectio ...	1984	6542099
studies on the inhibition of pancreatic and microbial lipases by soybean proteins.	a protein, molecular weight 70,000 that inhibits pancreatic lipase has been isolated from soybean seeds. inhibition is not reversed by colipase unless bile salts are added to the assay system. inhibitory properties of the purified protein are very similar to those of serum albumin or alpha-lactoglobulin. it has been confirmed that, during intestinal lipolysis of dietary fats, bile salts play an essential role for the activation of the lipase-colipase system in the presence of inhibitory proteins ...	1984	6542933
transfer of rhizobium meliloti psym genes into agrobacterium tumefaciens: host-specific nodulation by atypical infection.	the psym megaplasmid of rhizobium meliloti 2011 mobilized by plasmid rp4, or plasmid pgmi42, an rp4-prime derivative which carries a 290-kilobase psym fragment including nitrogenase and nod genes, was introduced into agrobacterium tumefaciens. the resulting transconjugants induced root deformations specifically on the homologous hosts medicago sativa and melilotus alba and not on the heterologous hosts trifolium pratense and trifolium repens. the root deformations were shown to be genuine nodule ...	1984	6690420
hairy-root-inducing plasmid: physical map and homology to tumor-inducing plasmids.	a physical map was constructed for the 250-kilobase plasmid pria4b, which confers the virulence properties of a strain of agrobacterium rhizogenes for hairy root disease in plants. the complete hindiii and kpni restriction map was determined from a collection of overlapping hindiii partial digest clones. homologous regions with two well-characterized plasmids that confer virulence for crown gall disease, plasmids ptia6 and ptit37, were mapped on pria4b. as much as 160 kilobases of pria4b had det ...	1984	6690423
rhizobium meliloti competitiveness and the alfalfa agglutinin.	we have isolated two types of isolates having identical colony morphologies from stock cultures of two different rhizobium meliloti strains. one isolate was agglutinated at a high-dilution titer (ha, highly agglutinable) of the alfalfa agglutinin and was sensitive to phage f20, and the other was agglutinated at a lower agglutinin titer (la) and was sensitive to phage 16b. all la isolates from the original slant produced nodules on alfalfa earlier than did ha strains from the original slant. when ...	1984	6698937
d-glucosaminate dehydratase: spectrometric properties of the enzyme-bound pyridoxal 5'-phosphate.	the holoenzyme of d-glucosaminate dehydratase [ec 4.2.1.26] from agrobacterium radiobacter showed absorption peaks at 280 and 415 nm with a shoulder in the region of 320 to 330 nm. the treatment of the enzyme with hydroxylamine followed by dialysis led to disappearance of both the absorption peak at 415 nm and the shoulder, giving the apoenzyme. the fluorescence excitation maximum of the holoenzyme was at 320 nm with a shoulder at 420 nm (emission at 510 nm), and the emission maxima were at 420 ...	1984	6706902
large scale preparation of rhizobium meliloti bacteriophages by fermenter culture.	a simple method for preparation of rhizobium meliloti bacteriophages was established employing fermenter culture. this technique allowed phage production to be checked by dissolved oxygen measure. phage suspensions ranging from 5.10(12) to 1.2.10(13) pfu/ml were found after polyethylene glycol precipitation and centrifugation in cscl.	1984	6707183
transfer of the octopine t-dna segment to plant cells mediated by different types of agrobacterium tumor- or root-inducing plasmids: generality of virulence systems.	genetic complementation studies demonstrated that the transfer to plant cells of the octopine t-dna, entirely present as the only part of the tumor-inducing (ti) plasmid on the plasmid pal1050, was effected by the virulence systems from related plasmids, viz. the nopaline ti plasmid ptic58, the limited host range plasmid ptiag57, and the root-inducing (ri) plasmid pri1855. rhizobium symbiosis plasmids were not capable of effecting the introduction of pal1050 into plant cells.	1984	6715283
light-regulated expression of a pea ribulose-1,5-bisphosphate carboxylase small subunit gene in transformed plant cells.		1984	6719112
heterogeneity of rhizobium lipopolysaccharides.	the lipopolysaccharides ( lpss ) from strains of rhizobium leguminosarum, rhizobium trifolii, and rhizobium phaseoli were isolated and partially characterized by mild acid hydrolysis and by polyacrylamide gel electrophoresis. mild acid hydrolysis results in a precipitate which can be removed by centrifugation or extraction with chloroform. the supernatant contains polysaccharides which, in general, are separated into two fractions ( lps1 and lps2 ) by sephadex g-50 gel filtration chromatography. ...	1984	6725208
visualization and exact molecular weight determination of a rhizobium meliloti megaplasmid.	the entire dna of rhizobium meliloti mvii /1 cells was isolated preparatively by gentle lysis and sucrose gradient centrifugation. fractions of the sucrose gradient were investigated by electron microscopy. we found intact megaplasmids in supercoiled and relaxed form and total chromosomes. the length of the megaplasmid could be measured, which allowed an exact determination of the molecular weight. we found a length of 0.48 +/- 0.019 mm equivalent to a molecular weight of about 1000 x 10(6).	1984	6726810
flagella-specific bacteriophages of agrobacterium tumefaciens: demonstration of virulence of nonmotile mutants.	bacteriophages gs2 and gs6 for agrobacterium tumefaciens were shown by electron microscopy to adsorb to flagella. this specificity was confirmed by the finding that phage-resistant mutants were nonmotile. such mutants retained tumor-inducing virulence and ability to attach to plant cells, indicating that motility was not required for these properties. both phages had contractile tails and appeared similar in the electron microscope.	1984	6744126
transformation of several species of higher plants by agrobacterium rhizogenes: sexual transmission of the transformed genotype and phenotype.	the t-dna of the ri plasmid from agrobacterium rhizogenes is compatible with the regeneration of whole plants from genetically transformed roots and is transmitted through meiosis to the progeny of genetically transformed plants in carrot, tobacco, and morning glory (convolvulus arvensis). the presence of ri t-dna is correlated with a phenotype that in some respects is invariable from species to species and in other respects varies as a function of species, organ clone within species, or individ ...	1984	6744417
transcription of a zein gene introduced into sunflower using a ti plasmid vector.	a maize genomic clone containing a zein gene (z4) was inserted into the t-region of the t37 ti plasmid. agrobacterium tumefaciens cells carrying this modified ti plasmid were used to inoculate sunflower stemlets. callus tissue active in nopaline synthesis was grown from a single transformed cell. dna analysis of this tissue showed that the zein gene plus t-dna was present in approximately 12 copies per diploid sunflower genome. a 1000 +/- 100 base rna homologous to a zein probe could be isolated ...	1984	6745240
nodulation of soybeans as affected by half-root infection with heterodera glycines.	a split-root technique was applied to soybean, glycine max (l.) merr. cv. lee 68, to characterize the nature of the nodulation suppression by race 1 of the soybean cyst nematode (scn), heterodera glycines. root-halves of each split-root plant were inoculated with rhizobium japonicum, and one root-half only was inoculated with various numbers of scn eggs. nodulation (indicated by nodule number, nodule weights, and ratio of nodule weight to root weight) and nitrogen-fixing capacity (indicated by r ...	1984	19295882
structural genes of dinitrogenase and dinitrogenase reductase are transcribed from two separate promoters in the broad host range cowpea rhizobium strain irc78.	the nucleotide sequence of the structural gene (nifd) coding for the alpha-subunit of dinitrogenase along with its flanking sequences has been determined in cowpea rhizobium irc78. the coding sequence consists of 1500 nucleotides, which corresponds to a predicted amino acid sequence of 500 residues and a molecular weight of 56,025. nucleotide homology to nifd from the blue-green alga, anabaena, and parasponia rhizobium, are 63% and 90%, respectively. cowpea rhizobium irc78 nifd and nifk (encodes ...	1984	16578778
rhizobium free-living nitrogen fixation occurs in specialized nongrowing cells.	a model for free-living n(2) fixation by rhizobium sp. rc3200 is presented that asserts that this process occurs in nongrowing cells. cultures containing mixed populations of cell types, n(2)-fixing and vegetative, grow cooperatively. in nitrogen-limited liquid suspension cultures, cooperative growth occurs by means of ammonium that is produced and exported by nongrowing, n(2)-fixing cells and transported to vegetative cells. this model implies prokaryotic differentiation: the creation of metabo ...	1984	16593433
plasmid-linked nif and "nod" genes in fast-growing rhizobia that nodulate glycine max, psophocarpus tetragonolobus, and vigna unguiculata.	forty-nine fast-growing rhizobium strains from the nodules of 26 different tropical legume genera were screened to find isolates that would (i) nodulate, e.g., winged beans, so producing large nodules for rna and protein isolation; (ii) also nodulate various small-seeded legumes, thus allowing screening of large numbers of mutants; and (iii) harbor plasmids containing nif structural genes as well as other functions involved in nodulation. on the basis of six different criteria, this rhizobial gr ...	1984	16593465
expression of beta-galactosidase controlled by a nitrogenase promoter in stem nodules of aeschynomene scabra.	a 365-base-pair (bp) dna fragment, containing the promoter region of the nitrogenase reductase (nifh) gene from stem rhizobium btai1, has been isolated and sequenced. the transcription initiation sites were localized at positions 152 (major initiation) and 114 (minor initiation) nucleotides upstream of the translation initiation codon. the 200-bp nucleotide sequence upstream of the nifh structural gene shows substantial homology to the corresponding nifh regions of cowpea rhizobium (100%), paras ...	1984	16593514
cloned avirulence gene of pseudomonas syringae pv. glycinea determines race-specific incompatibility on glycine max (l.) merr.	a genomic library of pseudomonas syringae pv. glycinea race 6 dna was constructed in the mobilizable cosmid vector plafr1 and maintained in escherichia coli hb101. completeness of the library was estimated by assaying clones for the expression of ice-nucleating activity in e. coli. ice-nucleation activity was represented approximately once in every 600 clones. six hundred eighty random race 6 cosmid clones were mobilized from e. coli by plasmid prk2013 in individual conjugations to a race 5 stra ...	1984	16593517
the phylogeny of purple bacteria: the alpha subdivision.	the technique of oligonucleotide cataloging shows the purple photosynthetic eubacteria to comprise three major subdivisions, temporarily called alpha, beta, and gamma--previously designated groups i-iii by gibson et al. (1979). each subdivision contains a number of non-photosynthetic genera in addition to the photosynthetic ones. the alpha subdivision, the subject of the present report, contains most but not all of the species that fall into the classically defined genera rhodospirillum, rhodo ...	1984	11541974
mineral soils as carriers for rhizobium inoculants.	mineral soil-based inoculants of rhizobium meliloti and rhizobium phaseoli survived better at 4 degrees c than at higher temperatures, but ca. 15% of the cells were viable at 37 degrees c after 27 days. soil-based inoculants of r. meliloti, r. phaseoli, rhizobium japonicum, and a cowpea rhizobium sp. applied to seeds of their host legumes also survived better at low temperatures, but the percent survival of such inoculants was higher than peat-based inoculants at 35 degrees c. survival of r. pha ...	1984	16346460
phosphate nutrition of rhizobium spp.	this study was conducted to determine the behavior of 40 strains from six species of rhizobium in liquid defined media containing orthophosphate at levels likely to be encountered naturally, ranging from the high concentrations expected in nodules and artificial media to the low concentrations of soil solutions. storage capacity in strains with high levels (2 mm) of p and ability to utilize this stored p for growth after transfer to low levels (0.06 mum) of p varied with each strain. storage var ...	1984	16346468