Publications

influence of iron-removal procedures on sequential electron transfer in photosynthetic bacterial reaction centers studied by transient epr spectroscopy.	electron spin polarized electron paramagentic resonance (esp epr) spectra were obtained with deuterated iron-removed photosynthetic bacterial reaction centers (rcs) to specifically investigate the effect of the rate of primary charge separation, metal-site occupancy, and h-subunit content on the observed p865+qa- charge-separated state. fe-removed and zn-substituted rcs from rb. sphaeroides r-26 were prepared by refined procedures, and specific electron transfer rates (kq) from the intermediate ...	1997	9214300
temperature dependence of the qy resonance raman spectra of bacteriochlorophylls, the primary electron donor, and bacteriopheophytins in the bacterial photosynthetic reaction center.	qy-excited resonance raman spectra of the accessory bacteriochlorophylls (b), the bacteriopheophytins (h), and the primary electron donor (p) in the bacterial photosynthetic reaction center (rc) of rhodobacter sphaeroides have been obtained at 95 and 278 k. frequency and intensity differences are observed in the low-frequency region of the p vibrational spectrum when the sample is cooled from 278 to 95 k. the b and h spectra exhibit minimal changes of frequencies and relative intensities as a fu ...	1997	9214301
identification of membrane spanning beta strands in bacterial porins.	the membrane assembly of outer membrane proteins is more complex than that of transmembrane helical proteins owing to the intervention of many charged and polar residues in the membrane. accordingly, the predictive accuracy of transmembrane beta strands is considerably lower than that of transmembrane alpha helices. in this paper we develop a set of conformational parameters for membrane spanning beta strands. we formulate an algorithm to predict the transmembrane beta strands in the family of b ...	1997	9215567
dna binding characteristics of crtj. a redox-responding repressor of bacteriochlorophyll, carotenoid, and light harvesting-ii gene expression in rhodobacter capsulatus.	previous genetic analysis indicated that the photosynthesis gene cluster from rhodobacter capsulatus coded for the transcription factor, crtj, that is responsible for aerobic repression of bacteriochlorophyll, carotenoid, and light harvesting-ii gene expression. in this study, we have heterologously overexpressed and purified crtj to homogeneity and shown by gel mobility shift assays that crtj is biologically active. dnase i footprint analysis confirms molecular genetic studies by showing that c ...	1997	9218481
protein and gene structure of the nadh-binding fragment of rhodobacter capsulatus nadh:ubiquinone oxidoreductase.	membranes of aerobically grown rhodobacter capsulatus contain only one type of nadh:ubiquinone oxidoreductase which is homologous to the proton-translocating complex i. the k(m) value of the enzyme for nadh was determined to be 8 microm. after solubilization of the membranes with an alkylglucoside detergent, two fragments of complex i with molecular masses of 110 kda and 140 kda were isolated by chromatographic steps in the presence of detergent. both fragments contain at least two polypeptides ...	1997	9219542
molecular analysis of the rhodobacter capsulatus chaperone dnakj operon: purification and characterization of dnak.	in rhodobacter capsulatus (rbc), the participation of dnak in the synthesis of light harvesting antenna complex i (lhi) has been recently inferred from the finding that the amount of lhi alpha- and beta-polypeptides synthesized in an in vitro translation system was strongly reduced when dnak was depleted. in the present work, a dnak protein was isolated from rbc and biochemically characterized. the n-terminus of the protein was sequenced and a corresponding oligo was used as probe in order to cl ...	1997	9224898
mixed lipid-protein films of bacterial photosynthetic reaction centres. ii. mixed multilayers on solid supports.	mixed lipid-protein multilayers composed of the reaction centre (rc) proteins from the chloroflexus aurantiacus and rhodobacter sphaeroides (wild type) photosynthetic bacteria and synthetic lipids were investigated. the optimal conditions for forming thin films on solid plates (approximately 100% transfer) were 30 mn/m surface pressure and transfer of the interfacial monolayers from the buffer/air interface onto the plates by the langmuir-schaefer method. the films transferred onto quartz and op ...	1997	9225257
cloning, sequencing, and oxygen regulation of the rhodobacter capsulatus alpha-ketoglutarate dehydrogenase operon.	the rhodobacter capsulatus suca, sucb, and lpd genes, which encode the alpha-ketoglutarate dehydrogenase (e1o), the dihydrolipoamide succinyltransferase (e2o), and the dihydrolipoamide dehydrogenase (e3) components of the alpha-ketoglutarate dehydrogenase complex (kgd), respectively, were cloned, sequenced, and used for regulatory analyses. the kgd enzymatic activity was greater in cells grown under aerobic, respiratory growth conditions than under anaerobic, photosynthetic conditions. similarly ...	1997	9226266
amaricoccus gen. nov., a gram-negative coccus occurring in regular packages or tetrads, isolated from activated sludge biomass, and descriptions of amaricoccus veronensis sp. nov., amaricoccus tamworthensis sp. nov., amaricoccus macauensis sp. nov., and amaricoccus kaplicensis sp. nov.	three isolates of gram-negative bacteria, strains ben 102t, ben 103t, and ben 104t, were obtained in pure culture by micromanipulation from activated sludge biomass from wastewater treatment plants in italy, australia, and macau, respectively. these isolates all had a distinctive morphology; the cells were cocci that usually were arranged in tetrads. based on this criterion, they resembled other bacteria from activated sludge previously called "g" bacteria. on the basis of phenotypic characteris ...	1997	9226904
triplet energy transfer between the primary donor and carotenoids in rhodobacter sphaeroides r-26.1 reaction centers incorporated with spheroidene analogs having different extents of pi-electron conjugation.	three carotenoids, spheroidene, 3,4-dihydrospheroidene and 3,4,5,6-tetrahydrospheroidene, having 8, 9 and 10 conjugated carbon-carbon double bonds, respectively, were incorporated into rhodobacter (rb.) sphaeroides r-26.1 reaction centers. the extents of binding were found to be 95 +/- 5% for spheroidene, 65 +/- 5% for 3,4-dihydrospheroidene and 60 +/- 10% for 3,4,5,6-tetrahydrospheroidene. the dynamics of the triplet states of the primary donor and carotenoid were measured at room temperature b ...	1997	9230708
diphosphoryl lipid a from rhodobacter sphaeroides inhibits complexes that form in vitro between lipopolysaccharide (lps)-binding protein, soluble cd14, and spectrally pure lps.	an early event in septic shock is the activation of macrophages by a complex consisting of lipopolysaccharide (lps), lps-binding protein (lbp), and the cell surface antigen cd14. the complexes that form between [3h]relps (relps is deep-rough-chemotype hexacyl lps from e. coli d31m4), soluble cd14 (scd14), and lbp were analyzed by two independent methods, native (nondenaturing) gel electrophoresis and size-exclusion high-performance liquid chromatography (hplc). this is the first reported use of ...	1997	9234747
the characterization and description of representatives of 'g' bacteria from activated sludge plants.	the name tetracoccus cechii is proposed for two strains of the tetrad arranged cocci, previously known as 'g' bacteria, which were isolated from laboratory scale activated sludge plants in the czech republic and in italy. they were morphologically, phenotypically and phylogenetically characterized and found to comprise a novel lineage in the alpha-3 group of the proteobacterial phylum in the domain bacteria. the strains are gram-negative and produce intracellular inclusions of poly-beta-hydroxyb ...	1997	9248083
continuous coupled assay for 5-aminolevulinate synthase.		1997	9250995
polyhydroxyalkanoate production in rhodobacter capsulatus: genes, mutants, expression, and physiology.	like many other prokaryotes, the photosynthetic bacterium rhodobacter capsulatus produces high levels of polyhydroxyalkanoates (phas) when a suitable carbon source is available. the three genes that are traditionally considered to be necessary in the pha biosynthetic pathway, phaa (beta-ketothiolase), phab (acetoacetylcoenzyme a reductase), and phac (pha synthase), were cloned from rhodobacter capsulatus. in r. capsulatus, the phaab genes are not linked to the phac gene. translational beta-galac ...	1997	9251189
positive selection systems for discovery of novel polyester biosynthesis genes based on fatty acid detoxification.	the photosynthetic bacterium rhodobacter capsulatus can grow with short- to long-chain fatty acids as the sole carbon source (r. g. kranz, k. k. gabbert, t. a. locke, and m. t. madigan, appl. environ. microbiol. 63:3003-3009, 1997). concomitant with growth on fatty acids is the production to high levels of the polyester storage compounds called polyhydroxyalkanoates (phas). here, we describe colony screening and selection systems to analyze the production of phas in r. capsulatus. a screen with ...	1997	9251190
coupling of cytochrome and quinone turnovers in the photocycle of reaction centers from the photosynthetic bacterium rhodobacter sphaeroides.	a minimal kinetic model of the photocycle, including both quinone (q-6) reduction at the secondary quinone-binding site and (mammalian) cytochrome c oxidation at the cytochrome docking site of isolated reaction centers from photosynthetic purple bacteria rhodobacter sphaeroides, was elaborated and tested by cytochrome photooxidation under strong continuous illumination. the typical rate of photochemical excitation by a laser diode at 810 nm was 2.200 s-1, and the rates of stationary turnover of ...	1997	9251814
the dmsr gene encoding a dimethyl sulfoxide-responsive regulator for expression of dmscba (dimethyl sulfoxide respiration genes) in rhodobacter sphaeroides f. sp. denitrificans.	upstream of the dmscba genes encoding dimethyl sulfoxide (dmso) reductase in the phototrophic bacterium rhodobacter sphaeroides f. sp. denitrificans, there was found one gene (referred to dmsr) which encoded a protein composed of 232 amino acid residues and was divergently transcribed from the dmscba genes. the deduced amino acid sequence was homologous to the ompr subfamily of response regulators in two-component systems for transcriptional regulation. the encoded protein dmsr was shown to bind ...	1997	9256068
the roles of the two proton input channels in cytochrome c oxidase from rhodobacter sphaeroides probed by the effects of site-directed mutations on time-resolved electrogenic intraprotein proton transfer.	the crystal structures of cytochrome c oxidase from both bovine and paracoccus denitrificans reveal two putative proton input channels that connect the heme-copper center, where dioxygen is reduced, to the internal aqueous phase. in this work we have examined the role of these two channels, looking at the effects of site-directed mutations of residues observed in each of the channels of the cytochrome c oxidase from rhodobacter sphaeroides. a photoelectric technique was used to monitor the time- ...	1997	9256439
sequence of a 189-kb segment of the chromosome of rhodobacter capsulatus sb1003.	cosmids from the 1a3-1a10 region of the complete miniset were individually subcloned by using the vector m13 mp18. sequences of each cosmid were assembled from about 400 dna fragments generated from the ends of these phage subclones and merged into one 189-kb contig. about 160 orfs identified by the codonuse program were subjected to similarity searches. the biological functions of 80 orfs could be assigned reliably by using the wit and magpie genome investigation tools. eighty percent of these ...	1997	9256491
effect of hydration on the structure, dynamics and function of photosynthetic membranes of purple bacteria.	nmr spectra and relaxation times t1 and t2 for 31p in membranes of rhodobacter sphaeroides were investigated at different relative humidity levels. the results are compared to the hydration curves, fatty acid composition and the structure-dynamic and functional characteristics of the membranes of photosynthetic bacteria rb. sphaeroides, rhodospirillum rubrum and ectothiorhodospira shaposhnikovii. the differences in the state of lipid phase of these membranes are revealed under low humidity, and ...	1997	9257278
a new nos gene downstream from nosdfy is essential for dissimilatory reduction of nitrous oxide by rhizobium (sinorhizobium) meliloti.	rhizobium (sinorhizobium) meliloti strains capable of dissimilatory nitrous oxide reduction (nos+) carry a nosrzdfy gene cluster on a 10.1 kb ecori fragment of the nod megaplasmid near the fixghis genes. these nos genes are arranged in three complementation groups and the 10.1 kb ecori fragment is sufficient to confer nos activity to r. meliloti strains lacking such activity. an overlapping hindiii fragment containing the nosrzdfy genes but missing a 0-6 kb hindiii-ecori downstream segment was f ...	1997	9274035
mannitol dehydrogenase from rhodobacter sphaeroides si4: subcloning, overexpression in escherichia coli and characterization of the recombinant enzyme.	by polymerase chain reaction mutagenesis techniques, an ndei restriction site was introduced at the initiation codon of the mannitol dehydrogenase (mdh) gene (mtlk) of rhodobacter sphaeroides si4. the mtlk gene was then subcloned from plasmid pak74 into the ndei site of the overexpression vector pet24a+ to give plasmid pasfg1. plasmid pasfg1 was introduced into escherichia coli bl21(de3), which was grown in a 1.5-1 bioreactor at 37 degrees c and ph 7.0. overexpression of mdh in escherichia coli ...	1997	9274047
temperature dependence of the electrogenic reaction in the qb site of the rhodobacter sphaeroides photosynthetic reaction center: the qa-qb --> qaqb- transition.	the temperature dependencies for the kinetics and relative amplitudes of electrogenic reaction(s) coupled with the first reduction of the secondary quinone acceptor qb were measured with dark-adapted chromatophores of rhodobacter sphaeroides. the kinetics, while acceptably fitted by a single exponent at room temperature, clearly split into two components below 15 degrees c (rise times, 25 micros and 300 micros at ph 7.0 and 10 degrees c) with the slow phase ousting the fast one at ph > 9.0. the ...	1997	9276452
rapid, sensitive, microbial detection by gene amplification using restriction endonuclease target sequences.	the use of primers synthesized to eight class ii restriction endonuclease target sequences, from haemophilus parainfluenzae, escherichia coli, staphylococcus aureus, salmonella infantis, rhodobacter sphaeroides, klebsiella pneumoniae, bacillus amyloliquefaciens and proteus vulgaris for single and multiplex pcr identification of the organisms is discussed. results indicate that the method is sensitive and specific enough to detect single cells and attogram amounts of target dna. it has also been ...	1997	9281417
photosynthesis: a new twist to biological solar power.	new crystallographic data for the bacterial photoreaction centre have brought an intriguing insight into the structural changes that accompany the primary event in photosynthesis, the conversion of light energy into chemical energy.	1997	9285702
structure of the puf operon of the obligately aerobic, bacteriochlorophyll alpha-containing bacterium roseobacter denitrificans och114 and its expression in a rhodobacter capsulatus puf puc deletion mutant.	roseobacter denitrificans (erythrobacter species strain och114) synthesizes bacteriochlorophyll a (bchl) and the photosynthetic apparatus only in the presence of oxygen and is unable to carry out primary photosynthetic reactions and to grow photosynthetically under anoxic conditions. the puf operon of r. denitrificans has the same five genes in the same order as in many photosynthetic bacteria, i.e., pufbalmc. pufc, the tetraheme subunit of the reaction center (rc), consists of 352 amino acids ( ...	1997	9286973
differential levels of specific cytochrome c biogenesis proteins in response to oxygen: analysis of the ccl operon in rhodobacter capsulatus.	the photosynthetic bacterium rhodobacter capsulatus synthesizes c-type cytochromes under a variety of growth conditions. for example, under aerobic growth, c-type cytochromes are synthesized as part of an electron transport pathway, using oxygen as the terminal electron acceptor. anaerobically in the light, r. capsulatus requires cytochrome bc1 and other c-type cytochromes for the photosynthetic electron transport pathway. it is shown here that the ccl1 and ccl2 genes of r. capsulatus are requir ...	1997	9286996
trap transporters: a new family of periplasmic solute transport systems encoded by the dctpqm genes of rhodobacter capsulatus and by homologs in diverse gram-negative bacteria.	the dct locus of rhodobacter capsulatus encodes a high-affinity transport system for the c4-dicarboxylates malate, succinate, and fumarate. the nucleotide sequence of the region downstream of the previously sequenced dctp gene (encoding a periplasmic c4-dicarboxylate-binding protein) was determined. two open reading frames (orfs) of 681 bp (dctq) and 1,320 bp (dctm) were identified as additional dct genes by insertional mutagenesis and complementation studies. dctq (24,763 da) and dctm (46,827 d ...	1997	9287004
analysis of the role of the nnrr gene product in the response of rhodobacter sphaeroides 2.4.1 to exogenous nitric oxide.	rhodobacter sphaeroides 2.4.1, which is incapable of denitrification, has been found to carry nnrr, the nor operon, and nnrs, which are utilized for denitrification in r. sphaeroides 2.4.3. the gene encoding nitrite reductase was not found in 2.4.1. expression of beta-galactosidase activity from a norb-lacz fusion was activated when cells of 2.4.1 were incubated with no-producing bacteria. this result indicates that the products of nnrr and the genes flanking it are utilized when 2.4.1 is growin ...	1997	9287025
the role of betaarg-10 in the b800 bacteriochlorophyll and carotenoid pigment environment within the light-harvesting lh2 complex of rhodobacter sphaeroides.	previous work has suggested that the betaarg-10 residue forms part of the binding site for the b800 bacteriochlorophyll in the lh2 complex of rhodobactersphaeroides [crielaard, w., visschers, r. w., fowler, g. j. s., van grondelle, r., hellingwerf, k. j., hunter, c. n. (1994) biochim. biophys. acta1183, 473-482], and this is consistent with the x-ray crystallographic data that have been subsequently obtained for the related lh2 complex from rhodopseudomonas acidophila [mcdermott, g., prince, s. ...	1997	9287171
antenna excited state decay kinetics establish primary electron transfer in reaction centers as heterogeneous.	the decay of the excited primary electron donor p* in bacterial photosynthetic reaction centers (both membrane-bound and detergent-isolated) has been observed to be nonexponential on a time scale of some tens of picoseconds. although the multipicosecond nonexponentiality of p* has been ascribed to heterogeneity in teh rate of primary electron transfer (pet), the decay kinetics can be interpreted equally well using homogeneous models. to address this ambiguity, we studied the decay of excited bac ...	1997	9289013
functional analysis of the reca promoter of rhodobacter capsulatus.	expression of the rhodobacter capsulatus reca gene is inducible by dna damage. by using primer extension and serial deletion, we have identified the promoter of the r. capsulatus reca gene. electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the r. capsulatus reca promoter containing the imperfect palindromic ttgtactcataccatgagaacaa, which is centered on position-8 with respect to the transcriptional starting site. pcr mutagenesis of both halves of th ...	1997	9294033
the ccrm dna methyltransferase is widespread in the alpha subdivision of proteobacteria, and its essential functions are conserved in rhizobium meliloti and caulobacter crescentus.	the caulobacter crescentus dna methyltransferase ccrm (m.ccrmi) methylates the adenine residue in the sequence gantc. the ccrm dna methyltransferase is essential for viability, but it does not appear to be part of a dna restriction-modification system. ccrm homologs are widespread in the alpha subdivision of gram-negative bacteria. we have amplified and sequenced a 258-bp region of the cerm gene from several of these bacteria, including rhizobium meliloti, brucella abortus, agrobacterium tumefac ...	1997	9294447
the involvement of serine 175 and alanine 185 of cytochrome b of rhodobacter sphaeroides cytochrome bc1 complex in interaction with iron-sulfur protein.	an approach involving cysteine replacement of potentially noncritical amino acid residues, followed by chemical modification studies, was used to investigate structure-function of the "cd helix" of cytochrome b from rhodobacter sphaeroides. three amino acid residues, ser-155, ser-175, and ala-185, which span this region of cytochrome b, were selected for this study. the s155c substitution yields cells unable to support photosynthetic growth, indicating that ser-155 is a critical amino acid resid ...	1997	9295316
behavioural responses of bacteria to light and oxygen.	motile bacteria have long been known to swim towards or away from specific environmental stimuli such as nutrients, oxygen or light. although there has been a detailed description of chemosensory responses in enteric species for several years, there has been little information on the mechanisms involved in responses to stimuli affecting electron transport as these usually also change the electrochemical proton gradient - at least transiently - and, thus, directly change flagellar rotation. there ...	1997	9297461
the electron transport system of the halophilic purple nonsulfur bacterium rhodospirillum salinarum. 1. a functional and thermodynamic analysis of the respiratory chain in aerobically and photosynthetically grown cells.	plasma membranes isolated from cells of the halophilic purple nonsulfur bacterium rhodospirillum salinarum grown in light or in the dark were examined. membranes isolated from cells grown aerobically in the dark contained three b-type and two c-type membrane-bound cytochromes with em,7 of +180, +72 and -5 mv (561-575 nm), and +244 and +27 mv (551-540 nm), respectively. conversely, membranes isolated from cells grown anaerobically in the light contained two b-type and five c-type haems with em,7 ...	1997	9297468
characterization of porin from roseobacter denitrificans.	porin from roseobacter denitrificans was isolated and purified to homogeneity. the pore characteristics from this marine bacterium were compared to those of its phylogenetically closely related freshwater bacteria rhodobacter capsulatus, rhodobacter sphaeroides and rhodopseudomonas blastica. the porin formed weakly cation-selective, general diffusion pores in lipid bilayer membranes. high transmembrane potentials caused channel closing in steps that were of one or two thirds of the initial on-st ...	1997	9298192
primary electron transfer kinetics in membrane-bound rhodobacter sphaeroides reaction centers: a global and target analysis.	absorbance difference kinetics were measured on quinone-reduced membrane-bound wild type rhodobacter sphaeroides reaction centers in the wavelength region from 690 to 1060 nm using 800 nm excitation. global analysis of the data revealed five lifetimes of 0.18, 1.9, 5.1, and 22 ps and a long-lived component for the processes that underlie the spectral evolution of the system. the 0.18 ps component was ascribed to energy transfer from the excited state of the accessory bacteriochlorophyll (b*) to ...	1997	9298955
a thioreduction pathway tethered to the membrane for periplasmic cytochromes c biogenesis; in vitro and in vivo studies.	the c-type cytochromes are distinguished from other heme proteins by the covalent ligation of two heme vinyl groups to two cysteine residues on the apoprotein (at a cxxch domain). the present study was undertaken to elucidate the roles and topological locations of two of the proteins necessary for cytochrome c biogenesis, the helx and ccl2 proteins in the gram-negative bacteria rhodobacter capsulatus. from their primary sequence, each of these proteins has a cxxc motif that could be involved in ...	1997	9299319
a nonradioactive double detection method for the assignment of spots in two-dimensional blots.	a method for identification of spots on two-dimensional electrophoresis gels by means of immunoblotting is described. this method does not require radioactive-labeled proteins and is based on the dual use of colloidal gold staining to detect the general 2d pattern on the blot and on chemiluminescence to detect the antibody-reactive spot(s). profit is taken from the fact that the general gold stain produces a background pattern on strong ecl exposures, which allows alignment of the antibody-react ...	1997	9300084
the assimilatory nitrate reductase from the phototrophic bacterium, rhodobacter capsulatus e1f1, is a flavoprotein.	the assimilatory nitrate reductase from the phototrophic bacterium rhodobacter capsulatus has been purified to electrophoretic homogeneity and its molecular and kinetic parameters determined. the native nitrate reductase is a dimer of 144 kda composed of two subunits of 46 and 95 kda. the purified enzyme catalyzes the electron transfer from nadh, reduced bromophenol blue or reduced viologens to nitrate. the nitrate reductase contains 1 mol fad per mole of enzyme and also reduces cytochrome c or ...	1997	9305729
conserved nonliganding residues of the rhodobacter capsulatus rieske iron-sulfur protein of the bc1 complex are essential for protein structure, properties of the [2fe-2s] cluster, and communication with the quinone pool.	the iron-sulfur (fe-s) protein subunit of the bc1 complex, known as the rieske protein, contains a high-potential [2fe-2s] cluster ligated by two nitrogen and two sulfur atoms to its apoprotein. earlier work indicated that in rhodobacter capsulatus these atoms are provided by two cysteine (c133 and c153) and two histidine (h135 and h156) residues, located at the carboxyl-terminal end of the protein [davidson, e., ohnishi, t., atta-asafo-adjei, e., & daldal, f. (1992) biochemistry 31, 3342-3351]. ...	1997	9305957
the amino-terminal portion of the rieske iron-sulfur protein contributes to the ubihydroquinone oxidation site catalysis of the rhodobacter capsulatus bc1 complex.	the rieske iron-sulfur (fe-s) protein subunit of bc1 complexes contains in its carboxyl-terminal part two highly conserved hexapeptide motifs (box i and box ii) that include the four amino acid ligands of its [2fe-2s] cluster. in the preceding paper [liebl, u., sled, v., brasseur, g., ohnishi, t., & daldal, f. (1997) biochemistry 36, 11675-11684], the effects of mutations at two of the nonliganding residues [threonine (t) 134 and leucine (l) 136 in the rhodobactercapsulatus rieske fe-s protein] ...	1997	9305958
factors determining electron-transfer rates in cytochrome c oxidase: studies of the fq(i-391) mutant of the rhodobacter sphaeroides enzyme.	the mechanisms of internal electron transfer and oxygen reduction were investigated in cytochrome c oxidase from rhodobacter sphaeroides (cytochrome aa3) using site-directed mutagenesis in combination with time-resolved optical absorption spectroscopy. electron-transfer reactions in the absence of o2 were studied after flash photolysis of co from the partly-reduced enzyme and the reaction of the fully-reduced enzyme with o2 was studied using the so-called flow-flash technique. results from studi ...	1997	9305969
distribution of a sub-class of bacterial abc polar amino acid transporter and identification of an n-terminal region involved in solute specificity.	a new sub-class of binding protein-dependent transporter with specificity for a broad range of polar amino acids has been identified by sequence comparison, in rhizobium leguminosarum, rhodobacter capsulatus, escherichia coli and pseudomonas fluorescens. southern blotting and pcr analysis has shown that transporters from this new sub-class are widely distributed in gram-negative bacteria, including, in addition to the above, citrobacter freundii, erwinia carotovorum and rhizobium meliloti. abc t ...	1997	9315727
in bacterial reaction centers rapid delivery of the second proton to qb can be achieved in the absence of l212glu.	in the reaction center (rc) of rhodobacter capsulatus, residue l212glu is a component of the pathway for proton transfer to the reduced secondary quinone, qb. we isolated phenotypic revertants of the photosynthetically incompetent (ps-) l212glu-->gln mutant; all of them retain the l212glu-->gln substitution and carry a second-site mutation: l227leu-->phe, l228gly-->asp, l231arg-->cys, or m231arg-->cys. we also characterized the l212ala strain, which is a phenotypic revertant of the ps- l212glu-l ...	1997	9315859
cloning of the sdsa gene encoding solanesyl diphosphate synthase from rhodobacter capsulatus and its functional expression in escherichia coli and saccharomyces cerevisiae.	different organisms produce different species of isoprenoid quinones, each with its own distinctive length. these differences in length are commonly exploited in microbial classification. the side chain length of quinone is determined by the nature of the polyprenyl diphosphate synthase that catalyzes the reaction. to determine if the side chain length of ubiquinone (uq) has any distinct role to play in the metabolism of the cells in which it is found, we cloned the solanesyl diphosphate synthas ...	1997	9324242
isolation and ultrastructural study of the flagellar basal body complex from rhodobacter sphaeroides ws8 (wild type) and a polyhook mutant pg.	filament-hook-basal body (fhbb) complexes were isolated from the purple non-sulphur facultative anaerobic bacterium rhodobacter sphaeroides (ws8) by lysozyme digestion of the cells followed by an alkaline treatment and ultracentrifugation, and they were analysed by electron microscopy. the structure is composed of a filament linked through an enlarged junction to the hook and a basal body composed of l and p rings, a rod, and a less well-defined cytoplasmic ring that has evidence of additional a ...	1997	9325158
molybdate transport and regulation in bacteria.	molybdate is transported in bacteria by a high-affinity transport system composed of a periplasmic binding protein, an integral membrane protein, and an energizer protein. these three proteins are coded by moda, modb, and modc genes, respectively. the moda, modb, and modc proteins from various organisms (escherichia coli, haemophilus influenzae, azotobacter vinelandii, and rhodobacter capsulatus) are very similar. the lowest km value reported for molybdate in the molybdate transport process is a ...	1997	9325422
light-induced electrogenic events associated with proton uptake upon forming qb- in bacterial wild-type and mutant reaction centers.	light-induced voltage changes (electrogenic events) were measured in wild-type and site-directed mutants of reaction centers (rcs) from rhodobacter sphaeroides oriented in a lipid monolayer adsorbed to a teflon film. a rapid increase in voltage associated with charge separation was followed by a slower increase attributed to proton transfer from solution to protonatable amino-acid residues in the vicinity of the qb site. in native reaction centers the proton-transfer voltage had a ph-dependent a ...	1997	9332502
cloning, nucleotide sequence, and overexpression of smos, a component of a novel operon encoding an abc transporter and polyol dehydrogenases of rhodobacter sphaeroides si4.	the gene coding for sorbitol dehydrogenase (sdh) of rhodobacter sphaeroides si4 was located 55 nucleotides upstream of the mannitol dehydrogenase gene (mtlk) within a previously unrecognized polyol operon. this operon probably consists of all the proteins necessary for transport and metabolization of various polyols. the gene encoding sdh (smos) was cloned and sequenced. analysis of the deduced amino acid sequence revealed homology to enzymes of the short-chain dehydrogenase/reductase protein fa ...	1997	9335280
orientation of photosynthetic reaction center reconstituted in neutral and charged liposomes.	the photosynthetic reaction center from the photosynthetic bacterium rhodobacter sphaeroides was reconstituted into neutral, positively charged, or negatively charged liposomes. about 70% of photosynthetic reaction centers were reconstituted in the proteoliposomes exposing their h-subunit outside with positively charged lipids while only 30-40% of them were in the same topological orientation with neutral or negatively charged lipids.	1997	9339562
characterization of the rhodobacter capsulatus housekeeping rna polymerase. in vitro transcription of photosynthesis and other genes.	to begin to characterize biochemically the transcriptional activation systems in photosynthetic bacteria, the rhodobacter capsulatus rna polymerase (rnap) that contains the sigma70 factor (r. capsulatus rnap/sigma70) was purified and characterized using two classical sigma70 type promoters, the bacteriophage t7a1 and the rna i promoters. transcription from these promoters was sensitive to rifampicin, rnase, and monoclonal antibody 2g10 (directed against the escherichia coli sigma70 subunit). spe ...	1997	9341173
sulfite stimulates the atp hydrolysis activity of but not proton translocation by the atp synthase of rhodobacter capsulatus and interferes with its activation by delta muh+.	sulfite stimulates the rate of atp hydrolysis by the atp synthase in chromatophores of rhodobacter capsulatus. the stimulated activity is inhibited by oligomycin. the activation takes place also in uncoupled chromatophores. the activation consists in an increase of about 12-15-fold of the vmax for the atp hydrolysis reaction, while the km for mgatp is unaffected at 0.16+/-0.03 mm. the dependence of vmax on the sulfite concentration follows a hyperbolic pattern with half maximum effect at 12 mm. ...	1997	9346308
programmed cell death in prokaryotes.	programmed cell death (pcd), also referred to as apoptosis, is a cellular "suicide" mechanism, based on information from its own internal metabolism, environment, developmental history, and genome. this system was described in eukaryotes continuously along evolution, through amoebae, nematodes, insects, and animals. pcd is essential for the proper development or function of a cell system, organ, or survival of the organism as a whole. research in the last 2 decades has shown that the life cycle ...	1997	9347220
the coupling of light-induced electron transfer and proton uptake as derived from crystal structures of reaction centres from rhodopseudomonas viridis modified at the binding site of the secondary quinone, qb.	in a reaction of central importance to the energetics of photosynthetic bacteria, light-induced electron transfer in the reaction centre (rc) is coupled to the uptake of protons from the cytoplasm at the binding site of the secondary quinone (qb). in the original structure of the rc from rhodopseudomonas viridis (pdb entry code 1prc), the qb site was poorly defined because in the standard rc crystals it was only approximately 30% occupied with ubiquinone-9 (uq9). we report here the structural ch ...	1997	9351808
extracellular reduction of selenite by a novel marine photosynthetic bacterium.	a novel purple nonsulfur bacterium strain nkpb030619, which has resistance to over 5 mm selenite, was isolated from a marine environment. an initial concentration of 1.1 mm selenite, added to the medium, was decreased to under 0.05 mm within 5 days. the color of the cell suspension turned red within 2 days. the red coloration gradually decreased and black precipitates appeared during 2 weeks of cultivation. under these conditions, two main types of deposit were formed extracellularly. these depo ...	1997	9352678
structural and genetic analysis of a mutant of rhodobacter sphaeroides ws8 deficient in hook length control.	motility in the photosynthetic bacterium rhodobacter sphaeroides is achieved by the unidirectional rotation of a single subpolar flagellum. in this study, transposon mutagenesis was used to obtain nonmotile flagellar mutants from this bacterium. we report here the isolation and characterization of a mutant that shows a polyhook phenotype. morphological characterization of the mutant was done by electron microscopy. polyhooks were obtained by shearing and were used to purify the hook protein mono ...	1997	9352903
photoresponses of the purple nonsulfur bacteria rhodospirillum centenum and rhodobacter sphaeroides.	we have measured the photoresponse of two purple nonsulfur bacteria, rhodobacter sphaeroides and rhodospirillum centenum, under defined conditions in a light beam propagating at 90 degrees to the optical axis of the microscope. this beam presented cells with a steep gradient of intensity perpendicular to the direction of propagation and a shallow gradient in the direction of light propagation. r. centenum, a species that reverses to change direction, accumulated in the light beam, as expected fo ...	1997	9352928
low-resolution sequencing of rhodobacter sphaeroides 2.4.1t: chromosome ii is a true chromosome.	the photosynthetic bacterium rhodobacter sphaeroides 2.4.1t has two chromosomes, ci (approximately 3.0 mb) and cii (approximately 0.9 mb). in this study a low-redundancy sequencing strategy was adopted to analyse 23 out of 47 cosmids from an ordered cii library. the sum of the lengths of these 23 cosmid inserts was approximately 495 kb, which comprised approximately 417 kb of unique dna. a total of 1145 sequencing runs was carried out, with each run generating 559 +/- 268 bases of sequence to gi ...	1997	9353914
transcriptional control of several aerobically induced cytochrome structural genes in rhodobacter sphaeroides.	to decipher how the synthesis of energy-transducing enzymes responds to environmental cues, the response of three rhodobacter sphaeroides aerobic cytochrome gene promoters was analysed under different conditions. two of these promoters are upstream of structural genes (ctad and coxii) for individual subunits of the cytochrome aa3 respiratory complex. the third promoter is that for the cycfg operon, which encodes two c-type cytochromes of unknown function, cytochrome c554 and cycg. primer extensi ...	1997	9353915
proton and electron transfer to the secondary quinone (qb) in bacterial reaction centers: the effect of changing the electrostatics in the vicinity of qb by interchanging asp and glu at the l212 and l213 sites.	the bacterial reaction center (rc) plays a central role in photosynthetic energy conversion by facilitating the light induced double reduction and protonation of a bound quinone molecule, qb. two carboxylic acid residues, asp-l213 and glu-l212, located near qb, were previously shown to be important for proton transfer to qb. in this work, the ability of glu to substitute for asp at l213 and asp to substitute for glu at l212 was tested by site-directed mutagenesis. both single mutants and a doubl ...	1997	9369497
molecular characterisation of the pifc gene encoding translation initiation factor 3, which is required for normal photosynthetic complex formation in rhodobacter sphaeroides ncib 8253.	in order to determine whether translation initiation events play a selective role in regulating the expression of photosynthetic complexes in the photosynthetic bacterium rhodobacter sphaeroides, we have undertaken an initial study to investigate the potential role of translation initiation factor if3, which also behaves as a pleiotropic regulatory factor in some bacteria. following the isolation and purification of a 24-kda if3-like protein (pifc) from r. sphaeroides, we used nested pcr to clon ...	1997	9370368
atpases and phosphate exchange activities in magnesium chelatase subunits of rhodobacter sphaeroides.	three separate proteins, bchd, bchh, and bchi, together with atp, insert magnesium into protoporphyrin ix. an analysis of atp utilization by the subunits revealed the following: bchh catalyzed atp hydrolysis at the rate of 0.9 nmol per min per mg of protein. bchi and bchd, tested individually, had no atpase activity but, when combined, hydrolyzed atp at the rate of 117.9 nmol/min per mg of protein. magnesium ions were required for the atpase activities of both bchh and bchi+d, and these activiti ...	1997	9371849
glutamate 286 in cytochrome aa3 from rhodobacter sphaeroides is involved in proton uptake during the reaction of the fully-reduced enzyme with dioxygen.	the reaction with dioxygen of solubilized fully-reduced wild-type and eq(i-286) (exchange of glutamate 286 of subunit i for glutamine) mutant cytochrome c oxidase from rhodobacter sphaeroides has been studied using the flow-flash technique in combination with optical absorption spectroscopy. proton uptake was measured using a ph-indicator dye. in addition, internal electron-transfer reactions were studied in the absence of oxygen. glutamate 286 is found in a proton pathway proposed to be used fo ...	1997	9374859
site-directed modification of the ligands to the bacteriochlorophylls of the light-harvesting lh1 and lh2 complexes of rhodobacter sphaeroides.	the core light-harvesting lh1 complex of rhodobactersphaeroides consists of an assembly of membrane-spanning alpha and beta polypeptides, each of which binds one bacteriochlorophyll molecule. in this study we have used site-directed mutagenesis to demonstrate that the b880 bacteriochlorophyll binding site of lh1 shows a high degree of specificity for the residue that provides the ligand to the bchl mg2+ ion. alpha his0 (alphah0) was changed to asn, leu, and tyr, and beta his0 (betah0) to asn, gl ...	1997	9376369
relationship between the oxidation potential and electron spin density of the primary electron donor in reaction centers from rhodobacter sphaeroides.	the primary electron donor in bacterial reaction centers is a dimer of bacteriochlorophyll a molecules, labeled l or m based on their proximity to the symmetry-related protein subunits. the electronic structure of the bacteriochlorophyll dimer was probed by introducing small systematic variations in the bacteriochlorophyll-protein interactions by a series of site-directed mutations that replaced residue leu m160 with histidine, tyrosine, glutamic acid, glutamine, aspartic acid, asparagine, lysin ...	1997	9391069
analysis of the fnrl gene and its function in rhodobacter capsulatus.	the fnr gene encodes a regulatory protein involved in the response to oxygen in a variety of bacterial genera. for example, it was previously shown that the anoxygenic, photosynthetic bacterium rhodobacter sphaeroides requires the fnrl gene for growth under anaerobic, photosynthetic conditions. additionally, the fnrl protein in r. sphaeroides is required for anaerobic growth in the dark with an alternative electron acceptor, but it is not essential for aerobic growth. in this study, the fnrl loc ...	1997	9393689
purification and biochemical characterization of a hydroxyneurosporene desaturase involved in the biosynthetic pathway of the carotenoid spheroidene in rhodobacter sphaeroides.	hydroxyneurosporene desaturase is involved in the carotenoid biosynthetic pathway of rhodobacter species. the gene encoding this enzyme was expressed in escherichia coli, purified, and biochemically characterized. the resulting protein contained an n-terminal six-histidine extension which derived from the cloning vector; this allowed for a one-step purification of the enzyme to homogeneity after solubilization with nonidet p-40. the hydrogen acceptor in the c-3,4 desaturation reaction was molecu ...	1997	9393712
a quorum-sensing system in the free-living photosynthetic bacterium rhodobacter sphaeroides.	rhodobacter sphaeroides is a free-living, photoheterotrophic bacterium known for its genomic and metabolic complexity. we have discovered that this purple photosynthetic organism possesses a quorum-sensing system. quorum sensing occurs in a number of eukaryotic host-associated gram-negative bacteria. in these bacteria there are two genes required for quorum sensing, the luxr and luxi homologs, and there is an acylhomoserine lactone signal molecule synthesized by the product of the luxi homolog. ...	1997	9393720
photoresponses in rhodobacter sphaeroides: role of photosynthetic electron transport.	rhodobacter sphaeroides responds to a decrease in light intensity by a transient stop followed by adaptation. there is no measurable response to increases in light intensity. we confirmed that photosynthetic electron transport is essential for a photoresponse, as (i) inhibitors of photosynthetic electron transport inhibit photoresponses, (ii) electron transport to oxidases in the presence of oxygen reduces the photoresponse, and (iii) the magnitude of the response is dependent on the photopigmen ...	1997	8981976
molecular genetic analysis suggesting interactions between appa and ppsr in regulation of photosynthesis gene expression in rhodobacter sphaeroides 2.4.1.	the appa protein plays an essential regulatory role in development of the photosynthetic apparatus in the anoxygenic phototrophic bacterium rhodobacter sphaeroides 2.4.1 (m. gomelsky and s. kaplan, j. bacteriol. 177:4609-4618, 1995). to gain additional insight into both the role and site of action of appa in the regulatory network governing photosynthesis gene expression, we investigated the relationships between appa and other known regulators of photosynthesis gene expression. we determined th ...	1997	8981989
hupuv proteins of rhodobacter capsulatus can bind h2: evidence from the h-d exchange reaction.	the h-d exchange reaction has been measured with the d2-h2o system, for rhodobacter capsulatus jp91, which lacks the hupsl-encoded hydrogenase, and r. capsulatus bse16, which lacks the hupuv proteins. the hupuv gene products, expressed from plasmid pac206, are shown to catalyze an h-d exchange reaction distinguishable from the h-d exchange due to the membrane-bound, hupsl-encoded hydrogenase. in the presence of o2, the uptake hydrogenase of bse16 cells catalyzed a rapid uptake and oxidation of h ...	1997	8982013
reactions of isocytochrome c2 in the photosynthetic electron transfer chain of rhodobacter sphaeroides.	rhodobacter sphaeroides strains lacking cytochrome c2 (cyt c2), the normal electron donor to p870+ in light-oxidized reaction center (rc) complexes, are unable to grow photosynthetically. however, spd mutations that suppress the photosynthetic deficiency of cyt c2 mutants elevate levels of the cyt c2 isoform, isocyt c2. we monitored photosynthetic electron transfer in whole cells, in chromatophores, and with purified components to ascertain if and how isocyt c2 reduced light-oxidized rc complexe ...	1997	9020790
characterization and regulation of the gene encoding nitrite reductase in rhodobacter sphaeroides 2.4.3.	nitrite reductase catalyzes the reduction of nitrite to nitric oxide, the first step in denitrification to produce a gaseous product. we have cloned the gene nirk, which encodes the copper-type nitrite reductase from a denitrifying variant of rhodobacter sphaeroides, strain 2.4.3. the deduced open reading frame has significant identity with other copper-type nitrite reductases. analysis of the promoter region shows that transcription initiates 31 bases upstream of the translation start codon. th ...	1997	9023188
thioredoxin is essential for rhodobacter sphaeroides growth by aerobic and anaerobic respiration.	to investigate the biological role of thioredoxin in the facultative photosynthetic bacterium rhodobacter sphaeroides, attempts were made to construct a thioredoxin-deficient mutant by site-specific mutagenesis, using the tn903 kanamycin resistance gene for selection. in situ and southern hybridization analyses have demonstrated that the trxa- mutation is lethal for r. sphaeroides growth under anaerobic conditions with dmso as terminal electron acceptor and under aerobic conditions. in addition, ...	1997	9025281
[photochemical reaction centers].		1997	9028167
6-ketocholestanol is a recoupler for mitochondria, chromatophores and cytochrome oxidase proteoliposomes.	the effect of 6-ketocholestanol (kch) on various natural and reconstituted membrane systems has been studied. 6-ketocholestanol (5 alpha-cholestan-3 beta-ol-6-one), a compound increasing the membrane dipole potential, completely prevents or reverses the uncoupling action of low concentrations of the most potent artificial protonophore sf6847. this effect can be shown in the rat liver and heart muscle mitochondria, in the intact lymphocytes, in the rhodobacter sphaeroides chromatophores, and in p ...	1997	9030261
mutation in ntrc gene leading to the derepression of nitrogenase synthesis in rhodobacter sphaeroides.	the rhodobacter sphaeroides mutants drn12 and drn21 derepressed for nitrogenase synthesis in the presence of ammonia and impaired in utilization of certain nitrogen sources have been analyzed. both mutants show a low level of expression of the glnba operon. the dna fragment restoring the wild-type phenotype to these mutants contains the 3'-portion of ntrb gene and the entire ntrc gene. sequence analysis showed that drn12 bears a missense mutation in the ntrc gene. the mutation results in the rep ...	1997	9037764
anaerobic carotenoid biosynthesis in rhodobacter sphaeroides 2.4.1: h2o is a source of oxygen for the 1-methoxy group of spheroidene but not for the 2-oxo group of spheroidenone.	anaerobic biosynthesis of carotenoids in the purple facultative photosynthetic bacterium rhodobacter sphaeroides was studied using mass spectrometry. we have demonstrated that (18)o from h2(18)o was incorporated into the 1-methoxy group of spheroidene and spheroidenone, the two major carotenoids produced by this bacterium during photosynthetic growth. neither water nor co2 was shown to provide an oxygen atom for the 2-oxo group of spheroidenone in r. sphaeroides 2.4.1 grown photosynthetically in ...	1997	9038350
regulation of synthesis of pyruvate carboxylase in the photosynthetic bacterium rhodobacter capsulatus.	the synthesis of pyruvate carboxylase (pc) was studied by using quantitative immunoblot analysis with an antibody raised against pc purified from rhodobacter capsulatus and was found to vary 20-fold depending on the growth conditions. the pc content was high in cells grown on pyruvate or on carbon substrates metabolized via pyruvate (lactate, d-malate, glucose, or fructose) and low in cells grown on tricarboxylic acid (tca) cycle intermediates or substrates metabolized without intermediate forma ...	1997	9045800
a hydrogen-sensing system in transcriptional regulation of hydrogenase gene expression in alcaligenes species.	heterologous complementation studies using alcaligenes eutrophus h16 as a recipient identified a hydrogenase-specific regulatory dna region on megaplasmid phg21-a of the related species alcaligenes hydrogenophilus. nucleotide sequence analysis revealed four open reading frames on the subcloned dna, designated hoxa, hoxb, hoxc, and hoxj. the product of hoxa is homologous to a transcriptional activator of the family of two-component regulatory systems present in a number of h2-oxidizing bacteria. ...	1997	9045826
site-directed mutations near the l-subunit d-helix of the purple bacterial reaction center: a partial model for the primary donor of photosystem ii.	we have engineered a photosynthetically competent mutant of the purple non-sulfur bacterium rhodobacter capsulatus which seeks to mimic the behavior of the primary electron donor (p) of the plant photosystem ii (ps ii) reaction center (rc). to construct this mutant (denoted d1-ilmh), four residues in the bacterial l subunit were mutagenized, such that an 11-residue segment was made identical to the analogous segment from the d1 subunit of ps ii. the electronic properties of the bacteriochlorophy ...	1997	9047318
excitation energy transfer between the b850 and b875 antenna complexes of rhodobacter sphaeroides.	energy transfer between the b850 (lh2) and b875 (lh1) antenna complexes of a mutant strain of rhodobacter sphaeroides lacking reaction centers is investigated by femtosecond pump-probe spectroscopy at room temperature. measurements are made at wavelengths between 810 and 910 nm at times extending to 200 ps after selective excitation of either b850 or b875. assignments of the spectroscopic signals to the two types of antenna complex are made on the basis of measurements in strains that lack eithe ...	1997	9047332
the substitution of proline 35 by alanine in rhodobacter capsulatus cytochrome c2 affects the overall protein stability but not the alkaline transition.	it was shown by koshy et al. [1990, proc. natl acad. sci usa, 87, 8697-8701; 1994, biochem. j., 299, 347-350] that the substitution of proline 30 by alanine (p30a) of drosophila melanogaster and rat cytochromes c exhibited decreased stabilities in both the heme iron-methionine sulfur (fe-s) bond and overall protein conformation. now we have found that the stability properties of the equivalent mutant of rhodobacter capsulatus cytochrome c2 (p35a) are somewhat different. based on optical and nmr ...	1997	9051737
aspartate-407 in rhodobacter sphaeroides cytochrome c oxidase is not required for proton pumping or manganese binding.	several pathways for proton transport in cytochrome c oxidase have been proposed on the basis of mutational analysis and x-ray structure: at least one for moving "pumped" protons from the interior to exterior of the membrane and a separate route for transporting "substrate" protons from the interior to the binuclear metal center to combine with oxygen to make h2o. according to the crystal structures of cytochrome c oxidase, asp407 (rhodobacter sphaeroides numbering) is at the interface of subuni ...	1997	9054559
cell-free activity of magnesium chelatase in rhodobacter spheroides and rhodobacter capsulatus.		1997	9056980
functions of conserved tryptophan residues of the core light-harvesting complex of rhodobacter sphaeroides.	we have examined mutants in the core light-harvesting complex of rhodobacter sphaeroides in which the tryptophan residues located at positions alpha+11, beta+6, and beta+9 have been mutated to each of the three other aromatic amino acids, namely tyrosine, phenylalanine, and histidine. we confirm that the alpha+11 residue and show that the beta+9 residue each form a hydrogen bond to a c2-acetyl group of a bchl molecule. mutation of either of these residues to a phenylalanine results in a breakage ...	1997	9062104
influence of asn/his l166 on the hydrogen-bonding pattern and redox potential of the primary donor of purple bacterial reaction centers.	the primary electron donor (p) of the photosynthetic reaction center (rc) from the purple bacterium rhodobacter (rb.) sphaeroides is constituted of two bacteriochlorophyll molecules in excitonic interaction. the c2 acetyl carbonyl group of one of the two bacteriochlorophyll molecules (pl), the one more closely associated with the l polypeptide subunit, is engaged in a hydrogen bond with histidine l168, while the other pi-conjugated carbonyl groups of p are free from such hydrogen-bonding interac ...	1997	9062134
cross-linked electron transfer complex between cytochrome c2 and the photosynthetic reaction center of rhodobacter sphaeroides.	electron donation from the soluble cytochrome (cyt) c2 to the photooxidized primary donor, p+, of reaction centers isolated from rhodobacter sphaeroides was studied by using chemical zero-length cross-linking. this cross-linking stabilizes a 1:1 covalent complex between subunit m of the reaction center and cyt c2. in 80% of the reaction centers, p+ generated by a laser flash is reduced by covalently bound cyt c2. kinetics of p+ reduction show (i) a fast phase with a half-life of 0.7 micros simil ...	1997	9063890
structure and function of cytochrome c2 in electron transfer complexes with the photosynthetic reaction center of rhodobacter sphaeroides: optical linear dichroism and epr.	the photosynthetic reaction center (rc) and its secondary electron donor the water-soluble cytochrome (cyt) c2 from the purple bacterium rhodobacter sphaeroides have been used in cross-linked and non-cross-linked complexes, oriented in compressed gels or partially dried multilayers, to study the respective orientation of the primary donor p (bchl dimer) and of cyt c2. three methods were used: (i) polarized optical absorption spectra at 295 and 10 k were measured and the linear dichroism of the t ...	1997	9063891
evidence for the role of redox carriers in photosynthesis gene expression and carotenoid biosynthesis in rhodobacter sphaeroides 2.4.1.	previous work from this laboratory revealed that alterations in the structure of the cconoqp operon of rhodobacter sphaeroides 2.4.1 could lead to induction of the photosynthetic apparatus under aerobic growth conditions. immediately downstream of the cconoqp operon is the rdxb gene, the first gene of the rdxbhis cluster. the rdxb gene product is predicted to encode a membrane protein which can bind two [4fe-4s] clusters. the ccop gene product is a diheme cytochrome which is a component of the c ...	1997	9068641
the archaeal soxabcd complex is a proton pump in sulfolobus acidocaldarius.	the thermoacidophilic archaeon sulfolobus acidocaldarius expresses a very unusual quinol oxidase, which contains four heme a redox centers and one copper atom. the enzyme was solubilized with dodecyl maltoside and purified to homogeneity by a combination of hydrophobic interaction and anion exchange chromatography. the oxidase complex consists of four polypeptide subunits with apparent molecular masses of 64, 39, 27, and 14 kda that are encoded by the soxabcd operon (lübben, m., kolmerer, b., an ...	1997	9079667
identification, sequence analysis, and expression of the lepb gene for a leader peptidase in rhodobacter capsulatus.	the leader peptidase (signal peptidase i) gene, lepb, of rhodobacter capsulatus has been cloned and sequenced. the amino acid sequence of the predicted protein exhibits similarity to other known bacterial leader peptidases. r. capsulatus belongs to the alpha-subdivision of purple bacteria and thus is a relative of mitochondria in eukaryotes. like the yeast mitochondrial inner membrane proteases imp1 and imp2, the leader peptidase from rhodobacter has only one membrane-spanning segment. sequence ...	1997	9079877
effects of sigmas and the transcriptional activator appy on induction of the escherichia coli hya and cbdab-appa operons in response to carbon and phosphate starvation.	the transcriptional regulation of two energy metabolism operons, hya and cbdab-appa, has been investigated during carbon and phosphate starvation. the hya operon encodes hydrogenase 1, and the cbdab-appa operon encodes cytochrome bd-ii oxidase and acid phosphatase, ph 2.5. both operons are targets for the transcriptional activator appy. in exponential growth, expression of the hya and cbd operons was reduced in an rpos mutant lacking the rna polymerase sigmas factor, and the induction of the two ...	1997	9079897
cloning and characterization of two groesl operons of rhodobacter sphaeroides: transcriptional regulation of the heat-induced groesl operon.	the nonsulfur purple bacterium rhodobacter sphaeroides was found to contain two groesl operons. the groesl1 heat shock operon was cloned from a genomic library, and a 2.8-kb dna fragment was sequenced and found to contain the groes and groel genes. the deduced amino acid sequences of groel1 (cpn60) and groes1 (cpn10) were in agreement with n-terminal sequences previously obtained for the isolated proteins (k. c. terlesky and f. r. tabita, biochemistry 30:8181-8186, 1991). these sequences show a ...	1997	8990302
pleiotropic effects of puf interposon mutagenesis on carotenoid biosynthesis in rubrivivax gelatinosus. a new gene organization in purple bacteria.	rubrivivax gelatinosus mutants affected in the carotenoid biosynthesis pathways were created by interposon mutagenesis within the puf operon. genetic and biochemical analysis of several constructed mutants suggest that at least crtc is localized downstream of the puf operon and that it is cotranscribed with this operon. sequence analysis confirmed the genetic data and showed the presence of crtd and crtc genes downstream of the puf operon, a localization different from that known for other purpl ...	1997	8999844
genetic analysis of chlorophyll biosynthesis.	during this decade, there have been major advancements in the understanding of genetic loci involved in synthesis of the family of mg-tetrapyrroles known as chlorophylls and bacteriochlorophylls. molecular genetic analysis of mg-tetrapyrrole biosynthesis was initiated by the performance of detailed sequence and mutational analysis of the photosynthesis gene cluster from rhodobacter capsulatus. these studies provided the first detailed understanding of genes involved in bacteriochlorophyll a bios ...	1997	9442890
the rhizobium meliloti puta gene: its role in the establishment of the symbiotic interaction with alfalfa.	little is known about the energy sources used by rhizobia during colonization, invasion and root nodule formation on leguminous plants. we have recently reported that an impaired proline metabolism in rhizobium meliloti leads to a reduced nodulation efficiency and competitiveness on alfalfa roots. in the present study we have characterized the r. meliloti proline dehydrogenase gene (puta) and addressed the question of its role in symbiosis. this rhizobial gene encodes a 1224-amino-acid-long poly ...	1997	9004223
analysis of the cbbxyz operon in rhodobacter sphaeroides.	three genes, cbbx, cbby, and cbbz were found downstream from the form i ribulose 1,5-bisphosphate carboxylase/oxygenase (rubisco) genes of rhodobacter sphaeroides. as in chemoautotrophic bacteria, cbbz was shown to encode phosphoglycolate phosphatase (pgp), whereas the identities of cbbx and cbby are not known. to determine the physiological function of the cbbxyz gene products, we constructed r. sphaeroides strains in which the genes were inactivated and characterized the resultant mutant strai ...	1997	9006018