Publications
| Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
|---|
| terbium(iii) fluorescence probe studies on metal ion-binding sites in anticoagulation factor i from agkistrodon acutus venom. | anticoagulation factor i (acf i) isolated from the venom of agkistrodon acutus is an activated coagulation factor x-binding protein with marked anticoagulant activity. present studies show that holo-acf i assumes a compactly folded structure in the range of ph 5-6, in which the most interior trp residues and quenchers are adjacent. tb3+ ions can completely replace both ca2+ ions in holo-acf i, as determined by equilibrium dialysis. although the two tb3+ ions in tb3+-acf i have slightly different ... | 2002 | 11934276 |
| purification, crystallization and preliminary x-ray crystallographic analysis of agkaggregin, a c-type lectin-like protein from agkistrodon acutus venom. | a snake-venom c-type lectin-like protein, agkaggregin, has been isolated from agkistrodon acutus venom. agkaggregin has an apparent molecular mass of about 28 kda and consists of two different types of subunits, an alpha-subunit (approximately 15 kda) and a beta-subunit (approximately 14 kda). agkaggregin has the ability to induce platelet aggregation at concentrations of the order of nanomoles. the agkaggregin crystals grew for nearly a year by hanging-drop vapour diffusion and belong to the i2 ... | 2002 | 11914494 |
| unmasking venom gland transcriptomes in reptile venoms. | while structural studies of reptile venom toxins can be achieved using lyophilized venom samples, until now the cloning of precursor cdnas required sacrifice of the specimen for dissection of the venom glands. here we describe a simple and rapid technique that unmasks venom protein mrnas present in lyophilized venom samples. to illustrate the technique we have rt-pcr-amplified a range of venom protein transcripts from cdna libraries derived from the venoms of a hemotoxic snake, the chinese coppe ... | 2002 | 12470674 |
| effects of terbium and ph on structure of anticoagulation factor ii from agkistrodon acutus venom probed by fluorescent spectroscopy and equilibrium dialysis. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is an activated coagulation factor x-binding protein with marked anticoagulant activity. present studies show that the ph has a marked effect on the fluorescence intensity of holo-acf ii; however, no appreciable shift of the emission maximum of holo-acf ii was observed in the ph range of 3-10. it was deduced from a relatively weak fluorescence emission of holo-acf ii at a neutral ph (6-7) that native holo-acf ii ass ... | 2002 | 12209446 |
| purification and characterization of a novel metalloproteinase, acurhagin, from agkistrodon acutus venom. | acurhagin, a high-molecular mass hemorrhagic metalloproteinase, was purified from the crude venom of agkistrodon acutus using anion-exchange and hydrophobic interaction chromatography. acurhagin is a monomer with a molecular mass of 51.4 kda under non-reducing conditions on sds-page and 48,133 da by mass spectrometry. partial amino acid sequence of its metalloproteinase domain is homologous to other high-molecular mass metalloproteinases from snake venoms. it preferentially cleaved aalpa chain o ... | 2002 | 12008947 |
| purification of nad glycohydrolase from agkistrodon acutus venom. | nad glycohydrolase (nadase) from agkistrodon acutus venom was purified to electrophoretic homogeneity by a fast, reproducible 3-step procedure including q sepharose fast flow, superdex 75, and mono s column chromatography. this new procedure gave a 15.6-fold purification with a recovery yield of 7.9% and a specific activity of 12.8 units/mg. | 2002 | 12135566 |
| ca(ii)- and tb(iii)-induced stabilization and refolding of anticoagulation factor i from the venom of agkistrodon acutus. | anticoagulation factor i (acf i) isolated from the venom of agkistrodon acutus is an activated coagulation factor x-binding protein in a ca(2+)-dependent fashion with marked anticoagulant activity. the equilibrium unfolding/refolding of apo-acf i, holo-acf i, and tb(3+)-reconstituted acf i in guanidine hydrochloride (gdnhcl) solutions was studied by following the fluorescence and circular dichroism. metal ions were found to increase the structural stability of acf i against gdnhcl and thermal de ... | 2002 | 11910037 |
| metal ion-induced stabilization and refolding of anticoagulation factor ii from the venom of agkistrodon acutus. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is an activated coagulation factor x-binding protein in a ca(2+)-dependent fashion with marked anticoagulant activity. the equilibrium unfolding/refolding of apo-acf ii, holo-acf ii, and tb(3+)-reconstituted acf ii in guanidine hydrochloride (gdnhcl) solutions was studied by following the fluorescence and circular dichroism (cd). metal ions were found to increase the structural stability of acf ii against gdnhcl and ... | 2002 | 11888270 |
| structure of an acidic phospholipase a2 from the venom of deinagkistrodon acutus. | an acidic phospholipase a(2) was purified from deinagkistrodon acutus (agkistrodon acutus) which displays an inhibitory effect on platelet aggregation. the three-dimensional structure of the enzyme was determined by molecular replacement at 2.6 a resolution with a crystallographic r factor of 18.40% (r(free) = 22.50%) and reasonable stereochemistry. two molecules in the asymmetric unit form a dimer and the dimer formation accompanies a significant conformational adaptation of segment 14-23, a co ... | 2002 | 11752784 |
| [expression, refolding and biological activity of recombinant type-i metalloproteinase acutolysin a from agkistrodon acutus]. | type-i snake venom metalloproteinase acutolysin a gene was cloned into the prokaryotic expression vector pbad/giiia and the resulting recombinant plasmid pds was obtained. by the induction with 0.02% l-(+)-arabinose, the recombinant metalloproteinase was expressed in insoluble inclusion body in e. coli top10 and reached up to 5%--10% of total bacterial proteins. the recombinant metalloproteinase has an additional sequence of n-terminal 22 amino acids and c-terminal 8 amino acids (housing 6 histi ... | 2002 | 12198576 |
| structure of an acidic phospholipase a(2) from the venom of deinagkistrodon acutus in a new crystal form. | the three-dimensional structure of an acidic phospholipase a(2) purified from the venom of deinagkistrodon acutus (agkistrodon acutus) was determined in a new crystal form by molecular replacement at 0.28 nm resolution with a crystallographic r factor of 21.9% (r-free=25.7%) and reasonable stereochemistry. being similar to the previous reported crystal form, a significant conformational adaptation of segment 14-23 at the dimer interface was observed. this segment was related to the "interface re ... | 2002 | 12019436 |
| purification, n-terminal sequencing, partial characterization, crystallization and preliminary crystallographic analysis of two glycosylated serine proteinases from agkistrodon acutus venom. | aav-sp-i and aav-sp-ii, two glycosylated serine proteinases from agkistrodon acutus venom with fibrinogenolysis and esterolysis activities, have been purified to homogeneity by three-step ion-exchange chromatography. estimated by sds-page, the molecular weights of aav-sp-i and aav-sp-ii are about 32 and 31 kda under reducing conditions and 26 and 25 kda under non-reducing conditions, respectively. the first 24 n-terminal amino-acid residues are the same in both sequences and display a high homol ... | 2003 | 12595722 |
| cdna cloning and high-level expression of a thrombin-like enzyme from agkistrodon acutus venom. | agkistrodon acutus (guenther), a poisonous snake species of the family of crotalidae, is mainly found south of the yellow river in china. the main symptom of this poison is massive hemorrhage, in which thrombin-like enzymes (tles) in the venom play an important role. tles are abundant, especially in the venom of a. acutus. we isolated the total rna from the venom gland tissue of a. acutus and amplified the cdnas of the tles using reverse transcription-polymerase chain reaction (rt-pcr). the cdna ... | 2003 | 12808469 |
| purification, partial characterization and crystallization of acucetin, a protein containing both disintegrin-like and cysteine-rich domains released by auto-proteolysis of a p-iii-type metalloproteinase aah-iv from agkistrodon acutus venom. | aah-iv, a p-iii-type metalloproteinase found in agkistrodon acutus venom, readily cleaves itself to release a stable protein named acucetin at 310 k under neutral and weakly alkaline conditions. a partial amino-acid residue sequence of acucetin indicates that the protein has a high homology to snake-venom proteins containing both disintegrin-like and cysteine-rich domains. acucetin has been crystallized in space group r32, with hexagonal unit-cell parameters a = b = 155.98, c = 76.07 a. the v(m) ... | 2003 | 14646104 |
| the crystal structure of a novel, inactive, lysine 49 pla2 from agkistrodon acutus venom: an ultrahigh resolution, ab initio structure determination. | the crystal structure of acutohaemolysin, a lysine 49 phospholipase a2 protein with 1010 non-hydrogen protein atoms and 232 water molecules, has been determined ab initio using the program snb at an ultrahigh resolution of 0.8 a. the lack of catalytic activity appears to be related to the presence of phe102, which prevents the access of substrate to the active site. the substitution of tryptophan for leucine at residue 10 interferes with dimer formation and may be responsible for the additional ... | 2003 | 12871974 |
| a novel p-i class metalloproteinase with broad substrate-cleaving activity, agkislysin, from agkistrodon acutus venom. | the venom of viperdae is a rich source of metalloproteinases, which have potential clinical applications for lowering plasma fibrinogen or dissolving thrombi. recently, we purified a novel proteinase from formosan agkistrodon acutus venom using deae-sephadex a-50 and mono-q hr 5/5 column chromatography. the purified getatinolytic component, agkislysin, is a 22kda-monomeric protein without asn-linked sugar. functional characterization showed that agkislysin possessed both fibronectin- and type iv ... | 2004 | 15465006 |
| metal-ion- and ph-induced conformational changes of acutolysin d from agkistrodon acutus venom probed by fluorescent spectroscopy. | acutolysin d isolated from the venom of agkistrodon acutus is a protein of 44 kda with marked hemorrhagic and proteolytic activities. the metal-ion- and ph-induced conformational changes of acutolysin d have been studied by following fluorescence and activity measurements. here we provide evidence for the fact that native holo-acutolysin d adopts two different conformations, native state a, stable in the weak acidic ph range from 5.5 to 7.0 with low activity, and native state b, stable in the we ... | 2004 | 15211502 |
| cdna cloning, sequence analysis, and recombinant expression of akitonin beta, a c-type lectin-like protein from agkistrodon acutus. | to clone the cdna of a new member of snake venom c-type lectin-like proteins, to study its structure-function relationships and to achieve its recombinant production. | 2004 | 15000893 |
| hemorrhagic activity and mechanism of fiia, a fibrinolytic enzyme from agkistrodon acutus venom. | to study the local hemorrhagic activity of a fibrinolytic enzyme (fii(a)) from agkistrodon acutus venom and its mechanism. | 2004 | 15066223 |
| reduction of brain injury by antithrombotic agent acutobin after middle cerebral artery ischemia/reperfusion in the hyperglycemic rat. | in vivo magnetic resonance imaging (mri) was used to observe the effect of acutobin, a purified thrombin-like enzyme (tle), isolated from the snake venom of deinagkistrodon acutus, on mri-detected brain lesion volume and tissue perfusion deficit in a hyperglycemic rat right middle cerebral artery occlusion/reperfusion (mcao/r) model. acutobin (0.75 u/ml) was intravenously injected with a dosage of 2.5 u/kg body weight 30 min after mcao (mcao duration=60 min) and again 24 h after reperfusion. mul ... | 2004 | 15353234 |
| purification, characterization, crystallization and preliminary x-ray crystallographic analysis of two novel c-type lectin-like proteins: aall-a and aall-b from deinagkistrodon acutus venom. | aall-a and aall-b, two novel heterodimeric snake-venom c-type lectin-like proteins (sv-clps), were purified from the venom of deinagkistrodon acutus from anhui, china. strikingly, both these proteins can localize on and congregate human erythrocytes, instead of aiming at the common targets of sv-clps such as platelet glycoproteins, von willebrand factors, coagulant factors etc. the crystals of aall-a belong to space group p2, with unit-cell parameters a = 105.2, b = 56.2, c = 108.7 a, beta = 100 ... | 2004 | 15502319 |
| taiwan's venomous snakebite: epidemiological, evolution and geographic differences. | located at the juncture of tropical and subtropical regions, taiwan has a warm and humid climate with abundant precipitation and food, which coupled with the island's diverse vegetation and landscape, makes it a suitable environment for many snake species. among these, naja atra, bungarus multicinctus, deinagkistrodon acutus, trimeresurus mucrosquamatus, trimeresurus stejnegeri, daboia russelii siamensis are the 6 principal venomous species, and have caused significant injuries and death over th ... | 2004 | 14964809 |
| expression of a recombinant anticoagulant c-type lectin-like protein acfi in pichia pastoris: heterodimerization of two subunits is required for its function. | acfi is an anticoagulant c-type lectin-like protein (clp) isolated from agkistrodon acutus venom. to investigate the function of acfi and its subunits, the cdnas of two subunits were transformed and expressed in pichia pastoris separately or together by a novel strategy using two vectors with different selectable markers. the results showed that recombinant homodimers were secreted when the subunits were expressed alone, while heterodimers (racfi) were secreted when two subunits were co-expresse ... | 2005 | 16199073 |
| [cloning and bioinformatics analysis of a thrombin-like enzyme gene from agkistrodon acutus]. | the venoms of viperidae and crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. to obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' atggtgctgatcagagtgctagc 3' and 2 5' ctcctcttaa-ctttttcaaaagttt 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. total rna was prepared from the venom glands of a d. acutus s ... | 2005 | 16129030 |
| crystallization and preliminary x-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of agkistrodon acutus. | a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of agkistrodon acutus has been crystallized by the hanging-drop method. the crystals belong to space group p3(1)21, with unit-cell parameters a = b = 80.57, c = 66.77 a and one molecule in the asymmetric unit. x-ray diffraction data were collected to 1.86 a resolution. | 2005 | 16511039 |
| crystallization and preliminary x-ray crystallographic analysis of agkicetin-c from deinagkistrodon acutus venom. | the crystallization and preliminary crystallographic analysis of agkicetin-c, a well known platelet glycoprotein ib (gpib) antagonist from the venom of deinagkistrodon acutus found in anhui province, china is reported. crystals of agkicetin-c suitable for structure determination were obtained from 1.8 m ammonium sulfate, 40 mm mes ph 6.5 with 2%(v/v) peg 400. interestingly, low buffer concentrations of mes seem to be necessary for crystal growth. the crystals of agkicetin-c belong to space group ... | 2005 | 16508096 |
| how does agkicetin-c bind on platelet glycoprotein ibalpha and achieve its platelet effects? | the platelet glycoprotein (gp) ib-ix-v receptor complex has a central role in primary haemostasis and possesses binding sites for the plasmatic adhesive protein von willebrand factor (vwf) and thrombin. several snake venom components have been identified in recent years that target this receptor complex and modulate its functionality. among them, agkicetin-c is from deinagkistrodon acutus and proved to be a potent antagonist of gpib-ix-v. we further studied the structure-activity relationships o ... | 2005 | 15777951 |
| fibrin(ogen)olytic character of fiia isolated from agkistrodon acutus venom. | to investigate the fibrin(ogen)olytic character of fiia isolated from agkistrodon acutus venom in vitro and in vivo. | 2005 | 15916735 |
| penetrating ocular injury caused by venomous snakebite. | to report the case of a patient who experienced a penetrating ocular injury with direct intraocular injection of venom from a snakebite. | 2005 | 16139013 |
| crystal structure of a non-hemorrhagic fibrin(ogen)olytic metalloproteinase complexed with a novel natural tri-peptide inhibitor from venom of agkistrodon acutus. | thrombotic occlusive diseases pose a great threat to human health. thrombolytic agents are in widespread use for the dissolution of arterial and venous pathologic thrombi in these kinds of diseases. snake venom metalloproteinases (svmps) can act directly on fibrin/fibrinogen and are therefore potential candidates for therapeutic use against thrombotic occlusive diseases. in this study, we have determined the crystal structure of fii, a novel non-hemorrhagic svmp isolated from anhui agkistrodon a ... | 2005 | 16330227 |
| enzymological characterization of fii(a), a fibrinolytic enzyme from agkistrodon acutus venom. | to study the enzymological characterization of a fibrinolytic enzyme (fii(a)) from agkistrodon acutus venom. | 2005 | 16297346 |
| primary structure and antiplatelet mechanism of a snake venom metalloproteinase, acurhagin, from agkistrodon acutus venom. | acurhagin has been characterized as a p-iii hemorrhagic metalloproteinase. we herein report the complete sequence of acurhagin by molecular cloning. analysis of the cdna-predicted amino acid sequence encoding acurhagin precursor revealed that this mosaic asn-linked glycoprotein possesses a multidomain structure including a proprotein, a metalloproteinase, a disintegrin-like and a cysteine-rich domains (189/205/102/114 residues), with an overall 87% identity to that of jararhagin, an integrin alp ... | 2005 | 16023283 |
| a c-type lectin-like protein from agkistrodon acutus venom binds to both platelet glycoprotein ib and coagulation factor ix/factor x. | agkisacutacin, a c-type lectin-like protein (clp) isolated from agkistrodon acutus venom, had been previously identified as an antagonist of platelet aggregation induced by ristocetin, as well as a certain extent fibrinogenlytic activity. in this study, agkisacutacin was further purified by three-step chromatography, and its biological functions were characterized. agkisacutacin after further purification retained the effect on ristocetin-induced, von willebrand factor-dependent platelet aggrega ... | 2005 | 15925567 |
| effects of metal ions and an inhibitor on the fluorescence and activity of acutolysin a from agkistrodon acutus venom. | acutolysin a, a protein isolated from the venom of chinese five-pace snake (agkistrodon acutus) has shown marked hemorrhagic and proteolytic activities. in the present study, the effects of metal ions and an inhibitor edta on the fluorescence and function of autolysin a have been studied, by following fluorescence and activity measurements. acutolysin a contains a ca(2+)-binding site, which provides it with important structural stability, and a zn(2+)-binding site, which is essential for its enz ... | 2005 | 23923569 |
| recombinant production of fibrinogenase iv from agkistrodon acutus venom and its preliminary evaluation. | a novel metalloproteinase, recombinant fibrinogenase iv (rfiva), was expressed and purified from agkistrodon acutus venom. it is a single-chain protein with an apparent molecular weight of 27 kda. western blot showed that it had a good immunological reaction against anti-fiva rabbit serum. the kinetic parameters km and kcat of rfiva on the substrate t6140 were 7.471 x 10(-4) mol/l and 5.103 x 10(-5) s(-1). rfiva cleaved preferentially the alpha-chain, and the beta- and gamma-chains of fibrinogen ... | 2006 | 16429282 |
| structural models of the snake venom factor v activators from daboia russelli and daboia lebetina. | blood coagulation factor v (fv) is a multifunctional protein that circulates in human plasma as a precursor molecule which can be activated by thrombin or activated factor x (fxa) in order to express its cofactor activity in prothrombin activation. fv activation is achieved by limited proteolysis after arg709, arg1018, and arg1545 in the fv molecule. the venoms of daboia russelli and daboia lebetina contain a serine protease that specifically activates fv by a single cleavage at arg1545. we have ... | 2006 | 16807918 |
| effects of rare earth ions on the conformational stability of anticoagulation factor ii from agkistrodon acutus venom probed by fluorescent spectroscopy. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is an activated coagulation factor x-binding protein in a ca(2+)-dependent fashion with marked anticoagulant activity. the equilibrium unfolding of rare earth ions (re(3+))-reconstituted acf ii in guanidine hydrochloride (gdnhcl) solution was studied by fluorescence. the gdnhcl-induced unfolding of re(3+) (nd(3+), sm(3+), eu(3+), gd(3+))-reconstituted acf ii follows a three-state transition with a stable intermediat ... | 2006 | 16475157 |
| a catalog for transcripts in the venom gland of the agkistrodon acutus: identification of the toxins potentially involved in coagulopathy. | agkistrodon acutus is a special agkistrodon halys, only distributed in southern china, with a few exceptions in vietnam. it is a cherished element used in traditional chinese medicine. in order to produce a global panorama of gene expression in the agkistrodon acutus venom gland, a non-normalized cdna library was constructed, and 8696 high quality 5' end expressed sequenced tags (ests) were sequenced and analyzed. the initial sequences were assembled into 2855 clusters. of these clusters, only 4 ... | 2006 | 16438937 |
| thrombin-like enzymes from venom gland of deinagkistrodon acutus: cdna cloning, mechanism of diversity and phylogenetic tree construction. | to clone cdnas of thrombin-like enzymes (tles) from venom gland of deinagkistrodon acutus and analyze the mechanisms by which their structural diversity arose. | 2006 | 16412268 |
| transcriptome analysis of deinagkistrodon acutus venomous gland focusing on cellular structure and functional aspects using expressed sequence tags. | the snake venom gland is a specialized organ, which synthesizes and secretes the complex and abundant toxin proteins. though gene expression in the snake venom gland has been extensively studied, the focus has been on the components of the venom. as far as the molecular mechanism of toxin secretion and metabolism is concerned, we still knew a little. therefore, a fundamental question being arisen is what genes are expressed in the snake venom glands besides many toxin components? | 2006 | 16776837 |
| effects of metal ions on the conformation and activity of acutolysin d from agkistrodon acutus venom. | acutolysin d, isolated from the venom of agkistrodon acutus, possesses marked haemorrhagic and proteolytic activities. the molecular weight and the absorption coefficients (a (1%) (280)) of acutolyisn d have been determined to be 47,850 +/- 8 amu and 9.3 by mass spectrometer and uv spectrum, respectively. the effects of metal ions on the conformation and activity of acutolysin d have been studied by following fluorescence, circular dichroism and biological activity measurements. acutolysin d con ... | 2006 | 17089193 |
| calcium ion-induced stabilization and refolding of agkisacutacin from agkistrodon acutus venom studied by fluorescent spectroscopy. | agkisacutacin isolated from the venom of agkistrodon acutus is a coagulation factor ix / coagulation factor x-binding protein with marked anticoagulant- and platelet-modulating activities. ca(2+) ion-induced stabilization and refolding of agkisacutacin have been studied by following fluorescent measurements. ca(2+) ions not only increase the structural stability of agkisacutacin against gdnhcl denaturation, but also induce its refolding. the gdnhcl-induced unfolding of the apo-agkisacutacin and ... | 2007 | 17279335 |
| metal ions- and ph-induced conformational changes of acutolysin a from agkistrodon acutus venom probed by fluorescent spectroscopy. | acutolysin a isolated from the venom of agkistrodon acutus is a protein of 22 kda with marked haemorrhagic and proteolytic activities. the metal ions- and ph-induced conformational changes of acutolysin a have been studied by following fluorescence and activity measurements. here, we provide evidence for the fact that native holo-acutolysin a adopts two subtly different conformations, native state a (na) stable in the weak acidic ph range from 6.0 to 7.0 with low activity and native state b (nb) ... | 2007 | 17063468 |
| actx-8, a cytotoxic l-amino acid oxidase isolated from agkistrodon acutus snake venom, induces apoptosis in hela cervical cancer cells. | actx-8 is a protein isolated from agkistrodon acutus snake venom in our laboratory. it demonstrates cytotoxic activity on various carcinoma cell lines in vitro. however, the mechanism by which actx-8 inhibits cell proliferation remains poorly understood. in this study the influence of actx-8 on the activation of apoptotic pathway in hela cells was investigated. we demonstrated that cell death induced by actx-8 was concentration- and time-dependent. apoptotic changes such as phosphatidyl serine e ... | 2007 | 17275856 |
| a cytotoxin isolated from agkistrodon acutus snake venom induces apoptosis via fas pathway in a549 cells. | actx-6 is a protein isolated from agkistrodon acutus snake venom and demonstrated cytotoxic activity to various cancer cells in vitro. in this paper the exact mechanism in actx-6-induced cell death was investigated and it was found that actx-6 could induce cell apoptosis. the results of western blot and rt-pcr showed that actx-6 could induce fas and fasl protein expression. when fas signaling pathway was blocked by neutralizing antibodies to fas or fasl, actx-6-induced apoptosis was inhibited. d ... | 2007 | 17544616 |
| the effect of fibrinolytic enzyme fiia from agkistrodon acutus venom on disseminated intravascular coagulation in rabbits. | a novel fibrinolytic enzyme, fii(a), was isolated from agkistrodon acutus venom, which can degrade fibrin/fibrinogen and dissolve thrombus without activating plasminogen or influencing the activities of tissue plasminogen activator (t-pa) and plasminogen activator inhibitor type-1 (pai-1). in this study, we evaluated the effect of fii(a) on lipopolysaccharide (lps)-induced experimental disseminated intravascular coagulation (dic) in rabbits, through the continuous infusion of 100-microg/kg/h lps ... | 2007 | 17964518 |
| purification and functional characterization of aav1, a novel p-iii metalloproteinase, from formosan agkistrodon acutus venom. | aav1, an alkaline glycoprotein (gp), was purified from agkistrodon acutus venom by two chromatographic steps on successive deae-sephadex a-50 and superdex 75 fplc columns. aav1 on sds-page under non-reducing conditions migrated as a monomeric and a polymeric forms with apparent molecular mass of 57 and 180 kda, respectively. upon reduction, it appeared as a single broad band with a mass of 50.3 kda corresponding to the size of a typical p-iii metalloproteinase acurhagin. the n-terminal sequence ... | 2007 | 17029743 |
| molecular phylogeography of endangered sharp-snouted pitviper (deinagkistrodon acutus; reptilia, viperidae) in mainland china. | using phylogenetic and population genetic approaches, the present study reports the phylogeographic structure of the sharp-snouted pitviper (deinagkistrodon acutus), a threatened snake species with commercial and medicinal importance in china. the entire mitochondrial nd2 gene (nadh dehydrogenase subunit 2) sequences of 86 individuals of d. acutus from 14 localities across its range in china were determined. based on the results of phylogenetic analyses, distribution of diagnostic sites, haploty ... | 2007 | 17643319 |
| affinity purification of serine proteinase from deinagkistrodon acutus venom. | an affinity protocol was developed for the preparation of the main serine proteinase from deinagkistrodon acutus venom on industrial scales. as affinity ligand, l-arginine was composed to medium and its structure was confirmed by esi-ms analysis. the purification process consisted of one major affinity chromatography step to remove more than 95% of other proteins, and a polishing step of deae ion-exchange chromatography for removal of minor contaminants. the serine proteinase was 100% pure analy ... | 2007 | 17904430 |
| agglucetin, a tetrameric c-type lectin-like venom protein, regulates endothelial cell survival and promotes angiogenesis by activating integrin alphavbeta3 signaling. | agglucetin, a platelet glycoprotein (gp)ib binding protein from formosan agkistrodon acutus (a. acutus) venom, could sustain human umbilical vein endothelial cell (huvec) proliferation and huvec adhering to immobilized agglucetin showed extensive spreading, which was strongly abrogated by integrin antagonists 7e3 and triflavin. flow cytometric analyses confirmed the expression of gpib complex on huvec is absent and fluorescein isothiocyanate (fitc)-agglucetin binds to huvec in a dose-dependent a ... | 2008 | 18312855 |
| recombinant fibrinogenase from agkistrodon acutus venom protects against sepsis via direct degradation of fibrin and tnf-alpha. | severe sepsis remains a leading cause of death and disability because of less effective therapy available for this disease. a complex interplay between the inflammatory factors and the coagulation pathways seems to be the fundamental mechanisms for the pathogenesis of sepsis. here we report that recombinant fibrinogenase ii (rf ii) from agkistrodon acutus plasmin-independently degraded the thrombi, and inhibited inflammatory responses by direct and specific degradation of tumor necrosis factor a ... | 2008 | 18634754 |
| isolation and characterization of actx-6: a cytotoxic l-amino acid oxidase from agkistrodon acutus snake venom. | the characterization of an l-amino acid oxidase purified from agkistrodon acutus snake venom was investigated. an l-amino acid oxidase (laao) was purified from a. acutus snake venom through deae sepharose f.f. and source 30 s chromatography. the molecular mass of this enzyme was determined by sds-page, size exclusion chromatography, and mass spectrometry. substrate specificity, cytotoxicity, antitumor activity in vivo, and apoptosis-inducing activity were assayed. the laao purified from a. acutu ... | 2008 | 18415865 |
| a novel phospholipase a2 from agkistrodon blomhoffii ussurensis venom: purification, proteomic, functional and structural characterizations. | a phospholipase a(2) was isolated from the snake venom of chinese agkistrodon blomhoffii ussurensis by column chromatography using deae sephadex a-50 ion-exchange chromatography, sephadex g-75 gel filtration chromatography and mono q ion-exchange chromatography, and designated as akbu-pla(2). it showed an average molecular mass of 13,980+/-3 amu determined by maldi tof mass spectrometry. protein identification results from hplc-nesi-ms/ms analysis indicated that the akbu-pla(2) was a new snake v ... | 2009 | 19278623 |
| determination of the structure form of the fourth ligand of zinc in acutolysin a using combined quantum mechanical and molecular mechanical simulation. | acutolysin a, which is isolated from the snake venom of agkistrodon acutus, is a member of the svmps subfamily of the metzincin family, and it is a snake venom zinc metalloproteinase possessing only one catalytic domain. the catalytic zinc ion, in the active site, is coordinated in a tetrahedral manner with three imidazole nitrogen atoms of histidine and one oxygen atom. it is uncertain whether this oxygen atom is a water molecule or a hydroxide ion just from the three-dimensional x-ray crystal ... | 2009 | 19191509 |
| enzymatic activities and functional characterization of a novel recombinant snake venom proteinase from agkistrodon acutus. | snake venom from agkistrodon acutus consists of a number of compounds which may potentially be used as drugs. however, it is hard to obtain enough pure protein for drug development. recently, we reported expression and purification of a novel recombinant fibrinogenase which was named rfii. here we reported for the first time the enzymatic activities and functional characterization of rfii. circular dichroism spectra showed the gross conformation of fiia and rfii to be notably similar. it is an a ... | 2009 | 19013210 |
| structural and biological characterization of a novel acutobin-like enzyme isolated from the venom of the sharp-nosed pit viper (deinagkistrodon acutus). | we previously reported the purification of a serine proteinase from the venom of the sharp-nosed pit viper (deinagkistrodon acutus) using a combination of affinity chromatography and ion-exchange chromatography [xin, dong, wang and li, r. (2007) j. chromatogr. b 859, 111-118]. the high fibrinogen-clotting activity [2025 nih (national institutes of health) units/mg] of this protein indicated that it may have great potential as a drug for treating thrombolysis. in order to systemically determine t ... | 2009 | 18643779 |
| identification of an unusual at(d)pase-like activity in multifunctional nad glycohydrolase from the venom of agkistrodon acutus. | nad-glycohydrolases (nadases) are ubiquitous enzymes that possess nad glycohydrolase, adpr cyclase or cadpr hydrolase activity. all these activities are attributed to the nadase-catalyzed cleavage of c-n glycosyl bond. aa-nadase purified from the venom of agkistrodon acutus is different from the known nadases, for it consists of two chains linked with disulfide-bond(s) and contains one cu(2+) ion. here, we show that aa-nadase is not only able to cleave the c-n glycosyl bond of nad to produce adp ... | 2009 | 18952139 |
| novel recombinant fibrinogenase of agkistrodon acutus venom protects against lps-induced dic. | disseminated intravascular coagulation (dic) is an acquired syndrome characterized by the widespread activation of coagulation. this leads to failure of multiple organs in the body and finally death. because there is no effective therapy for dic, the clinical prognosis is poor and the mortality is high. | 2009 | 19070354 |
| purification and characterization of anti-clotting protein component (acpf-7221) from venom of agkistrodon acutus. | snake venom contains a number of components with different pharmacological and biological activities, especially in cancer therapy, and has increasingly become a research focus. this study was designed to isolate and purify a novel anti-clotting protein component from the venom of agkistrodon acutus, and to explore its physico-chemical properties and biological activity. | 2009 | 19781305 |
| biochemical and hemostatic mechanism of a novel thrombin-like enzyme. | thrombin-like enzyme (tle) plays a significant role in vessel injury hemostasis. a novel snake venom tle (agacutin) was purified from agkistrodon acutus snake venom. structural analysis indicated that agacutin is a heterodimer that has a mw of 29,402 da, a pi value of 5.39, and optimum activity at 35 degrees c and ph 7.5. the n-terminal 15 amino acid sequences of agacutin are dssgwssyegheyyv (small subunit) and dcssgwssyeehqyy (large subunit). in vitro studies indicated that the coagulation acti ... | 2009 | 19683796 |
| a novel anti-platelet aggregation tripeptide from agkistrodon acutus venom: isolation and characterization. | aap, a tripeptide that inhibited rabbit platelet aggregation, was isolated from agkistrodon acutus venom by ion-exchange, gel filtration and reverse-phase chromatography. amino acid sequences which determined mainly by amino acid analyses and nmr spectroscopy indicated it was a tripeptide including pyroglutamic acid, asparagine and tryptophane residues. the esms experiment assigned a molecular weight of 429 da. aap inhibited rabbit platelet aggregation induced by adp, paf-acether, collagen and t ... | 2009 | 19345702 |
| effect of metal ion substitutions in anticoagulation factor i from the venom of agkistrodon acutus on the binding of activated coagulation factor x and on structural stability. | anticoagulation factor i (acf i) isolated from the venom of agkistrodon acutus is an activated coagulation factor x (fxa)-binding protein that binds in a ca(2+)-dependent fashion with marked anticoagulant activity. the thermodynamics of the binding of alkaline earth metal ions to acf i and the effects of alkaline earth metal ions on the guanidine hydrochloride (gdnhcl)-induced unfolding of acf i and the binding of acf i to fxa were studied by isothermal titration calorimetry, fluorescence, circu ... | 2009 | 19184130 |
| terminal disialylated multiantennary complex-type n-glycans carried on acutobin define the glycosylation characteristics of the deinagkistrodon acutus venom. | glycosylation analysis of nonmammalian sources often springs surprises and conjures up intriguing views of evolutionary adaptation. many of the constituents of snake venoms are known to be glycosylated and yet very few were fully characterized and accorded specific functions. in the process of glycomic screening through the venoms from asian pit vipers, a partially o-acetylated neuacα2-8neuacα2-3galβ1-4glcnacβ1-terminal epitope was found to be the predominant glycosylation characteristic of the ... | 2010 | 21106559 |
| rosmarinic acid in argusia argentea inhibits snake venom-induced hemorrhage. | a methanolic extract of argusia (or messerschmidia or tournefortia) argentea (boraginaceae) significantly inhibited hemorrhage induced by crude venom of trimeresurus flavoviridis. the extract was then separated according to antivenom activity by using silica gel column chromatography and hplc equipped with an octadecylsilanized silica gel (ods) column to afford rosmarinic acid (ra) (1) as an active principle. ra (1) significantly inhibited the hemorrhagic effect of crude venoms of t. flavoviridi ... | 2010 | 20512530 |
| identification of a nitric oxide-dependent hypotensive effect of anticoagulation factor ii from the venom of agkistrodon acutus. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is a member of the coagulation factor ix/coagulation factor x-binding protein (ix/x-bp) family. acf ii forms a 1:1 complex with activated coagulation factor x in a ca(2+)-dependent fashion and thereby blocks the amplification of the coagulation cascade. in the present study, we have investigated the effect of acf ii on the mean arterial blood pressure (mabp) and heart rate (hr) in anaesthetized rats. the results ind ... | 2010 | 19723511 |
| structural characterization of n-linked oligosaccharides of defibrase from agkistrodon acutus by sequential exoglycosidase digestion and maldi-tof mass spectrometry. | detailed structures of n-linked oligosaccharides of defibrase, a highly active thrombin like enzyme (tle) purified from the venom of agkistrodon acutus, were successfully characterized using maldi-tof mass spectrometry in combination with sequential exoglycosidase digestion. monosaccharide composition analysis was performed by high performance anion-exchange chromatography with pulsed amperometric detection (hpaec-pad). galactose(gal), mannose(man), fucose(fuc), n-acetylglucosamine (glcnac), and ... | 2010 | 19800908 |
| characterization and molecular cloning of one novel c-type lectin from the venom of taiwan habu (trimeresurus mucrosquamatus). | one novel snake venom factor (termed trimecetin) was isolated and purified from the venom of taiwan habu (trimeresurus mucrosquamatus). the purified venom factor was shown to consist of two subunit chains linked by one disulfide bond. this two-chain factor showed high sequence homology at their n-terminal segments to some previously reported venom proteins such as alboaggregin-b isolated from trimeresurus albolabris and agkicetin from agkistrodon acutus. the cdna clones corresponding to the two ... | 2010 | 19931300 |
| effects of heating on the immunogenicity and biological toxicity of deinagkistrodon acutus venom and its fractions. | to improve toxoid preparation, the effects of selective heat denaturation were assessed on deinagkistrodon acutus venom. the venom and its fractions (peak 1 and peak 2 separated by gel filtration chromatography) were heated to various temperatures (45-70 degrees c) for 30 min, after which protein concentration, immunoreactivity, lethality, myotoxicity and hemorrhagic and membrane lysis activities of the samples were determined. in addition, the synergistic effects of the venom fractions were eva ... | 2010 | 20331994 |
| multi-host model-based identification of armillifer agkistrodontis (pentastomida), a new zoonotic parasite from china. | pentastomiasis is a rare parasitic infection of humans. pentastomids are dioecious obligate parasites requiring multiple hosts to complete their lifecycle. despite their worm-like appearance, they are commonly placed into a separate sub-class of the subphylum crustacea, phylum arthropoda. however, their systematic position is not uncontested and historically, they have been considered as a separate phylum. | 2010 | 20386597 |
| acurhagin-c, an ecd disintegrin, inhibits integrin alphavbeta3-mediated human endothelial cell functions by inducing apoptosis via caspase-3 activation. | acurhagin, a member of versatile metalloproteinase disintegrins from agkistrodon acutus venom, has been identified as a platelet aggregation inhibitor, previously. here, acurhagin-c, the c-terminal glu-cys-asp (ecd)-containing fragment of acurhagin, was evaluated for its biological activities and potential applications in anti-angiogenic therapy. | 2010 | 20590625 |
| a novel recombinant snake venom metalloproteinase from agkistrodon acutus protects against taurocholate-induced severe acute pancreatitis in rats. | severe acute pancreatitis (sap) remains a challenging disease to manage, with high mortality, limited understanding of pathogenesis and lack of specific therapy. recombinant fibrinogenase ii (rfii) from agkistrodon acutus venom has been found to degrade tumor necrosis factor-alpha (tnf-α) which is vital in mortality of sap. here we investigate the in vivo effects of rfii in rat sap and confirm the degradation effect of rfii for tnf-αin vitro. the sap model was prepared by retrograde infusion of ... | 2010 | 20600562 |
| metal ions binding to nad-glycohydrolase from the venom of agkistrodon acutus: regulation of multicatalytic activity. | aa-nadase from agkistrodon acutus venom is a unique multicatalytic enzyme with both nadase and at(d)pase activities. among all identified nadases, only aa-nadase contains cu(2+) ions that are essential for its multicatalytic activity. in this study, the interactions between divalent metal ions and aa-nadase and the effects of metal ions on its structure and activity have been investigated by equilibrium dialysis, isothermal titration calorimetry, fluorescence, circular dichroism, dynamic light s ... | 2010 | 21072348 |
| small-molecule reductants inhibit multicatalytic activity of aa-nadase from agkistrodon acutus venom by reducing the disulfide-bonds and cu(ii) of enzyme. | aa-nadase from agkistrodon acutus venom is a unique multicatalytic enzyme with both nadase and at(d)pase activities. among all identified nadases, only aa-nadase contains cu(ii) and has disulfide-bond linkages between two peptide chains. the effects of the reduction of the disulfide-bonds and cu(ii) in aa-nadase by small-molecule reductants on its nadase and adpase activities have been investigated by polyacrylamide gel electrophoresis, high performance liquid chromatography, electron paramagnet ... | 2010 | 19780128 |
| within-clutch variation in venoms from hatchlings of deinagkistrodon acutus (viperidae). | we used 17 hatchling five-paced pit-vipers snakes (deinagkistrodon acutus) to study within-clutch variation in snake venoms. we measured venom yield and total protein content, and examined the correlations between venom yield and hatchling size [snout-vent length (svl) and body mass]. we also analyzed the electrophoretic profiles and enzymatic activities of venoms from hatchlings. lyophilized venom mass was not correlated with svl, nor with body mass. liquid venom mass and total protein content ... | 2011 | 21459103 |
| metal ion binding to anticoagulation factor ii from the venom of agkistrodon acutus: stabilization of the structure and regulation of the binding affinity to activated coagulation factor x. | anticoagulation factor ii (acf ii) isolated from the venom of agkistrodon acutus is an activated coagulation factor x (fxa)-binding protein with both anticoagulant and hypotensive activities. the thermodynamics of the binding of alkaline earth metal ions to acf ii and their effects on the stability of acf ii and the binding of acf ii to fxa were investigated by isothermal titration calorimetry, fluorescence, differential scanning calorimetry, and surface plasmon resonance. the binding of acf ii ... | 2011 | 21197556 |
| the effect of the fibrinolytic enzyme fiia from agkistrodon acutus venom on acute pulmonary thromboembolism. | to evaluate the effects of the fibrinolytic enzyme fii(a) from agkistrodon acutus venom on acute pulmonary thromboembolism (apt) in animal models. | 2011 | 21293476 |
| separation and identification of proteins obtained from agkistrodon acutus snake venom by capillary zone electrophoresis and laser desorption/ionization mass monitoring. | fractions of seven protein principles with fibrinolytic or thrombin-like activities obtained from agkistrodon acutus snake venom purified by two steps of normal pressure chromatography were separated further by capillary zone electrophoresis (cze). mass determination for these fractions were achieved by performing laser desorption/ionization mass monitoring (ldim). the comparative study between cze and ldim on the separation of these fractions was made. | 2011 | 8075526 |
| glomerular injury in mice induced by agkistrodon venom. | glomerular injury was produced in mice after a single ld50 intravenous dose of purified 100-pace snake venom (agkistrodon acutus). characteristic features in glomeruli where the venom was demonstrated immunohistochemically included cystic lesions of the capillary tufts, thrombosis, subsequent proliferative and sclerotic changes, and crescent formation. venom was recognized immunohistochemically in the glomerular endothelium, visceral basement membrane, mesangium, epithelium, and bowman's capsule ... | 2012 | 3511722 |
| cloning of cdnas and molecular characterisation of c-type lectin-like proteins from snake venoms. | c-type lectin-like proteins (ctlps) isolated from snake venoms are the largest and most complex non-mammalian vertebrate c-type lectin-like domain family. in the present study, we simultaneously amplified four cdnas encoding different types of ctlp subunits from the venoms of two different species of snakes by rt-pcr with a single sense primer and a nested universal primer - two ctlp subunit-encoding cdnas were cloned from deinagkistrodon acutus venom and two from agkistrodon halys pallas venom. ... | 2012 | 23010162 |
| ca(2+) -induced binding of anticoagulation factor ii from the venom of agkistrodon acutus with factor ix. | anticoagulation factor ii (acf ii), a coagulation factor x- binding protein from the venom of agkistrodon acutus has both anticoagulant and hypotensive activities. previous studies show that acf ii binds specifically with activated factor x (fxa) in a ca(2+) -dependent manner and inhibits intrinsic coagulation pathway. in this study, the inhibition of extrinsic coagulation pathway by acf ii was measured in vivo by prothrombin time assay and the binding of acf ii to factor ix (fix) was investigat ... | 2012 | 22806501 |
| an indirect sandwich elisa for the determination of agkisacutacin in human serum: application to pharmacokinetic study in chinese healthy volunteers. | the platelet receptor glycoprotein ib-ix-v complex (gpib-ix-v) plays a dominant role in the first step of platelet adhesion and arterial thrombus formation. agkisacutacin, a c-type lectin-like protein (clp) from agkistrodon acutus venom, had been previously identified as an antagonist of platelet aggregation and a membrane glycoprotein ib-binding protein (gpib-bp). for the analysis of pharmacokinetics of agkisacutacin, an indirect sandwich enzyme-linked immunosorbent assay (elisa) was establishe ... | 2012 | 22738788 |
| a novel fibrinogenase from agkistrodon acutus venom protects against dic via direct degradation of thrombosis and activation of protein c. | the incidence of disseminated intravascular coagulation (dic), which leads to multiple organ dysfunction and high mortality, has remained constant in recent years. at present, treatments of dic have focused on preventing cytokine induction, inhibiting coagulation processes and promoting fibrinolysis. recent clinical trials have supported the use of antithrombin and activated protein c supplementation in dic. to better understand the mechanism of treatment on dic, we here report a novel fibrinoge ... | 2012 | 22728069 |
| [component i from agkistrodon acutus venom induces apoptosis of k562/a02 cells by promoting caspase 3 expression]. | to investigate the effects of component i from agkistrodon acutus venom (aavc-i) on the biological features of chronic myeloid leukemia cells, k562/a02 leukemia cells were cultured in the presence of aavc-i (6.25 - 100 µg/ml) and the proliferation status was assayed by cck-8 method. morphological changes were observed by inversed microscope after giemsa and hochest 33258 staining, and cell apoptosis was detected by flow cytometry. caspase 3 activity was tested by using chromogenic activity assay ... | 2012 | 22541080 |
| crystal structure of agkisacucetin, a gpib-binding snake c-type lectin that inhibits platelet adhesion and aggregation. | agkisacucetin is a snake c-type lectin isolated from the venom of agkistrodon acutus (a. acutus). it binds specifically to the platelet glycoprotein (gp) ib and prevents the von willebrand factor (vwf) accessing it. we determined the crystal structure of agkisacucetin to 1.9å resolution. the structure of agkisacucetin has an (αβ) fold similar to another gpib-binding protein, flavocetin-a, but lacks the c-terminal cysteine in the β-subunit, does not form (βα)(4) tetramers, and does not cluster gp ... | 2012 | 22447656 |
| anticoagulation factor i, a snaclec (snake c-type lectin) from agkistrodon acutus venom binds to fix as well as fx: ca2+ induced binding data. | anticoagulation factor i (acf i), a snake c-type lectin (snaclec) from the venom of agkistrodon acutus binds specifically with activated factor x (fxa) in a ca2+-dependent manner and prolongs the blood-clotting time in vitro. in this study, the inhibition of the coagulation pathway by acf i was measured in vivo by activated partial thromboplastin time and prothrombin time assays and the binding of acf i to factor ix (fix) was investigated by native page and surface plasmon resonance. the results ... | 2012 | 22445822 |
| cu(ii)- and disulfide bonds-induced stabilization during the guanidine hydrochloride- and thermal-induced denaturation of nad-glycohydrolase from the venom of agkistrodon acutus. | nad-glycohydrolase (aa-nadase) from agkistrodon acutus venom is a unique multicatalytic enzyme with both nadase and at(d)pase-like activities. among all identified nadases, only aa-nadase is a disulfide-linked dimer and contains cu(2+). cu(2+) and disulfide bonds are essential for its multicatalytic activity. in this study, the effects of cu(2+) and disulfide-bonds on guanidine hydrochloride (gdnhcl)- and thermal-induced unfolding of aa-nadase have been investigated by fluorescence, circular dic ... | 2012 | 22045055 |
| purification, characterization and gene cloning of da-36, a novel serine protease from deinagkistrodon acutus venom. | a serine protease termed da-36 was isolated from crude venom of deinagkistrodon acutus. the enzyme was a single chain protein with an apparent molecular weight of 36,000 on sds-page with an isoelectric point of 6.59. da-36 could clot human plasma by cleaving the aα, bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. the proteolytic activity of da-36 toward tame was strongly inhibited by pmsf and moderately affected by benzamidine and aprotinin, indicating that it was a ... | 2013 | 23462378 |
| biochemical properties and comparative pharmacology of a coagulant from deinagkistrodon acutus snake venom. | a number of snake venom thrombin-like enzymes (tles) have already been characterized. some tles play significant roles in vessel injury hemostasis. a novel tle (agacutase) was purified from deinagkistrodon acutus snake venom by the means of sephadex g-75, deae-sepharose ff, and sephadex g-25 column chromatography. structural analysis indicated that agacutase is a single-chain glycoprotein with a molecular mass of 31,084 da, isoelectric point of 4.38, optimal activity at 37 °c and ph 6.6, sugar c ... | 2013 | 23429184 |
| determination of hemocoagulase agkistrodon in a pharmaceutical preparation by high-performance liquid chromatography with pre-column derivatization and fluorescence detection. | currently, there is no analytical method for the quantification of hemocoagulase agkistrodon (hca) in pharmaceutical preparations. this study presents a pre-column derivatization method for the quantification of hca, a compound extracted from the venom of agkistrodon acutus, in a pharmaceutical preparation (trade name suling). in the proposed method, 6-aminoquinolyl-n-hydroxysuccinimidyl carbamate was used to tag the hca substrate, and the derivatives were analyzed by high-performance liquid chr ... | 2013 | 23357044 |
| inhibition of integrins αv/α5-dependent functions in melanoma cells by an ecd-disintegrin acurhagin-c. | acurhagin-c, a glu-cys-asp (ecd)-disintegrin from agkistrodon acutus venom, has been reported as an endothelial apoptosis inducer, previously. here we further evaluate its potential applications in cancer therapy. in vitro assays indicated that acurhagin-c not only may influence the cell viability at higher concentration, but also can potently and dose-dependently decrease cell proliferation in murine b16-f10 melanoma. otherwise, it also had a dose-dependent inhibition on b16-f10 cell adhesion t ... | 2013 | 23333557 |
| immunoreactivity between venoms and commercial antiserums in four chinese snakes and venom identification by species-specific antibody. | we studied the immunoreactivity between venoms and commercial antiserums in four chinese venomous snakes, bungarus multicinctus, naja atra, deinagkistrodon acutus and gloydius brevicaudus. venoms from the four snakes shared common antigenic components, and most venom components expressed antigenicity in the immunological reaction between venoms and antiserums. antiserums cross-reacted with heterologous venoms. homologous venom and antiserum expressed the highest reaction activity in all cross-re ... | 2013 | 23142457 |
| [sequencing and analysis of the complete mitochondrial dna of chinese moccasin for medicinal use]. | to sequence and analyze the complete mitochondrial dna of chinese moccasin. | 2013 | 24218958 |
| [mitochondrial mechanisms of apoptosis of human leukemia k562 cells induced by avvc-1]. | this study was purpose to investigate apoptosis pathway of leukemia k562 cells induced by anticoagulant fraction from agkistrodon acutus venom (avvc-1). the mitochondrial transmembrane potential (δψm) of leukemia k562 cells was detected by flow cytometry with jc-1 single staining. the expression of cytochrome c in the mitochondrial of leukemia k562 cells was analyzed by western blot after avvc-1 treatment. the distribution of cytochrome c in leukemia k562 cells was measured by immuno-fluorescenc ... | 2013 | 23815904 |
| [application of capillary zone electrophoresis in the interaction analysis of protein c with protein c activator from agkistrodon acutus venom]. | a new capillary zone electrophoresis method (cze) has been established for the interaction analysis of protein c (pc) with a protein c activator (pca) from agkistrodon acutus venom. the analysis was performed on an uncoated fused-silica capillary with 75 microm i.d. and a total length of 60.2 cm (50 cm to the detector) with a buffer solution of 50 mmol/l tris-hcl (ph 7.4) and 198 nm of wavelength. the factors which influence the separation of the pca, such as buffer solution and ion concentratio ... | 2013 | 23667991 |
| a novel recombinant fibrinogenase of agkistrodon acutus venom protects against hyperacute rejection via degradation of complements. | hyperacute rejection (har) is a main barrier in xenotransplantation, which is mediated by the combination of natural antibody to the xenograft and complement activation. current therapies have focus on the inhibition of complement by development of complement inhibitor and transgenic animal organ. here, we investigated the effects of rfii, a recombinant fibrinogenase from agkistrodon acutus venom, on complement and har. the degradation effect of rfii on complement was tested by sds-page, ch50 ex ... | 2013 | 23178656 |
| [extraction, purification and identification of type ii collagen from agkistrodon acutus]. | the object of the research was to extract, purify and identify the type ii collagen of agkistrodon acutus. type ii collagen of a. acutus was extracted by enzyme decomposition method, and purified by ion exchange column chromatography. it was characterized by sds-page gel electrophoresis, ultraviolet spectrophotometry, infrared absorption spectroscopy and mass spectroscopy. the results showed that the size of c ii was about 130 kda. it absorbed at 223 nm. ir spectrum obtained showed that the trip ... | 2013 | 24494552 |
| correlation between the glycan variations and defibrinogenating activities of acutobin and its recombinant glycoforms. | acutobin isolated from deinagkistrodon acutus venom has been used to prevent or treat stroke in patients. this defibrinogenating serine protease is a 39 kda glycoprotein containing terminal disialyl-capped n-glycans. after sialidase treatment, the enzyme showed similar catalytic activities toward chromogenic substrate, and cleaved the aα chain of fibrinogen as efficiently as the native acutobin did. however, the level of fibrinogen degradation products in mice after i.p.-injection of desialylate ... | 2014 | 24945257 |
| purification and partial characterization of a novel fibrinogenase from the venom of deinagkistrodon acutus: inhibition of platelet aggregation. | a novel fibrinogenase, danase, was purified from the venom of deinagkistrodon acutus by a combination of anion and cation exchange chromatography. unlike other fibrinogenases which are usually single polypeptide chain proteins, the enzyme was a disulfide-linked dimer with an isoelectric point of 6.03 and an apparent molecular weight of 25kda on sds-polyacrylamide gel electrophoresis. danase showed α-fibrinogenase activity devoid of fibrinolytic activity. it hydrolyzed rapidly the aα-chain of fib ... | 2014 | 24755064 |
| [application of rapid pcr to authenticate medicinal snakes]. | to obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in chinese pharmacopoeia (zaocysd humnades, bungarus multicinctus, agkistrodon acutus), a rapid pcr method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. dna was extracted by alkaline lysis and the specific primers were amplified by two-steps pcr amplification method. the denatured and annealing temperature and cycle numbers were optimiz ... | 2014 | 25612419 |
| a critical role for the regulation of syk from agglutination to aggregation in human platelets. | agglucetin, a tetrameric glycoprotein (gp) ibα agonist from formosan agkistrodon acutus venom, has been characterized as an agglutination inducer in human washed platelets (wps). in platelet-rich plasma (prp), agglucetin dramatically elicits a biphasic response of agglutination and subsequent aggregation. for clarifying the intracellular signaling events from agglutination to aggregation in human platelets, we examined the essential signaling molecules involved through the detection of protein t ... | 2014 | 24326074 |